ID: 1001942411

View in Genome Browser
Species Human (GRCh38)
Location 5:175750169-175750191
Sequence CTCCCTGTCCAGAGGAACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001942401_1001942411 29 Left 1001942401 5:175750117-175750139 CCCCTGAAGCCCACTCATCAGTT No data
Right 1001942411 5:175750169-175750191 CTCCCTGTCCAGAGGAACTTGGG No data
1001942406_1001942411 5 Left 1001942406 5:175750141-175750163 CCTAGCTGTGAGTGTTCATTAAT No data
Right 1001942411 5:175750169-175750191 CTCCCTGTCCAGAGGAACTTGGG No data
1001942402_1001942411 28 Left 1001942402 5:175750118-175750140 CCCTGAAGCCCACTCATCAGTTT No data
Right 1001942411 5:175750169-175750191 CTCCCTGTCCAGAGGAACTTGGG No data
1001942405_1001942411 19 Left 1001942405 5:175750127-175750149 CCACTCATCAGTTTCCTAGCTGT No data
Right 1001942411 5:175750169-175750191 CTCCCTGTCCAGAGGAACTTGGG No data
1001942403_1001942411 27 Left 1001942403 5:175750119-175750141 CCTGAAGCCCACTCATCAGTTTC No data
Right 1001942411 5:175750169-175750191 CTCCCTGTCCAGAGGAACTTGGG No data
1001942404_1001942411 20 Left 1001942404 5:175750126-175750148 CCCACTCATCAGTTTCCTAGCTG No data
Right 1001942411 5:175750169-175750191 CTCCCTGTCCAGAGGAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001942411 Original CRISPR CTCCCTGTCCAGAGGAACTT GGG Intergenic
No off target data available for this crispr