ID: 1001929269

View in Genome Browser
Species Human (GRCh38)
Location 5:175661202-175661224
Sequence TCTAGGACCCCACAGTTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001929266_1001929269 -6 Left 1001929266 5:175661185-175661207 CCATTCAAACCAGATCTTCTAGG 0: 1
1: 0
2: 1
3: 10
4: 119
Right 1001929269 5:175661202-175661224 TCTAGGACCCCACAGTTTACAGG 0: 1
1: 0
2: 1
3: 15
4: 138
1001929261_1001929269 20 Left 1001929261 5:175661159-175661181 CCCCATCCTACTCATCCTTCAAG 0: 1
1: 1
2: 18
3: 106
4: 534
Right 1001929269 5:175661202-175661224 TCTAGGACCCCACAGTTTACAGG 0: 1
1: 0
2: 1
3: 15
4: 138
1001929264_1001929269 14 Left 1001929264 5:175661165-175661187 CCTACTCATCCTTCAAGATTCCA 0: 1
1: 4
2: 19
3: 132
4: 598
Right 1001929269 5:175661202-175661224 TCTAGGACCCCACAGTTTACAGG 0: 1
1: 0
2: 1
3: 15
4: 138
1001929265_1001929269 5 Left 1001929265 5:175661174-175661196 CCTTCAAGATTCCATTCAAACCA 0: 1
1: 0
2: 1
3: 15
4: 228
Right 1001929269 5:175661202-175661224 TCTAGGACCCCACAGTTTACAGG 0: 1
1: 0
2: 1
3: 15
4: 138
1001929263_1001929269 18 Left 1001929263 5:175661161-175661183 CCATCCTACTCATCCTTCAAGAT 0: 2
1: 1
2: 7
3: 37
4: 318
Right 1001929269 5:175661202-175661224 TCTAGGACCCCACAGTTTACAGG 0: 1
1: 0
2: 1
3: 15
4: 138
1001929262_1001929269 19 Left 1001929262 5:175661160-175661182 CCCATCCTACTCATCCTTCAAGA 0: 1
1: 1
2: 5
3: 33
4: 280
Right 1001929269 5:175661202-175661224 TCTAGGACCCCACAGTTTACAGG 0: 1
1: 0
2: 1
3: 15
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001929269 Original CRISPR TCTAGGACCCCACAGTTTAC AGG Intronic
900173679 1:1282499-1282521 TCTAGGGTCCCACAGTAGACAGG + Intronic
902990101 1:20181452-20181474 TCTGGGACCTCTCAGTTTGCAGG - Intergenic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
904398110 1:30236613-30236635 TCTTGGAACCCACAGATGACAGG - Intergenic
905699817 1:40003124-40003146 TCTATGACTCCACAGTCTAAGGG + Intergenic
906698360 1:47839996-47840018 TCCAGGAACTCACAGTTTACAGG - Intronic
907193252 1:52665992-52666014 TCTAGGCCACCACTATTTACAGG + Intronic
912183936 1:107251881-107251903 TTTAGGAGCCCACAGATTATAGG - Intronic
912702802 1:111890767-111890789 TCTAGGACACCACACTCTCCAGG - Intronic
913137525 1:115907031-115907053 TCTTGCACACCACAGTTTTCTGG + Intergenic
916575659 1:166064264-166064286 GCTGGGACCCCACAGTTTAACGG - Intronic
916671366 1:167024234-167024256 TCAAGGAACTCACAGTTTAATGG + Intergenic
916677788 1:167078443-167078465 TCTAGCACCTCACAGTTCTCAGG + Intronic
917559819 1:176138598-176138620 TCTAAAGCCCCAGAGTTTACAGG + Intronic
919539020 1:198826485-198826507 TATAGGGCTCCACAGTTTTCAGG - Intergenic
920255001 1:204648751-204648773 TCCAGGACCACACAGTCTAGTGG + Intronic
920255093 1:204649305-204649327 TCTAGGACCTCACAGTCTAGTGG - Intronic
921332889 1:214057573-214057595 TCTAGAACCCCAGGGTTTATGGG - Intergenic
921823852 1:219649263-219649285 TCAAGGAGCTCACAGTCTACAGG - Intergenic
1065306919 10:24377938-24377960 GGAAGGACCCCACAGTGTACTGG + Intronic
1074662326 10:115675007-115675029 TCAAGGAACCCACAGTCTAGTGG - Intronic
1074774933 10:116760563-116760585 TCTAGGACCCCCGAGTTCAGTGG - Intergenic
1075676371 10:124298651-124298673 TCAAGGAACTCATAGTTTACTGG - Intergenic
1075995594 10:126873866-126873888 TCTAGGACCCCACCCTTTCCGGG + Intergenic
1076911016 10:133389645-133389667 TGTAGGACCCCCTAGTGTACGGG - Exonic
1079293999 11:19215348-19215370 TCAAAGAACCCACAATTTACTGG + Intergenic
1082837422 11:57661533-57661555 TCTACTAGTCCACAGTTTACTGG - Exonic
1084901645 11:72314433-72314455 TCTAGTAGCCCACAGCATACTGG - Intronic
1085058565 11:73423778-73423800 TCAAGGAGCTCACAGTTTAGTGG - Intronic
1085184222 11:74561831-74561853 TCTGGATCCCCACAGTCTACAGG + Intronic
1085402809 11:76244639-76244661 TCTTGGACCCCAGAGATCACTGG + Intergenic
1090530211 11:127583034-127583056 TCAAGGACCCCACGGTTTAGAGG + Intergenic
1090632496 11:128662316-128662338 TTAAGGAACTCACAGTTTACTGG - Intergenic
1097497409 12:60358169-60358191 TCTAGGACCCAGCAATTTTCAGG - Intergenic
1097999354 12:65923598-65923620 TCTAGGTTCCCACAGGGTACAGG - Intronic
1098306170 12:69105016-69105038 TCTAAGACCCCACAGCTCAGTGG + Intergenic
1098849121 12:75573609-75573631 TGTAGGATCCCACAAATTACCGG - Intergenic
1105593456 13:21814877-21814899 TCTACGAGCTCACAGTTCACTGG + Intergenic
1105969194 13:25412760-25412782 TCTCTGACCCCACAGTGTCCAGG + Intronic
1106923934 13:34593059-34593081 TCTAGGATCCCACGGTGTACTGG + Intergenic
1107244035 13:38270875-38270897 TCAAGGCCCCCACAGTCTACAGG + Intergenic
1107355855 13:39565868-39565890 TCCAGGACCCACCAGTTCACGGG + Intronic
1107869742 13:44735527-44735549 TCTAGGACCCCTCAGCTTCAGGG - Intergenic
1108169749 13:47728894-47728916 TCTAAGCCCCCACAGTTCTCAGG + Intergenic
1109594648 13:64534260-64534282 TCAAGGACTCAACAGTTGACTGG + Intergenic
1112983593 13:105418560-105418582 TCTAGGAACTCACACTCTACAGG + Intergenic
1116141566 14:41001730-41001752 TCAAGGACACCAGAATTTACAGG - Intergenic
1118700149 14:68425111-68425133 TCTAGGACCCCTCTGTGTAGGGG + Intronic
1119034984 14:71222017-71222039 ACTATGACCCCACCATTTACTGG + Intergenic
1120974237 14:90234952-90234974 TCTGGGACCACACAGTTGATGGG - Intergenic
1126103152 15:45131512-45131534 TCTAAGATCCCACAGTGGACTGG + Exonic
1126460763 15:48913130-48913152 TCTAGGACCCCACACACTAAGGG - Intronic
1129503540 15:76061661-76061683 TCTTGGACCCCACTTTTTATAGG - Intronic
1132516724 16:369491-369513 TGTGCGACCCCACAGTTTACAGG + Intronic
1135336571 16:21606519-21606541 CCCAGGACCCCATAGTTTAGGGG + Intronic
1135984034 16:27170503-27170525 TCAAGTACCCCACAGTCCACTGG + Intergenic
1140737608 16:77912011-77912033 TCTTGGACCCCACAATATAAGGG + Intronic
1143588609 17:7865988-7866010 TCTAGGAGCTTACAGTTTAATGG + Intronic
1147054208 17:37821747-37821769 TCAAGGAGCTCACAGTGTACTGG - Intergenic
1147337852 17:39738058-39738080 TCTAGGAACCCCCAGATTCCTGG - Intronic
1147700780 17:42393252-42393274 TCCAGGAACCCACAGTTTAGGGG - Intergenic
1149372674 17:56010656-56010678 TCTGAGACCCCACACTTTCCTGG + Intergenic
1150655916 17:67039344-67039366 TCTAGGAGCCCACAGTCTGGTGG - Intergenic
1150862432 17:68815029-68815051 TATAGAACCTCAGAGTTTACTGG + Intergenic
1151807946 17:76418238-76418260 TCTAGGAGCCCACAGCCTCCCGG + Intronic
1153055032 18:937252-937274 TCTAGGACCCCAGGATTTCCAGG - Intergenic
1153118764 18:1694033-1694055 TCTAGGACCTCTCAGCTAACAGG + Intergenic
1155424998 18:25697687-25697709 TATAGGACTCCTCTGTTTACAGG + Intergenic
1157392577 18:47315122-47315144 TCTAGGAGCACAGAGTTTATTGG - Intergenic
1157989037 18:52473249-52473271 TCTAAGACCTCACATCTTACAGG + Intronic
1159370947 18:67527061-67527083 TCTAGGACCCAAAATTTTTCTGG + Intergenic
1160191199 18:76715204-76715226 CCTAGGACCCCGCAGTGTCCTGG - Intergenic
1160215294 18:76923722-76923744 TCTAGGACCACAGAGCTCACAGG - Intronic
1160293590 18:77617393-77617415 TCTAAGACCCCACGCTTTGCGGG + Intergenic
1161922449 19:7276654-7276676 TCCAGGATCACACAGTTGACAGG - Intronic
1161963391 19:7535014-7535036 TCCCGGACCCCACGGTTTGCGGG + Intronic
1164847757 19:31449055-31449077 TCCAGGATCCCACAGTTTCATGG + Intergenic
1166079258 19:40433756-40433778 TCTAGGACCACCCTGGTTACAGG - Intergenic
925217835 2:2112347-2112369 TGTATCACCCCACAATTTACTGG + Intronic
928873832 2:36013433-36013455 TCTAGGAACTCACAATTCACTGG - Intergenic
929255936 2:39812011-39812033 TATTGGCCCCCACAGTTTTCTGG + Intergenic
930247836 2:49003310-49003332 TCTAGGTCCCCACAGAATACAGG - Intronic
933747308 2:85580507-85580529 TCGAGGACCCCTCAGTGTGCAGG + Intronic
944055371 2:195517041-195517063 TCTAGGCCCACTCAGGTTACTGG + Intergenic
946485114 2:220094175-220094197 TCTTGGAACCTACATTTTACCGG + Intergenic
947554626 2:231080595-231080617 TCTAGGCCCTAACATTTTACTGG + Intronic
1169529275 20:6466701-6466723 TCTAGGACCTCACAGTCTCTGGG - Intergenic
1171354966 20:24536878-24536900 TCCTGGACCCCAAAGTTTCCTGG + Intronic
1172027013 20:31955420-31955442 TCTGGGCCCCCACAGTTTTTTGG + Intergenic
1172532020 20:35638088-35638110 TCAAGGACCCCATAGTTTACAGG - Intronic
1173497426 20:43529648-43529670 TCTAGGAGCTCACAGTTGTCTGG + Intronic
1178921171 21:36739313-36739335 TCTAGGATCACACAGTTTGTTGG + Intronic
1181848240 22:25730424-25730446 TCCAGGAACTCACAGTTTAAAGG - Intergenic
1183020570 22:35023021-35023043 TCTAGGGCCCCGCCGTTTCCTGG - Intergenic
1183304571 22:37075543-37075565 GCTAGAACCTCACAGTTCACAGG - Intronic
951828251 3:26893632-26893654 TCTAGGATGCCACAGGTTATGGG - Intergenic
952800011 3:37281600-37281622 TCAAGGATCTCACAGTTTAGTGG + Intronic
954055291 3:48018236-48018258 TCTGGGACCCAGCAGTTTACAGG - Intronic
957487811 3:80885627-80885649 TCTTGGACTCCACATATTACTGG - Intergenic
958793196 3:98676252-98676274 TCTAGGACCACACACTTCAATGG - Intergenic
960263779 3:115597568-115597590 ATTTGGACCCCACAGTTTAATGG + Intergenic
968258977 3:197303634-197303656 TTTAGGACCCCACAGCTGGCTGG + Intergenic
968310369 3:197677615-197677637 TCTAGAACCCCAGGGTTTAAAGG - Intronic
971467392 4:26977906-26977928 TCTAGGTCCCCACATTCTCCTGG - Intronic
976896511 4:90118450-90118472 TCTAGGACACCACAGTTCCTTGG - Intergenic
979068518 4:116170037-116170059 GCTAGGACCCAACAGTTTCTAGG - Intergenic
989131678 5:38113366-38113388 TTTAGGAACTCACAGTTTCCTGG + Intergenic
992704811 5:79380347-79380369 TCTAGGACACTGCAGTTTATTGG - Intronic
998660601 5:144232945-144232967 CCTAGGAAACCACAGTTTTCAGG - Intronic
999547498 5:152646583-152646605 TCTTTGACCTCACAGTTTTCAGG + Intergenic
1001929269 5:175661202-175661224 TCTAGGACCCCACAGTTTACAGG + Intronic
1003844675 6:10160788-10160810 TCAAGGAGCTCACAGTTTAATGG + Intronic
1006418321 6:33918441-33918463 TCTAGGACCCAACAGTCTGGTGG + Intergenic
1007663271 6:43499380-43499402 ATTAGGACCCCTCAGTCTACTGG - Intronic
1008207219 6:48676253-48676275 TCTAGGAACTCATAGTTTATTGG - Intergenic
1010762449 6:79738831-79738853 TCTAGGAGCTCACAGTTCAGTGG + Intergenic
1014121401 6:117729457-117729479 TGGAGTACCCCAAAGTTTACTGG + Intergenic
1022216736 7:28270458-28270480 TGTAGGACACCACAGTTGTCTGG - Intergenic
1023416430 7:39937573-39937595 TCTTGGAACCCACAGTCTATTGG + Intergenic
1026079745 7:67207171-67207193 TCTAGGAACTCACAGCTTCCTGG - Intronic
1030175467 7:106649225-106649247 TCTAAAACCCAACAGTTGACTGG - Intergenic
1031517933 7:122724230-122724252 TCCATGAGCCCACAGTCTACTGG - Intronic
1031532410 7:122890977-122890999 TCTGGGACCACACATTTTACAGG + Intergenic
1032368723 7:131325726-131325748 TCCAGGACCAAACAGTCTACAGG + Intronic
1033480258 7:141733227-141733249 TCTAAGAGCTCACAGTTAACAGG + Intergenic
1035887834 8:3310773-3310795 TGCAGAACCCCACAGTTTCCTGG - Intronic
1037699563 8:21262442-21262464 CCCTGGACCCCACTGTTTACTGG - Intergenic
1039076020 8:33690911-33690933 TCTAGGCCCCCAGGGTTTAAAGG + Intergenic
1040820008 8:51546165-51546187 TTTAGGAACTCACAGTTTTCTGG - Intronic
1041660170 8:60393512-60393534 TCAAGGAGGCCACTGTTTACAGG - Intergenic
1044020025 8:87094640-87094662 TCTATGTCCACAAAGTTTACAGG - Intronic
1044958102 8:97502944-97502966 TTTGGGACCCCACAGTCTCCTGG - Intergenic
1047555272 8:125922467-125922489 TCAAGGACTTCACAGTCTACAGG - Intergenic
1047583690 8:126244968-126244990 TCAAGGACCCTGCAGTGTACAGG - Intergenic
1048518935 8:135136269-135136291 TGTAAGACCCCACAGTCTGCAGG - Intergenic
1051544027 9:18254115-18254137 TCTAAGACCACACAGCTTACAGG - Intergenic
1051992806 9:23173616-23173638 CCCAGGAACTCACAGTTTACTGG - Intergenic
1052209921 9:25892012-25892034 TCCAGCAGCCCACAGTTTAGTGG + Intergenic
1052228721 9:26121139-26121161 TCCAGGACCCCACACTCTCCTGG - Intergenic
1052246905 9:26347177-26347199 TCTAGGACCCCACCTTCCACCGG + Intergenic
1055797758 9:79993813-79993835 TCTAGGAGCCCAGAATTTATGGG - Intergenic
1056708236 9:88969629-88969651 CCAAGGACCCCACAGGTGACAGG + Intergenic
1058205326 9:102099186-102099208 TCAAGTACCTCACAGTTTAGTGG + Intergenic
1058556524 9:106174537-106174559 TCTTGGATCTCACAGTTCACTGG - Intergenic
1060354449 9:122891914-122891936 TCATGGAGCCCACAGTTTACTGG - Intronic
1203376913 Un_KI270442v1:383940-383962 TCTGGGACCCCACAGAGCACGGG + Intergenic
1187431544 X:19229380-19229402 TCTCGAACCCCACCCTTTACGGG - Intergenic
1187540568 X:20189238-20189260 TCTAGGAGCTCACAGTTTATTGG - Intronic
1189707449 X:43773095-43773117 GCTAGGATCCCACAGGTTTCTGG - Intronic
1190876319 X:54462713-54462735 TTTAGGACCCCACACTTTCTTGG + Intronic
1192151661 X:68716586-68716608 TCTAGGACCCCATTCTTTCCTGG + Intronic
1195716308 X:107821843-107821865 TCCAGGCCCACACTGTTTACAGG + Intergenic
1195919075 X:109964468-109964490 TCAAAGACCCCTCAGTTCACTGG + Intergenic
1197723364 X:129759780-129759802 TCCAGGAGCTCACAGTTTAGCGG + Intronic
1199364489 X:146963762-146963784 TCAAGGAGCTCACAGTTTAGAGG - Intergenic