ID: 1001934665

View in Genome Browser
Species Human (GRCh38)
Location 5:175695650-175695672
Sequence CGATGTCGCTGGCAGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001934665_1001934672 15 Left 1001934665 5:175695650-175695672 CCTCCCTGCTGCCAGCGACATCG No data
Right 1001934672 5:175695688-175695710 CTCGAACCCACATCAGCAAGAGG No data
1001934665_1001934673 16 Left 1001934665 5:175695650-175695672 CCTCCCTGCTGCCAGCGACATCG No data
Right 1001934673 5:175695689-175695711 TCGAACCCACATCAGCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001934665 Original CRISPR CGATGTCGCTGGCAGCAGGG AGG (reversed) Intergenic
No off target data available for this crispr