ID: 1001929205

View in Genome Browser
Species Human (GRCh38)
Location 5:175660757-175660779
Sequence TAGACTGAATTGCCTCTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001929200_1001929205 15 Left 1001929200 5:175660719-175660741 CCACGTATCTGAGTGTGCCCTGT 0: 1
1: 0
2: 2
3: 1
4: 90
Right 1001929205 5:175660757-175660779 TAGACTGAATTGCCTCTAAAAGG 0: 1
1: 0
2: 1
3: 11
4: 146
1001929203_1001929205 -3 Left 1001929203 5:175660737-175660759 CCTGTCTCAGGCCTACAATATAG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1001929205 5:175660757-175660779 TAGACTGAATTGCCTCTAAAAGG 0: 1
1: 0
2: 1
3: 11
4: 146
1001929202_1001929205 -2 Left 1001929202 5:175660736-175660758 CCCTGTCTCAGGCCTACAATATA 0: 1
1: 0
2: 2
3: 10
4: 118
Right 1001929205 5:175660757-175660779 TAGACTGAATTGCCTCTAAAAGG 0: 1
1: 0
2: 1
3: 11
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001929205 Original CRISPR TAGACTGAATTGCCTCTAAA AGG Intronic
900850878 1:5142112-5142134 TAAACTTAATTGCCTCCCAAAGG + Intergenic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
907888533 1:58616559-58616581 CAAACTGAATTGCCTTTAATTGG - Intergenic
910196557 1:84647145-84647167 TAGACTGAGTTTCCTCTTATAGG - Exonic
910695949 1:90015868-90015890 TAGATTGAAGTGACTCTAATGGG + Intronic
916544396 1:165788606-165788628 TAGAGGGAAATGACTCTAAAAGG + Intronic
917418376 1:174835397-174835419 TAAATTGAATTGCCTATAAAAGG - Intronic
919028413 1:192206872-192206894 TAAACTTAATTACCTCTCAAAGG + Intergenic
919349846 1:196435769-196435791 GAGACAGAATTGCCTGTAATAGG + Intronic
920313028 1:205059486-205059508 TAGACAGAGTTGGCTCTGAAAGG + Intronic
921687433 1:218105972-218105994 TAGACTACCTTGCCTCTAAGTGG + Intergenic
1064160169 10:12938470-12938492 TATACTGCACTGCCTCTAGAAGG - Intronic
1068264825 10:54632942-54632964 TAGCCTGAATTCCCACTAATGGG + Intronic
1068919529 10:62467723-62467745 ATGAGTGAATTGCCTCTGAAAGG - Intronic
1069115365 10:64498635-64498657 TAAACTGAATTACCTCCCAAAGG - Intergenic
1075796224 10:125121664-125121686 TAGAATGAGTTGCTTCTAGAGGG - Intronic
1079358422 11:19749782-19749804 TAGCCTGAATTCCTTCTCAAGGG - Intronic
1079638735 11:22778014-22778036 TAGACTTAATTGGCTATTAATGG + Intronic
1081037794 11:38171081-38171103 TAGACTGAATCCTCTCCAAAGGG - Intergenic
1081306399 11:41517089-41517111 TAGATTGAATTGCTTTTAAAAGG - Intergenic
1082223978 11:49678817-49678839 GAGGCTGAATTGCTTTTAAAAGG + Intergenic
1084744540 11:71160370-71160392 TAACCTGAATTACCTCTTAAAGG - Intronic
1086169999 11:83825627-83825649 TTCACTGAATTTCCTCGAAAAGG - Intronic
1086625062 11:88940336-88940358 GAGGCTGAATTGCTTTTAAAAGG - Intronic
1092963866 12:13622849-13622871 AGGACCTAATTGCCTCTAAAAGG + Intronic
1094320644 12:29179127-29179149 TTAACTGAATTACCTCTATAAGG + Intronic
1097239115 12:57562638-57562660 TAGACTGAATTTCATTTACATGG + Intronic
1097953391 12:65457971-65457993 TGGACTGAGTTGCCTCAATATGG + Intronic
1099460974 12:82920555-82920577 TAAACTAAACTACCTCTAAAAGG - Intronic
1106001650 13:25729140-25729162 TTTACTGAATTGCCTTTACATGG + Intronic
1107308524 13:39049813-39049835 TAGCCTGAATTGCTTCAAAGAGG - Exonic
1108886949 13:55198361-55198383 AAGGCCGAATTGCCTATAAAGGG - Intergenic
1109023869 13:57135372-57135394 TATACTGAATTTTCTCTACATGG + Intergenic
1110934747 13:81273452-81273474 TAGAATGAATTGCATCTTAACGG - Intergenic
1111629272 13:90828121-90828143 TAGACCTAATTACCTCTTAAAGG + Intergenic
1113352127 13:109539538-109539560 TATAATGAATAGCCACTAAATGG + Intergenic
1115179642 14:30608532-30608554 TAGGCTGAATTTCTTCCAAAGGG + Intronic
1115736541 14:36337658-36337680 TAGATTTAATGTCCTCTAAAAGG + Intergenic
1117061390 14:51967105-51967127 TAAACCGAATTGCATCTACACGG - Exonic
1117699641 14:58400041-58400063 TAGAGTAAATTTCTTCTAAATGG + Intronic
1119496969 14:75088300-75088322 TAAACTGAGTTGCCTCAGAAAGG - Intronic
1119992427 14:79213962-79213984 TGAAATGAATTGCCTCTGAAAGG - Intronic
1120722964 14:87907260-87907282 TAGTCCTAATTGCCTCTCAAAGG - Intronic
1120866058 14:89296467-89296489 TAGGCTCATTTGCATCTAAAAGG - Intronic
1121149534 14:91619060-91619082 TATACTGAATTGCTTATTAAAGG - Intronic
1125306305 15:38319741-38319763 TTCACTGCATTGCCTATAAACGG + Intronic
1126968969 15:54088329-54088351 AAGACTGACTTGCCTCAAACTGG - Intronic
1130989492 15:88867692-88867714 TAGAATGAATGACCTCGAAATGG - Intronic
1131002606 15:88950769-88950791 CAGGCTGCATTGCCTCTACAAGG + Intergenic
1135069057 16:19336471-19336493 TAAACTTAATTACCTCCAAAAGG + Intergenic
1136850514 16:33608595-33608617 AAGACTGAATCACCTCTCAAGGG + Intergenic
1203112128 16_KI270728v1_random:1457048-1457070 AAGACTGAATCACCTCTCAAGGG + Intergenic
1150904340 17:69321572-69321594 TAAGTTTAATTGCCTCTAAATGG + Intronic
1152404748 17:80090689-80090711 TAGATTTCATTGCCTTTAAAAGG + Intronic
1155700236 18:28734331-28734353 CAGGCTGACTTGCCTCTAAGTGG - Intergenic
1156850667 18:41722078-41722100 TACACTGAAGTGTCTCTAAAAGG + Intergenic
1156973245 18:43183765-43183787 TACAAAGAATTGCCTCTTAAGGG + Intergenic
1159344474 18:67182016-67182038 TTTAATGAATTGCCTTTAAAAGG - Intergenic
926453452 2:13035940-13035962 TAGACTAAATTGGCTTTAACAGG + Intergenic
929974654 2:46620639-46620661 TAGATTGAAGTCACTCTAAAAGG - Intronic
930596543 2:53396420-53396442 TAGATTGAATTTCATCAAAATGG + Intergenic
934300197 2:91772318-91772340 CAGACTCAGTTCCCTCTAAAGGG - Intergenic
939072936 2:137565538-137565560 AAGACTCAATTGCATCTTAAAGG + Intronic
940191314 2:151042888-151042910 TAGAATAATTTGCCTCTAATAGG + Intronic
940360377 2:152790411-152790433 AAAACTGAATTACCTTTAAAAGG - Intergenic
941266607 2:163370723-163370745 TAGAATGAATTGTCTCTGACAGG + Intergenic
941311055 2:163932216-163932238 TGGACTGATTTCACTCTAAAAGG - Intergenic
941798226 2:169625360-169625382 TAGAATGAATTTCCTAGAAATGG + Intronic
942001408 2:171651762-171651784 TAGACAAAATAGCCTCAAAAGGG - Intergenic
943717279 2:191166131-191166153 CAGACTGAATGCCATCTAAAAGG - Intergenic
943888594 2:193255991-193256013 TAAACTTAATTGCCTCCCAAAGG - Intergenic
945420637 2:209631903-209631925 TAGACTGAGTTGAGTCAAAAGGG + Intronic
946788136 2:223269876-223269898 TATAGTGAGTTGCTTCTAAAAGG - Intergenic
1169126967 20:3136023-3136045 AAGGGTGAATTGCCTCTAAGTGG - Intronic
1170335437 20:15265465-15265487 AAGACTGAATTGCCAAGAAAGGG - Intronic
1171055152 20:21899300-21899322 TAAACTGAATTGCAAATAAAAGG + Intergenic
1177523127 21:22256326-22256348 TAAAATAAATTGCCTGTAAAAGG + Intergenic
1177693623 21:24542185-24542207 TAGACTCAATCACCTTTAAATGG + Intergenic
1182530434 22:30951523-30951545 TAGACTGAATAGCATCTATATGG - Intronic
949242543 3:1889547-1889569 TACACTGAAATGCCTCCAATAGG + Intergenic
949673893 3:6430695-6430717 TAAAATGAATTGACTCTAATTGG - Intergenic
950846264 3:16018844-16018866 TACACAGAAATGCCTCTAATAGG - Intergenic
950969381 3:17170886-17170908 GAGACTGAATTGCCTTTAACTGG + Intronic
951023176 3:17802934-17802956 GGGACTGATTTGCCTCTCAAAGG + Intronic
955068662 3:55554249-55554271 TAGACTGAAATGGCTTTAAAAGG + Intronic
955260378 3:57383482-57383504 TAGAATGGAGTGCCTCTTAAAGG + Intronic
955871209 3:63440687-63440709 TCTACTGAATTATCTCTAAAGGG - Intronic
966577331 3:181517260-181517282 TATACTGAAATGCCATTAAAAGG - Intergenic
971326672 4:25650212-25650234 CACACTGATTTTCCTCTAAATGG - Intergenic
973668551 4:53189628-53189650 TAAACTTAATTACCTCTCAAAGG + Intronic
973754277 4:54058153-54058175 TAGACTGACTTCCCACAAAATGG + Intronic
973934732 4:55832190-55832212 TACTCTGAATTCCCTCTAGACGG + Intergenic
974473355 4:62347695-62347717 TAGACTGCATTATCTCTTAAAGG + Intergenic
975318827 4:72986227-72986249 CATACCGAATTGCCTCTATACGG + Intergenic
975550292 4:75606056-75606078 AAGAATGAATAGGCTCTAAATGG - Intronic
975954264 4:79818329-79818351 TAGACTTAATTTCAACTAAATGG + Intergenic
976981357 4:91234952-91234974 TAGGCTATATTGCCTCTCAAAGG - Intronic
977088679 4:92640763-92640785 TAGACTATATTGCCTCTACCAGG + Intronic
977222513 4:94354633-94354655 TAGAATGAACTGCCTCTTACAGG + Intergenic
977887531 4:102270623-102270645 TAGGCTGAATTGCCTCATCATGG - Intronic
977891450 4:102316822-102316844 TAAACTTAATTACCTCTCAAAGG - Intronic
978802389 4:112767816-112767838 AGGACTTAATTGCCTCAAAAAGG + Intergenic
979684054 4:123491740-123491762 TAGAATGTTTTGCCTCAAAAAGG + Intergenic
986363469 5:7004939-7004961 TAGACTGAATTATCTCCCAAGGG - Intergenic
986511021 5:8506309-8506331 GTGACTGAATTACCTCTACATGG - Intergenic
987981490 5:25090673-25090695 TAGAGTGAAATGCCACTGAAAGG + Intergenic
988218890 5:28315828-28315850 TATATTGATTTTCCTCTAAAAGG - Intergenic
992440305 5:76792338-76792360 CAGACTGAATTCTCTCTCAAGGG - Intergenic
993494896 5:88596936-88596958 CTGACTGAATTGCCACAAAAAGG - Intergenic
996867646 5:128144928-128144950 AAGACTGTCTTGTCTCTAAAGGG - Intronic
998546587 5:143033496-143033518 ATGACTGATTTGCCTCTAGAGGG + Intronic
999102922 5:149041807-149041829 TTAACTGAATTCCCTCTCAATGG - Intronic
999172032 5:149603482-149603504 TACACTGAATTGCTTCTGCATGG + Intronic
1001929205 5:175660757-175660779 TAGACTGAATTGCCTCTAAAAGG + Intronic
1002764835 6:230284-230306 TAGAGTGAGTTGCCTGAAAAAGG + Intergenic
1003339509 6:5206091-5206113 TTGACTGAACTGACTATAAAGGG - Intronic
1004447695 6:15715647-15715669 TAGACTGAATTGCCCATTGAAGG + Intergenic
1004905919 6:20237079-20237101 TAGACTATTTTTCCTCTAAAGGG + Intergenic
1005093847 6:22089304-22089326 TAGCCTGTTTTGCCTCAAAATGG - Intergenic
1005212025 6:23477159-23477181 TAAACTGAATTACCTCCCAATGG - Intergenic
1007017656 6:38485291-38485313 TATTCTTAATGGCCTCTAAATGG + Intronic
1008013692 6:46493816-46493838 TAGACTAGACTGCCTCTCAATGG + Intergenic
1008207507 6:48680905-48680927 TAGAGTGAATGGACTCTTAAGGG - Intergenic
1008621713 6:53277528-53277550 TGGACTAAATTATCTCTAAAGGG + Intronic
1011176017 6:84561082-84561104 TCGACTGAATTGCATTTTAAAGG - Intergenic
1017107301 6:150900093-150900115 TAGACTGTGTTGCCTGCAAATGG - Intronic
1018426257 6:163685407-163685429 TAGACTGAATTTTCCCTAAAAGG - Intergenic
1019843296 7:3471557-3471579 AAAATTGAATTGCGTCTAAATGG - Intronic
1020861602 7:13499355-13499377 TAGACTAAATTGTGGCTAAATGG - Intergenic
1020921822 7:14274840-14274862 TACACTTCATTACCTCTAAAAGG + Intronic
1022371115 7:29772500-29772522 ATGACTCAATTGCCTCCAAAAGG + Intergenic
1030716426 7:112813016-112813038 TAAAGTAAATTGCCTCTAGATGG + Intergenic
1031035788 7:116786262-116786284 TAAACTGAATTACCTCTAAATGG + Intronic
1032068094 7:128787520-128787542 TACACTGAAATGCCACAAAAGGG + Intergenic
1032722067 7:134558293-134558315 TACACTGAAATGCCTCCAATTGG + Intronic
1033914812 7:146310882-146310904 ATGTCTGAATTGCCTCTTAAGGG - Intronic
1036451252 8:8869920-8869942 TTGTCTGAATTACCTCTAAGTGG + Intronic
1036918030 8:12823456-12823478 TACACTGAATTGCTTCAAAGTGG + Intergenic
1038511350 8:28138962-28138984 TGGACTGAATTGCTTCAGAAGGG - Intronic
1039216200 8:35274371-35274393 GAGACTAAACTGCCTCAAAAGGG + Intronic
1039715182 8:40100673-40100695 TACACTGCAGTGCCTCTCAAGGG - Intergenic
1045248729 8:100465678-100465700 TGGTCTGAATTGCCTCTGAATGG + Intergenic
1047224054 8:122942028-122942050 TAAACAGAATTGCCTTTGAAAGG - Intronic
1051508656 9:17852719-17852741 ATGACTTAATTGCCTCTTAAAGG + Intergenic
1055502750 9:76918089-76918111 TAGACTGATTTACATGTAAAAGG + Intergenic
1055606104 9:77972457-77972479 TTTACTGAATTGCCTGAAAATGG - Intronic
1058624160 9:106916899-106916921 TAGACTTCATTGTCTGTAAAGGG - Intronic
1059679909 9:116576114-116576136 TAGGATGAATTCCCTGTAAAAGG - Intronic
1186352182 X:8751184-8751206 TATGCTGAATTGCCTCCGAAAGG + Intergenic
1186871042 X:13773100-13773122 TAGACAGACTTGACTTTAAAGGG + Intronic
1188073476 X:25746711-25746733 TAGAGTGCATTGCCTCTAAGTGG + Intergenic
1188410347 X:29864350-29864372 TAGACTGCATTGCTCCTGAAGGG + Intronic
1188511802 X:30944141-30944163 TAGAGTGCATTGCCTTTCAAGGG + Intronic
1189563476 X:42215111-42215133 TAGAATAAGTTGCTTCTAAATGG + Intergenic
1190379819 X:49828991-49829013 AAGACTGAATACCCTCTTAAGGG + Intergenic
1191127982 X:56978204-56978226 TAGACAGAATTTCCTCCAAAGGG + Intronic
1198791391 X:140350775-140350797 TATACTCAATTGCATATAAATGG - Intergenic
1199867369 X:151864262-151864284 TAAACTGAATTGCCACTTGAAGG + Intergenic
1201148190 Y:11078043-11078065 TAACCTGAATTACCTCTTAAAGG - Intergenic