ID: 1001944728

View in Genome Browser
Species Human (GRCh38)
Location 5:175769730-175769752
Sequence ATGGAGAGACGGCCTCCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001944724_1001944728 -7 Left 1001944724 5:175769714-175769736 CCACGTGTTCCCAGTGATGGAGA No data
Right 1001944728 5:175769730-175769752 ATGGAGAGACGGCCTCCAAGAGG No data
1001944722_1001944728 -1 Left 1001944722 5:175769708-175769730 CCTACACCACGTGTTCCCAGTGA No data
Right 1001944728 5:175769730-175769752 ATGGAGAGACGGCCTCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001944728 Original CRISPR ATGGAGAGACGGCCTCCAAG AGG Intergenic
No off target data available for this crispr