ID: 1001932161

View in Genome Browser
Species Human (GRCh38)
Location 5:175680916-175680938
Sequence GTGTTGAAAAGGACTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001932155_1001932161 26 Left 1001932155 5:175680867-175680889 CCAGCACCTGGAGTAGCATCTGA 0: 1
1: 0
2: 0
3: 19
4: 186
Right 1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG No data
1001932153_1001932161 28 Left 1001932153 5:175680865-175680887 CCCCAGCACCTGGAGTAGCATCT 0: 1
1: 0
2: 5
3: 47
4: 381
Right 1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG No data
1001932156_1001932161 20 Left 1001932156 5:175680873-175680895 CCTGGAGTAGCATCTGACACATT 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG No data
1001932151_1001932161 30 Left 1001932151 5:175680863-175680885 CCCCCCAGCACCTGGAGTAGCAT 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG No data
1001932154_1001932161 27 Left 1001932154 5:175680866-175680888 CCCAGCACCTGGAGTAGCATCTG 0: 1
1: 0
2: 1
3: 37
4: 320
Right 1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG No data
1001932152_1001932161 29 Left 1001932152 5:175680864-175680886 CCCCCAGCACCTGGAGTAGCATC 0: 1
1: 0
2: 0
3: 15
4: 201
Right 1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001932161 Original CRISPR GTGTTGAAAAGGACTGAGGA AGG Intronic
No off target data available for this crispr