ID: 1001939420

View in Genome Browser
Species Human (GRCh38)
Location 5:175729949-175729971
Sequence CCCCGTGCCTGGGCTTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001939420_1001939427 -9 Left 1001939420 5:175729949-175729971 CCAGGGGAAGCCCAGGCACGGGG No data
Right 1001939427 5:175729963-175729985 GGCACGGGGAATCCACCAGGGGG No data
1001939420_1001939428 0 Left 1001939420 5:175729949-175729971 CCAGGGGAAGCCCAGGCACGGGG No data
Right 1001939428 5:175729972-175729994 AATCCACCAGGGGGCAGTGCAGG No data
1001939420_1001939426 -10 Left 1001939420 5:175729949-175729971 CCAGGGGAAGCCCAGGCACGGGG No data
Right 1001939426 5:175729962-175729984 AGGCACGGGGAATCCACCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001939420 Original CRISPR CCCCGTGCCTGGGCTTCCCC TGG (reversed) Intergenic
No off target data available for this crispr