ID: 1001934696

View in Genome Browser
Species Human (GRCh38)
Location 5:175695778-175695800
Sequence CAGCATTTAAGGATGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001934689_1001934696 -3 Left 1001934689 5:175695758-175695780 CCTCAAGGAGAAGGGGCCACCAG No data
Right 1001934696 5:175695778-175695800 CAGCATTTAAGGATGGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001934696 Original CRISPR CAGCATTTAAGGATGGGCCA GGG Intergenic
No off target data available for this crispr