ID: 1001929472

View in Genome Browser
Species Human (GRCh38)
Location 5:175662531-175662553
Sequence ACCAGTGCTTTGAAGGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001929472_1001929474 -8 Left 1001929472 5:175662531-175662553 CCAAGGGCCTTCAAAGCACTGGT 0: 1
1: 0
2: 2
3: 17
4: 184
Right 1001929474 5:175662546-175662568 GCACTGGTCCTTTGAGCCTGAGG 0: 1
1: 0
2: 0
3: 12
4: 122
1001929472_1001929478 12 Left 1001929472 5:175662531-175662553 CCAAGGGCCTTCAAAGCACTGGT 0: 1
1: 0
2: 2
3: 17
4: 184
Right 1001929478 5:175662566-175662588 AGGTTGCTCTATTGGCCACCTGG 0: 1
1: 0
2: 0
3: 10
4: 61
1001929472_1001929476 4 Left 1001929472 5:175662531-175662553 CCAAGGGCCTTCAAAGCACTGGT 0: 1
1: 0
2: 2
3: 17
4: 184
Right 1001929476 5:175662558-175662580 TGAGCCTGAGGTTGCTCTATTGG 0: 1
1: 0
2: 1
3: 2
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001929472 Original CRISPR ACCAGTGCTTTGAAGGCCCT TGG (reversed) Intronic
901002080 1:6153961-6153983 CCCTGTGACTTGAAGGCCCTGGG - Intronic
902556378 1:17249244-17249266 CCTAGTGGTTTGCAGGCCCTTGG + Intronic
905654746 1:39678835-39678857 ACTGCTGCTTAGAAGGCCCTGGG + Exonic
905784410 1:40742159-40742181 CCCAGTGCTTTGGAGGGCCAAGG - Intronic
911553651 1:99315803-99315825 ACAACTGATTTGAAGGCCATGGG - Intergenic
912506790 1:110162054-110162076 ACGAGTGCCGAGAAGGCCCTTGG - Intronic
913055533 1:115155495-115155517 AACAGTGCTTTGAAAGGCCCAGG + Intergenic
914429818 1:147611199-147611221 AACAATGCTTTGAAACCCCTAGG - Intronic
915041081 1:152968846-152968868 ACCAGTGCCTTCAAGGCACCAGG + Intergenic
915830702 1:159127149-159127171 ACTAGTTCTTTGAAGACTCTCGG - Intronic
916382932 1:164233379-164233401 ACCAGAGATTTGAATGGCCTAGG - Intergenic
921871996 1:220151380-220151402 TTCAGTGTTTTGAAGGTCCTGGG + Exonic
922683813 1:227623449-227623471 GCCAGTGCTTTGAAGCTCTTTGG - Intronic
924158844 1:241209200-241209222 AACAGTGCTTTGATGGCCTGGGG + Intronic
924319139 1:242829716-242829738 ACCATTTCTTTCAAAGCCCTAGG + Intergenic
1063044800 10:2381064-2381086 ACCAGTGCTTTGGGAGGCCTAGG + Intergenic
1064056110 10:12098918-12098940 ACCAGTGCTTTGGAAGGCCAAGG + Intronic
1065736046 10:28753444-28753466 CCCAGTGCTTTGAGGGGCCAAGG - Intergenic
1066435617 10:35394767-35394789 ACCTCTGTTTTGAAGGGCCTTGG + Intronic
1066553500 10:36585517-36585539 AACAGGGCTTTGAAGGCCCATGG + Intergenic
1067763971 10:49071385-49071407 CTCAGTGCTGTCAAGGCCCTGGG + Intronic
1067799610 10:49349983-49350005 CCCTGTGCTCTGATGGCCCTGGG + Intergenic
1069541606 10:69298375-69298397 ACCAGTGCTTTAAAAGACCAAGG + Intronic
1073655964 10:105416926-105416948 AAGTGTGCTTTGAAGGCCCTGGG + Intergenic
1075462497 10:122626918-122626940 AGGGATGCTTTGAAGGCCCTAGG + Intronic
1075615677 10:123889532-123889554 ACCAGTGCTTAGCAGGTTCTTGG + Intronic
1075795806 10:125118698-125118720 ACCAGTGCAGTGGAGGCGCTGGG + Intronic
1076270791 10:129150505-129150527 ACCCGTGCTTAGAAAGCCCGAGG + Intergenic
1076433400 10:130423255-130423277 ACCAGTGCTTGGAAGTCCTGTGG + Intergenic
1080881599 11:36326575-36326597 TCCATTGATTTGAAGACCCTGGG + Intronic
1081765245 11:45605876-45605898 ACCATTCCCTTGAAGGCACTAGG + Intergenic
1082874155 11:57971063-57971085 TCCAGTGCCTTCTAGGCCCTGGG - Intergenic
1084162030 11:67355266-67355288 ACCAGGGCTGGGAAGGGCCTAGG + Intronic
1084204943 11:67585762-67585784 ACCAGTGGGTTCAAGGCCTTCGG - Intronic
1084455865 11:69267867-69267889 ACCAGGGCATTGGAGGCTCTTGG + Intergenic
1084514349 11:69628124-69628146 ACCAGCTATGTGAAGGCCCTAGG + Intergenic
1085336180 11:75698234-75698256 TGCAGGGCCTTGAAGGCCCTGGG - Intergenic
1086769043 11:90737780-90737802 AGCAGTGCTTTGAAGGGACTGGG - Intergenic
1088707320 11:112475575-112475597 ATCAGTGCTAGGAAGGCCCTGGG - Intergenic
1088826624 11:113500664-113500686 CCCAGTGCTTTGGAGGGCCAAGG + Intergenic
1095082954 12:38028974-38028996 TCCAGTGTTTTGAAGCTCCTCGG + Intergenic
1100506423 12:95225084-95225106 ACCAGTGCTGTGCAGGCCTGGGG + Intronic
1102376619 12:112426992-112427014 ACCAGTACTTTGAGGGGCCGAGG + Intronic
1103542114 12:121673243-121673265 ACCAGGGCCTTGAAGGCCACTGG - Intergenic
1104055469 12:125226897-125226919 CCTAGTGCTTTCTAGGCCCTTGG + Intronic
1105407905 13:20146471-20146493 TCCAGTGTTTTGCAGCCCCTGGG - Intronic
1106496426 13:30282385-30282407 ACCAGTGCTTTGAGAGGCCAAGG + Intronic
1107385440 13:39903426-39903448 TCCAGTACATAGAAGGCCCTTGG + Intergenic
1115599008 14:34937836-34937858 CCCAGTGCTTTGAAAGACCAGGG + Intergenic
1119646520 14:76352564-76352586 ACCTGGGATTTGAAGGCCCAGGG - Intronic
1124803632 15:32859784-32859806 CCCAGTGCTTTGAGAGGCCTTGG + Intronic
1125392210 15:39205878-39205900 AACAGTGGTTTGAAGGCACTTGG - Intergenic
1125472520 15:40018570-40018592 CCCAGTGCTTTGAAAGGCCAAGG - Intronic
1126171562 15:45699529-45699551 AGCGGTCTTTTGAAGGCCCTTGG + Intergenic
1126348640 15:47721711-47721733 ACCACTGATTTGATCGCCCTTGG - Intronic
1128762749 15:70228978-70229000 ACCAGTGCCCAGTAGGCCCTCGG + Intergenic
1131997336 15:98144948-98144970 ACCTGTGCTTTGAGTGCACTGGG - Intergenic
1132081548 15:98870320-98870342 ATCAGTGCTTTGAAGGAGATGGG + Intronic
1134348526 16:13414466-13414488 ACAAGGGCTTTGAATTCCCTGGG + Intergenic
1134802672 16:17099885-17099907 ACCAAAGCTGTGAAGGGCCTGGG + Intergenic
1134862048 16:17568824-17568846 ACCAGTTCTTTTCATGCCCTGGG + Intergenic
1137371251 16:47907819-47907841 TACTGTGCTTTGAAGGCACTGGG + Intergenic
1138369612 16:56516238-56516260 GCAAGTCCTTTGAAAGCCCTGGG - Intronic
1139445833 16:66998106-66998128 ATCAGTGGTGTGAAGCCCCTGGG + Intronic
1140677079 16:77343025-77343047 AGCAGGGTTTTGAAGGCCTTAGG - Intronic
1141873329 16:86804640-86804662 CCCAGTGCTTTGCAGATCCTGGG + Intergenic
1144175734 17:12705297-12705319 ACCAATGCTTTGAAGATCTTCGG - Intronic
1147317782 17:39629075-39629097 AACAGTGCTTTGGAGTCCCCAGG - Intronic
1148751712 17:49949067-49949089 AACAGTGCTTGGAAAGTCCTCGG + Intergenic
1148865940 17:50628604-50628626 TCCTGGGGTTTGAAGGCCCTGGG - Intergenic
1149361949 17:55904376-55904398 GCAAGTGCTTTGGAGGCCCATGG - Intergenic
1149781361 17:59399035-59399057 TCCAGTGCTTTCATAGCCCTGGG + Exonic
1152392890 17:80013291-80013313 GCCAGGGCTCTAAAGGCCCTGGG - Intronic
1152735419 17:81994753-81994775 ACCAGTGCCACGGAGGCCCTGGG - Intronic
1153459361 18:5316476-5316498 ACCAGCAATTTGAGGGCCCTGGG + Intergenic
1155177230 18:23311593-23311615 ACCCGTGACTTGAAGGCCCCTGG + Intronic
1155551879 18:26973415-26973437 AACAGTGCGTAGAAGGCCCCGGG + Intronic
1157298788 18:46464792-46464814 CCCAGTGCTCTGCAGGCCATGGG + Intergenic
1160018100 18:75159259-75159281 AGCTGTGAGTTGAAGGCCCTGGG + Intergenic
1160278970 18:77469132-77469154 AACAGTACTTTGAAGGATCTTGG - Intergenic
1160816729 19:1039467-1039489 TCCACAGCTTTGAAGGCGCTGGG - Intergenic
1162745359 19:12794784-12794806 CCCAGTGCTTTGAAAGGCCAAGG - Intronic
1162803264 19:13122714-13122736 GACAGTGCTGTGAAGGCTCTGGG + Intronic
1163054369 19:14707152-14707174 CCCAGTGCTTTGCAAGGCCTAGG + Intronic
1163138243 19:15329402-15329424 CTCAGTGATTTGAAGACCCTGGG - Intronic
1163225321 19:15956568-15956590 AGCAGTGCTTTGGAAGCCTTAGG + Intergenic
1165383608 19:35497496-35497518 ACCAGTGCTTTTCGGGGCCTCGG + Exonic
1166359300 19:42246135-42246157 AGAGGTGCTTTGAAGGCACTGGG + Intronic
1166668229 19:44694337-44694359 ACAAGTGAATTCAAGGCCCTGGG - Intergenic
927377694 2:22437410-22437432 TCCAGTGCTTTGAGAGCCCAAGG + Intergenic
928302521 2:30138712-30138734 ACCAGTGCTTTGGGAGCCCAAGG + Intergenic
929940731 2:46332107-46332129 ACCATTGCTTTAGAGGCTCTGGG + Intronic
935340376 2:102054295-102054317 ACCAAAGATGTGAAGGCCCTAGG - Intergenic
936861527 2:117026138-117026160 CTAAGGGCTTTGAAGGCCCTTGG - Intergenic
938948562 2:136236589-136236611 ACCAGTGCTTTGCAGGGCTGTGG - Intergenic
939292824 2:140217594-140217616 CTAAGGGCTTTGAAGGCCCTTGG + Intergenic
944578691 2:201113906-201113928 CCCAGTGCTTTGGAAGACCTAGG + Intergenic
945594778 2:211777882-211777904 CTAAGGGCTTTGAAGGCCCTTGG - Intronic
946749979 2:222884466-222884488 AGCAGAGCTTTGAAGGCTCCAGG + Intronic
947417304 2:229909775-229909797 ACCATAGCCTTGAAAGCCCTTGG - Intronic
1169041105 20:2496300-2496322 ACCAGCCCATTGAAGGTCCTAGG + Intronic
1170471997 20:16676988-16677010 ACCACTTCTGTGAAGACCCTTGG - Intergenic
1170512934 20:17097639-17097661 AGCAGAGCTTTGATGGCCCTGGG - Intergenic
1176056001 20:63149549-63149571 TCCAGTGCTTTGTAAGCCCTAGG - Intergenic
1176801119 21:13431878-13431900 ATCAATACTTTGAAAGCCCTAGG + Intergenic
1179095573 21:38311621-38311643 GCCCTTGATTTGAAGGCCCTGGG - Intergenic
1180109569 21:45641868-45641890 ACCCGTGCTTTGGACGCGCTTGG - Intergenic
1181158619 22:20942294-20942316 CCCAGTGCTTTGAAAGGCCAAGG + Intronic
1182376579 22:29852983-29853005 GCCTGTGCTTTGGAGGACCTAGG - Intergenic
1184655097 22:45937096-45937118 CTCAGTGCTGGGAAGGCCCTTGG + Intronic
1184853277 22:47132896-47132918 ACCAGGGCCTTGAACTCCCTGGG + Intronic
949994546 3:9606085-9606107 ACCAGTGCTTTGGAAGGCCATGG - Intergenic
950032051 3:9859904-9859926 GCCAGCGCTTTGAGGCCCCTGGG + Intergenic
950218181 3:11174714-11174736 TCCAGTGCTTTGAAGGCTGGGGG + Intronic
951038228 3:17958010-17958032 ACCAGTGCTTTGAAAGGCCAAGG + Intronic
951839905 3:27023158-27023180 ACCATTACATTGATGGCCCTGGG - Intergenic
952491870 3:33881353-33881375 TCCTGTGCTCTGAAAGCCCTGGG - Intergenic
953281038 3:41557513-41557535 ACCAGTGCTTTGGAAGTCCGAGG + Intronic
954967266 3:54622838-54622860 GCCAGTGCTTTGACGACCCATGG - Intronic
956280205 3:67547779-67547801 ACCTCTCCTCTGAAGGCCCTTGG + Intronic
956565339 3:70630954-70630976 CCCAGTGCTTTGGAAGGCCTAGG + Intergenic
956775918 3:72565526-72565548 ACCAGTGCTTTGCACACCCTGGG - Intergenic
957275402 3:78084801-78084823 ACCAGTGTTTAGAAGGACCCTGG - Intergenic
961036163 3:123643344-123643366 ACCATTGTTTTCAATGCCCTTGG + Intronic
961784803 3:129341341-129341363 GCCAGCGCTTTGAGGCCCCTGGG + Intergenic
963852992 3:150226350-150226372 ACCCTTGCTTGGAAGTCCCTGGG - Intergenic
967306517 3:188064774-188064796 ACCTTTGCTTTGAAGGCCCCTGG + Intergenic
968957930 4:3728490-3728512 ACCACTCATTGGAAGGCCCTGGG - Intergenic
969056938 4:4408043-4408065 ACCAGTGCCTGGGACGCCCTTGG + Intronic
971029643 4:22622257-22622279 AACAGTGCGTAGAAGGCCCTGGG + Intergenic
974892482 4:67898610-67898632 ACCAGATCCTTAAAGGCCCTTGG - Intergenic
977438267 4:97029204-97029226 AACATTGCTTTAAAGGTCCTTGG + Intergenic
978162257 4:105562968-105562990 TCCAGTGTTGTGAAGGACCTGGG + Intronic
983267064 4:165518398-165518420 ACCAGTGCTTTGAGAGGCCAAGG - Intergenic
984964393 4:185127935-185127957 ACCAGGGCTTGGAAGACCCTCGG + Intergenic
985714633 5:1448472-1448494 ACTGGTGCTGGGAAGGCCCTGGG + Intergenic
986631026 5:9774579-9774601 TCCAGAGATTTGAAGGCACTTGG + Intergenic
988340217 5:29960819-29960841 ACCTGTGCTTTGCTGGCCTTGGG + Intergenic
990809080 5:59701984-59702006 ACCAGTGCTTTCTTGGCCCTTGG - Intronic
991286138 5:64978307-64978329 ACAAGTGCTTTCAGGGTCCTAGG - Intronic
992221316 5:74576583-74576605 CCCAGTGCTTTGAAAGGCCAAGG + Intergenic
992313513 5:75528559-75528581 TCCAGCGCTTTGAAAGGCCTAGG + Intronic
992809995 5:80377119-80377141 ACCTGTGCTTACAAGGCCCTTGG - Intergenic
992910071 5:81387793-81387815 TCCAGTGCTTTGAGGGGCCAAGG - Intronic
992971225 5:82060611-82060633 ACCAGTACTTTGAAAGGCCGAGG + Intronic
994438906 5:99776321-99776343 ACCCGTGCTTTAAAGCACCTAGG + Intergenic
995802417 5:116012790-116012812 ACCAGTGAGTTGAAGGGCGTGGG + Intronic
998117410 5:139548822-139548844 ACCAGGGCTTTGAAGTCAGTGGG - Intronic
998449956 5:142226561-142226583 ACCAGGGCTTTTAGGGCACTTGG + Intergenic
999216182 5:149937329-149937351 AGCAGGGCTTTGGAGGCCATGGG + Intronic
1001929472 5:175662531-175662553 ACCAGTGCTTTGAAGGCCCTTGG - Intronic
1002600299 5:180350572-180350594 CCCAGTGTTTTCCAGGCCCTGGG - Intronic
1002764376 6:226685-226707 GCCAGAGCTTCGGAGGCCCTGGG - Intergenic
1003585551 6:7385416-7385438 ACCAGTGCTTTGGAAGGCCAAGG - Intronic
1005011324 6:21338316-21338338 AACAGAGCTGTGAAGGCCCCAGG + Intergenic
1005106853 6:22233136-22233158 ACCAGTACTTTGAAGGACAATGG - Intergenic
1005252954 6:23968333-23968355 TCCAAGGCTTTGAAGTCCCTTGG + Intergenic
1005420781 6:25647848-25647870 ACCAGTGCTTTAAAAGCTCTAGG - Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1008042632 6:46817911-46817933 ACCAGTGCCCTGAAGGGCTTAGG - Intronic
1013567621 6:111383158-111383180 CCCAGTGCTGTGAATGCACTGGG - Intronic
1013671127 6:112404423-112404445 ACTTGCGCATTGAAGGCCCTCGG - Intergenic
1016373667 6:143398900-143398922 GCCAGTGCTGTGAATCCCCTAGG + Intergenic
1016427785 6:143952860-143952882 ATCAGTTCTTTGAAGGACTTTGG + Intronic
1021478391 7:21088535-21088557 ACCAGTGGTTGGGAGGCCATTGG - Intergenic
1021487406 7:21182555-21182577 TCCAGAGCTTCCAAGGCCCTGGG + Intergenic
1021724153 7:23533481-23533503 CCCAGTACTTTGGAGACCCTAGG + Intergenic
1021728868 7:23576999-23577021 CCCAGCACTTTGAAGGCCCAAGG + Intergenic
1024568840 7:50707752-50707774 AGCAGGGCTGTGCAGGCCCTGGG - Intronic
1026135177 7:67654066-67654088 ACTTGTGCTTTGAAAGCCATGGG + Intergenic
1026610008 7:71849881-71849903 CCCAGTGCTTTGGAAGGCCTGGG - Intronic
1031685240 7:124725568-124725590 ACCAGTGCTTTCAAGGCAATGGG - Intergenic
1033775586 7:144606516-144606538 CCCAGTGCTTTGAAGTGACTTGG - Intronic
1039004338 8:33017069-33017091 CTAAGGGCTTTGAAGGCCCTTGG - Intergenic
1041378249 8:57224073-57224095 CCCAGCACTTTGAGGGCCCTGGG + Intergenic
1041846621 8:62336469-62336491 AACAGTCTTTTCAAGGCCCTTGG + Intronic
1042920409 8:73914040-73914062 ACCAGTGCTTTGAGAGGCCAAGG + Intergenic
1045960905 8:107966653-107966675 AACAGTGCTTTCAGGGCACTTGG + Intronic
1046063390 8:109166286-109166308 ACCACTGCATTGAAGGTACTGGG - Intergenic
1046929977 8:119832493-119832515 ACAAGGGCTTTGAAAGCCCAAGG - Exonic
1047337987 8:123954516-123954538 ACCAGTGAGTGGAAGGCTCTAGG - Intronic
1047389450 8:124438300-124438322 ACCAGGGCTGTTAAGGTCCTTGG - Intergenic
1047459405 8:125047798-125047820 CCCAGTGCTTTGAAAGGCCGAGG - Intronic
1049020082 8:139950611-139950633 ACCAGTTCTTGGAAGGCCCTTGG - Intronic
1050888051 9:10790392-10790414 ACCAGTGCTCTCAGGGGCCTGGG + Intergenic
1053443232 9:38132538-38132560 ACCAGTGCTCTGAAGCCCCAGGG + Intergenic
1054776765 9:69130579-69130601 ACCAGTGCTTTGGAGGCCTTTGG + Intronic
1056007372 9:82286340-82286362 ACCACTGCTATGATGGCACTGGG - Intergenic
1056733579 9:89185693-89185715 CACAGTGCTCTCAAGGCCCTGGG + Intergenic
1057562188 9:96137405-96137427 ACCAGTGCTTTGCAGTCACCAGG + Intergenic
1057777319 9:98021546-98021568 AGGAGTGCTCTGCAGGCCCTGGG - Intergenic
1058758173 9:108103133-108103155 ACCAGTCTCTTAAAGGCCCTGGG - Intergenic
1059431160 9:114251189-114251211 ACAAGTGCCTCCAAGGCCCTTGG - Intronic
1060034608 9:120244087-120244109 ACCAATCCTTTGAAAGACCTTGG + Intergenic
1061340512 9:129976859-129976881 AACAGTTCTTTTAATGCCCTGGG - Intronic
1185586766 X:1246816-1246838 TCCAGTTGTTTTAAGGCCCTCGG + Intergenic
1186835117 X:13429950-13429972 ATGAGTTCTTTGATGGCCCTAGG - Intergenic
1189147643 X:38671790-38671812 ACCAGAGCTTTGCAAGGCCTGGG + Intronic
1189404386 X:40706450-40706472 ACCAGTGGTTTTCAAGCCCTAGG - Intronic
1189669300 X:43390897-43390919 TCCATTGCTTTCAAGGTCCTGGG - Intergenic
1198792552 X:140361473-140361495 CCCAGTGTTTAGAAGTCCCTGGG + Intergenic
1199616293 X:149658792-149658814 TTCTGTACTTTGAAGGCCCTGGG + Intergenic
1199626348 X:149744456-149744478 TTCTGTACTTTGAAGGCCCTGGG - Intergenic
1200171745 X:154081358-154081380 CCCAGTGCTTTGGAAGCCCGTGG - Intronic