ID: 1001945125

View in Genome Browser
Species Human (GRCh38)
Location 5:175772317-175772339
Sequence GGATCTTTGGTTCTGATATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001945125_1001945138 30 Left 1001945125 5:175772317-175772339 CCAAATATCAGAACCAAAGATCC No data
Right 1001945138 5:175772370-175772392 GAGCTCTATGTCAGGAATAGGGG No data
1001945125_1001945131 8 Left 1001945125 5:175772317-175772339 CCAAATATCAGAACCAAAGATCC No data
Right 1001945131 5:175772348-175772370 CCCCTGTCCACGAGGATTTCAGG No data
1001945125_1001945128 0 Left 1001945125 5:175772317-175772339 CCAAATATCAGAACCAAAGATCC No data
Right 1001945128 5:175772340-175772362 TCCTATCACCCCTGTCCACGAGG No data
1001945125_1001945135 22 Left 1001945125 5:175772317-175772339 CCAAATATCAGAACCAAAGATCC No data
Right 1001945135 5:175772362-175772384 GATTTCAGGAGCTCTATGTCAGG No data
1001945125_1001945136 28 Left 1001945125 5:175772317-175772339 CCAAATATCAGAACCAAAGATCC No data
Right 1001945136 5:175772368-175772390 AGGAGCTCTATGTCAGGAATAGG No data
1001945125_1001945137 29 Left 1001945125 5:175772317-175772339 CCAAATATCAGAACCAAAGATCC No data
Right 1001945137 5:175772369-175772391 GGAGCTCTATGTCAGGAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001945125 Original CRISPR GGATCTTTGGTTCTGATATT TGG (reversed) Intergenic
No off target data available for this crispr