ID: 1001939926

View in Genome Browser
Species Human (GRCh38)
Location 5:175733145-175733167
Sequence CCGTGGAGGAGGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001939912_1001939926 28 Left 1001939912 5:175733094-175733116 CCAACTTCTCAGGGGAGATGGCA No data
Right 1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG No data
1001939911_1001939926 29 Left 1001939911 5:175733093-175733115 CCCAACTTCTCAGGGGAGATGGC No data
Right 1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001939926 Original CRISPR CCGTGGAGGAGGAAGGTGGA GGG Intergenic
No off target data available for this crispr