ID: 1001930852

View in Genome Browser
Species Human (GRCh38)
Location 5:175672054-175672076
Sequence GTGTGTGTGTGGAGGGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5416
Summary {0: 1, 1: 14, 2: 131, 3: 905, 4: 4365}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001930852 Original CRISPR GTGTGTGTGTGGAGGGGTGA AGG (reversed) Intronic
Too many off-targets to display for this crispr