ID: 1001928022 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:175653187-175653209 |
| Sequence | GTGGTAGGGCACCTGAACTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1001928022_1001928028 | 4 | Left | 1001928022 | 5:175653187-175653209 | CCACAGTTCAGGTGCCCTACCAC | No data | ||
| Right | 1001928028 | 5:175653214-175653236 | CCAGAGCTACCACACAGCACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1001928022 | Original CRISPR | GTGGTAGGGCACCTGAACTG TGG (reversed) | Intergenic | ||