ID: 1001945272

View in Genome Browser
Species Human (GRCh38)
Location 5:175773022-175773044
Sequence TGGGTTTACCAGCCCTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001945272_1001945277 16 Left 1001945272 5:175773022-175773044 CCTGCTGAGGGCTGGTAAACCCA No data
Right 1001945277 5:175773061-175773083 TGCTGCACGCGAGGAGCAAATGG No data
1001945272_1001945275 7 Left 1001945272 5:175773022-175773044 CCTGCTGAGGGCTGGTAAACCCA No data
Right 1001945275 5:175773052-175773074 CTGCGTCCTTGCTGCACGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001945272 Original CRISPR TGGGTTTACCAGCCCTCAGC AGG (reversed) Intergenic
No off target data available for this crispr