ID: 1001923851

View in Genome Browser
Species Human (GRCh38)
Location 5:175621995-175622017
Sequence CTCTGGACACCAAGGCTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001923851_1001923858 2 Left 1001923851 5:175621995-175622017 CCACCAAGCCTTGGTGTCCAGAG No data
Right 1001923858 5:175622020-175622042 TTTATTGGGGTTTGATTTTGTGG No data
1001923851_1001923861 24 Left 1001923851 5:175621995-175622017 CCACCAAGCCTTGGTGTCCAGAG No data
Right 1001923861 5:175622042-175622064 GGCATGACTGGTTAAGTCACTGG No data
1001923851_1001923859 3 Left 1001923851 5:175621995-175622017 CCACCAAGCCTTGGTGTCCAGAG No data
Right 1001923859 5:175622021-175622043 TTATTGGGGTTTGATTTTGTGGG No data
1001923851_1001923860 12 Left 1001923851 5:175621995-175622017 CCACCAAGCCTTGGTGTCCAGAG No data
Right 1001923860 5:175622030-175622052 TTTGATTTTGTGGGCATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001923851 Original CRISPR CTCTGGACACCAAGGCTTGG TGG (reversed) Intergenic
No off target data available for this crispr