ID: 1001924619

View in Genome Browser
Species Human (GRCh38)
Location 5:175627191-175627213
Sequence GGCCTCGGCGGGGTTTCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001924609_1001924619 20 Left 1001924609 5:175627148-175627170 CCAAGTCCTGGTGCTCTGCTGCT No data
Right 1001924619 5:175627191-175627213 GGCCTCGGCGGGGTTTCCCTAGG No data
1001924610_1001924619 14 Left 1001924610 5:175627154-175627176 CCTGGTGCTCTGCTGCTGACTGG No data
Right 1001924619 5:175627191-175627213 GGCCTCGGCGGGGTTTCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001924619 Original CRISPR GGCCTCGGCGGGGTTTCCCT AGG Intergenic
No off target data available for this crispr