ID: 1001928022

View in Genome Browser
Species Human (GRCh38)
Location 5:175653187-175653209
Sequence GTGGTAGGGCACCTGAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001928022_1001928028 4 Left 1001928022 5:175653187-175653209 CCACAGTTCAGGTGCCCTACCAC No data
Right 1001928028 5:175653214-175653236 CCAGAGCTACCACACAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001928022 Original CRISPR GTGGTAGGGCACCTGAACTG TGG (reversed) Intergenic