ID: 1001948226

View in Genome Browser
Species Human (GRCh38)
Location 5:175797488-175797510
Sequence GTGGGGGTCTGGAGGGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1090
Summary {0: 1, 1: 0, 2: 9, 3: 102, 4: 978}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001948226_1001948236 0 Left 1001948226 5:175797488-175797510 CCGTCTTCCCTCCAGACCCCCAC 0: 1
1: 0
2: 9
3: 102
4: 978
Right 1001948236 5:175797511-175797533 CCCATCCCAGCTCAGAATCGCGG 0: 1
1: 0
2: 0
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001948226 Original CRISPR GTGGGGGTCTGGAGGGAAGA CGG (reversed) Intronic
900160855 1:1222790-1222812 GTGGCTGTCAGGAGGGAAGTGGG - Intronic
900360032 1:2284018-2284040 GTCTGGGTCTGGGGAGAAGATGG - Intronic
900416051 1:2535153-2535175 CTGGGGGGCTGGGGGCAAGAGGG + Intergenic
900509540 1:3051982-3052004 GTGGGTGAGTGGATGGAAGATGG - Intergenic
900526265 1:3130274-3130296 GTGGGGTTCTGGGGAGAAGCTGG + Intronic
900738044 1:4311646-4311668 GAGGAGGTCGGGAGGGGAGACGG - Intergenic
900825271 1:4921158-4921180 GTGTGGGTCTCGGGGGAGGATGG + Intergenic
900908968 1:5580601-5580623 CTGGGGTCCTGGAAGGAAGAGGG - Intergenic
900943170 1:5814293-5814315 GTTGGGGTTTGGGGCGAAGAGGG + Intergenic
900971624 1:5995211-5995233 GAGGGGGACTGGCGGGAACATGG - Intronic
901018488 1:6244635-6244657 GGGGAGGGCTGGAGGGAGGAGGG + Intronic
901313167 1:8285310-8285332 GTGGGGCAGTGGAAGGAAGATGG + Intergenic
901453811 1:9352076-9352098 GTGAGGGGGTGGAGGGAAGGTGG + Intronic
901857061 1:12051351-12051373 CTGGGGGCCTGGAGGCAAAATGG + Intergenic
901883421 1:12207089-12207111 GTGGGGGCCTGGAAGGACCAGGG - Exonic
901911797 1:12464709-12464731 GTGGGGGTGGGGAGAGAAGAGGG + Intronic
902048491 1:13543435-13543457 GTGGGGGTCTGAGGAGAAGCAGG + Intergenic
902218097 1:14947324-14947346 GTGAGGATGTGGAGGGAAGCAGG + Intronic
902392769 1:16115885-16115907 GTGGGGGACTGGGGGGCAGGAGG + Intergenic
902402377 1:16165348-16165370 GTGGAGGCTTGGAAGGAAGAAGG + Intergenic
902615138 1:17619467-17619489 GTGGGGGTCTGCAGGGGAAGGGG + Intronic
902717364 1:18281914-18281936 TTGGGGGTGTGGTGGAAAGAGGG + Intronic
902798468 1:18814794-18814816 GGAGGGGTCTGGAGGGCTGATGG - Intergenic
902802977 1:18841845-18841867 ATAGGGATCTGGAGGGAGGAGGG + Exonic
902803696 1:18847514-18847536 GTCGGGGACTGGGGGGAAGAGGG + Intronic
903226630 1:21897445-21897467 GTAGGGGTGGGGAGGGAAGGGGG - Intronic
903231064 1:21922633-21922655 GTGGAGGTGTGGGGGGAAGGAGG + Intronic
903284835 1:22270074-22270096 GTGAAGCTCTGGAGGGAACATGG - Intergenic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
903421055 1:23217783-23217805 GTAGGGGTCTGCAGGGAGGTGGG + Intergenic
903684353 1:25120090-25120112 AGGGGGCTCAGGAGGGAAGAAGG - Intergenic
903763006 1:25712372-25712394 GGGAGGGTCTGGAGAGGAGATGG + Intronic
903887794 1:26551115-26551137 GATGGGGTCTGGTGGGAAAAGGG + Intronic
903931299 1:26863981-26864003 GTGGGGGACTGGAGGGGGCAGGG - Exonic
904041823 1:27589900-27589922 GTGGGGGTGCTGAGGGCAGAAGG - Intronic
904128374 1:28258714-28258736 GAGAGTGTCTGGAGGGAAGAGGG + Intergenic
904297021 1:29526478-29526500 GTGGTGGCCTGGAGGGGAGAAGG - Intergenic
904311586 1:29632789-29632811 CTGGGGGGCTGGAGGGCTGAGGG - Intergenic
904768277 1:32867242-32867264 GTGGGGGTGTGGAAGCAGGAGGG + Intronic
904894094 1:33801159-33801181 GAGGGGGCATGGAAGGAAGAGGG - Intronic
905375007 1:37514389-37514411 GAGGGGGCGTGGAGGGAGGACGG - Intronic
905446356 1:38030598-38030620 GAGGGGGACTGGAGGAAAGCTGG - Intergenic
905527263 1:38648504-38648526 GTGAGTGTCTGGAGTGCAGATGG - Intergenic
905689843 1:39934933-39934955 GTGGGAGACTGGAGTGGAGATGG + Intergenic
906098210 1:43238498-43238520 GTGGGGGTCTGGAGGATTGGAGG + Intronic
906299264 1:44670333-44670355 GTGAGTGGCTGGAGGGAACAGGG - Intronic
906567395 1:46810944-46810966 GTGGGGGTGAGGAGAGAGGATGG + Exonic
906681963 1:47733232-47733254 GTGGGAGTCAGGAGAGAGGATGG - Intergenic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907962298 1:59295135-59295157 GTGGAGGTCTGGAGGGCAGTGGG + Intergenic
908131688 1:61081684-61081706 GCGGGGGTCTGGAGAAAAGAAGG - Intronic
908612582 1:65879098-65879120 GTGGGAGTCTAGAGGGTAAAAGG - Intronic
908830385 1:68172849-68172871 GAGAGGGACTGGAGGGAACAGGG + Intronic
909086447 1:71174281-71174303 GTGGGGAGCTGGAAGGAGGATGG + Intergenic
909294350 1:73927903-73927925 GTGGTGGTCTGGAGAGAACAAGG - Intergenic
909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG + Intronic
909472882 1:76049317-76049339 GAGGGGGGAGGGAGGGAAGAAGG - Intergenic
909736461 1:78968502-78968524 GTGGGGGGGTGGGGGGGAGACGG + Intronic
909786341 1:79618631-79618653 GTGGGGGTGAGGATGGGAGATGG + Intergenic
909884619 1:80925368-80925390 GTGGAGATCTAGAGAGAAGATGG + Intergenic
909929376 1:81477925-81477947 GTGTGGCTCAGGAAGGAAGAGGG + Intronic
910158102 1:84243261-84243283 GTGGGGGTGGGGAGGGAACCAGG + Intergenic
910502411 1:87908034-87908056 GTGGGGGTGGGGTGGGCAGAAGG + Intergenic
912563925 1:110571610-110571632 ATGGGGGTCGGGAGGGGAGAGGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912594585 1:110861349-110861371 GTGGTTGTTTGGAGGTAAGAAGG - Intergenic
912698929 1:111861703-111861725 GGAGGGCTCTGCAGGGAAGAGGG + Intronic
912878110 1:113383557-113383579 GTGGGGTTATGGAGGAGAGAAGG - Intergenic
913528295 1:119713858-119713880 GTGGGGATAGGGAGGGATGAGGG + Intronic
914718078 1:150267924-150267946 GGAGTGGTCTGGAGGGGAGAGGG - Intronic
914826812 1:151143101-151143123 GTGGGGGTCTGGGAGGGAGGGGG - Intronic
914829446 1:151159988-151160010 GAGAGGGTCTGGAGGGGAGGGGG + Exonic
914959602 1:152194680-152194702 GGGGGGGTGGGGAGGGGAGAGGG - Intergenic
915017307 1:152746015-152746037 GTGGGGGGCAGGAGGGATCATGG - Intronic
915128931 1:153683890-153683912 GTGGGGACCCAGAGGGAAGAGGG + Intronic
915164583 1:153941533-153941555 GTGGGGTTCAGGAAGGAATAAGG - Intronic
915312306 1:155010809-155010831 GTGGGGGGGTGGAGGGAGAAAGG + Intronic
915324742 1:155075620-155075642 GGGGAGGTCAGGAGGGAAGCGGG - Intergenic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
915681574 1:157586478-157586500 GTGGGGGTCGGGTGTGAAGGAGG + Intronic
915729150 1:158040793-158040815 GTGGGGGGCTGAAGATAAGATGG + Intronic
915823444 1:159050644-159050666 GAGGAGGTATGGAGGCAAGAAGG - Intronic
915848924 1:159299979-159300001 GTGGGGGTGGGCTGGGAAGATGG + Intronic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916909692 1:169333318-169333340 GTGGGAGGCTGTAGGGAAGGTGG + Intronic
917512776 1:175681892-175681914 ATGGGGGTCTGAAGGGAGGAAGG + Intronic
917535734 1:175873072-175873094 GTGGGGGGCTGAAGGGAGGAGGG - Intergenic
917607364 1:176646540-176646562 GTGGGGGTCAGGTGGGGGGATGG - Intronic
917626948 1:176855904-176855926 GAGGGAGACTGGAAGGAAGAAGG + Intergenic
918076700 1:181176110-181176132 GCGGGAATGTGGAGGGAAGATGG + Intergenic
918125612 1:181580790-181580812 GTGGGGACCTGGAAGGAGGAGGG + Intronic
918147739 1:181772342-181772364 GTGGGGGTGTGGAGAGAGGAGGG - Intronic
918644812 1:186891438-186891460 GTAGGGGGCTGGAGGGGAGGTGG - Intronic
918673931 1:187258099-187258121 GTGGGGGTTTGGAGGGGAGGTGG - Intergenic
918824223 1:189301034-189301056 GGGTGGGCCTGGAGGAAAGAAGG - Intergenic
919167618 1:193916057-193916079 GTGAGAGTGTGGAGGGAAGTAGG - Intergenic
919470678 1:197975645-197975667 GTAAGGTTCAGGAGGGAAGATGG - Intergenic
919691518 1:200532197-200532219 GGGGGAGTCTGGAGGGAGGCAGG + Intergenic
920074758 1:203327847-203327869 GAGGGACTCTGGAGGGAGGACGG - Intergenic
920179825 1:204125780-204125802 GAGGAGGCCTGGAGGGGAGATGG + Intronic
920353898 1:205356392-205356414 ATGGGGGTCAGGAGGGACAAGGG - Intronic
920773765 1:208915307-208915329 ATGAAGGTCTGCAGGGAAGAAGG + Intergenic
921163499 1:212489345-212489367 GTGGGAGTCTGGAAGAATGAGGG - Intergenic
922466525 1:225848696-225848718 GTGGGGGAGTGCAGGGATGAGGG + Intronic
922672785 1:227525624-227525646 GTGGGGGGCTAGAGGGATGTGGG - Intergenic
922691214 1:227693110-227693132 GAAGGGGACTGGAGGCAAGAGGG - Intergenic
922765999 1:228157081-228157103 GCCGGGGGCTGGAGGGAGGATGG + Intronic
922823038 1:228497458-228497480 GTGGGGGACTGGCGGGGAGCAGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923433934 1:233950598-233950620 GTGGAGGGATGGAGGGAGGAGGG - Intronic
923536652 1:234857769-234857791 GTCAGGGTCTGGAGGGAGTAGGG + Intergenic
923855423 1:237839976-237839998 GTGGTTGTCTGGAAGAAAGAAGG - Intergenic
924073847 1:240312188-240312210 GTGGGTGGCTGGAGAGCAGAGGG - Intronic
924099354 1:240587906-240587928 GTAAGGGACTGGAGGGAATAGGG - Intronic
924150756 1:241126671-241126693 ATGGGGGGCTGGAGGTAGGAGGG - Intronic
924226480 1:241926393-241926415 GTGGGGATGTGGAGGGAAAAAGG - Intergenic
924257386 1:242195935-242195957 GTGAGGGGCTGAAGAGAAGAGGG + Intronic
924594541 1:245433933-245433955 TTGGGGGTCTGTAGTGAAAAGGG + Intronic
1063099178 10:2934783-2934805 TTGGGGGGCTGGAGTGTAGAGGG + Intergenic
1063179466 10:3584762-3584784 GACGGGGGCTGGAGGGGAGAAGG - Intergenic
1063522861 10:6757036-6757058 GTGGGGGTGTGGAGGGACAAGGG + Intergenic
1063866131 10:10367314-10367336 GTGGGGAAGCGGAGGGAAGAGGG - Intergenic
1065382391 10:25103158-25103180 GGGGGGGTTGGGAGAGAAGAGGG - Intergenic
1065497259 10:26341983-26342005 GGGGAGGAGTGGAGGGAAGAAGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066093510 10:32050181-32050203 GTGGGGATGTGGAGGGTAGTAGG - Intronic
1067043384 10:42970311-42970333 GTGGGGGTTGGGTGGGAAGGAGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067077476 10:43196434-43196456 ATGGGAGTCTGTAAGGAAGAGGG - Intronic
1067103779 10:43351484-43351506 GTGGGGGTCTGGAATGCAGGGGG - Intergenic
1067545270 10:47188237-47188259 GTGGAGGTGGGGAGAGAAGAGGG + Intergenic
1067806312 10:49395639-49395661 GCGGGGGACAGGAGGGAAGGCGG + Intronic
1068803059 10:61163320-61163342 TTGGAGGTCTGCAGGGCAGAAGG + Intergenic
1068922439 10:62498809-62498831 GTGGGGGGGTGGAGGGCAGTGGG + Intronic
1069289217 10:66756592-66756614 GTAGGGGTCAGGAGAGAGGAAGG - Intronic
1069571153 10:69495161-69495183 GAGGGGCTCTGGAGGGCAAAGGG + Intronic
1069746334 10:70717274-70717296 GTGGGGTTGTGGAGAGAGGAGGG + Intronic
1069754417 10:70764361-70764383 GTAGGGGTCTGGGGGGAGGAGGG + Intergenic
1069902820 10:71715727-71715749 GAGGGGGTCTGCAGAGAGGAAGG + Exonic
1070321560 10:75358598-75358620 GTAGGGCTCGGGAGGGAGGAAGG - Intergenic
1070599470 10:77855824-77855846 GTAGAGGTCTGGAGGGGAGGGGG - Intronic
1070817881 10:79336514-79336536 GGGGAGGTGTGGGGGGAAGAGGG + Intergenic
1071843529 10:89498225-89498247 GTGGGGGTGAGGTGGGAAGATGG + Intronic
1071966993 10:90861650-90861672 GTGGGCAGCGGGAGGGAAGAAGG - Intergenic
1072035576 10:91560468-91560490 GTAGGGGTCTGGAGGCAGGGAGG - Intergenic
1073152783 10:101323133-101323155 GCGGGGGTCAGGAGGAGAGAGGG + Intergenic
1074094532 10:110298651-110298673 ATGGCAGTCTGGAGTGAAGATGG - Exonic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1075065470 10:119286489-119286511 GTGGGGGTCTGGAGGGCCCCAGG + Intronic
1075807025 10:125196566-125196588 GTGGGGGTCTGGAGCCGAGTTGG - Intergenic
1076751480 10:132545587-132545609 GTGGGGGCCTTAGGGGAAGAGGG + Intronic
1076777032 10:132703639-132703661 GTGGGGGTGTGCGGGGATGAAGG - Intronic
1077044369 11:537889-537911 GTGGGGCTCAGGAGGGGAGCGGG + Intronic
1077054493 11:584348-584370 GTTGGGGGCTGGAGTGAAGGTGG + Intronic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077224801 11:1435250-1435272 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224813 11:1435279-1435301 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224825 11:1435308-1435330 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224837 11:1435337-1435359 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224849 11:1435366-1435388 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224861 11:1435395-1435417 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224873 11:1435424-1435446 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224885 11:1435453-1435475 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224897 11:1435482-1435504 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224909 11:1435511-1435533 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224921 11:1435540-1435562 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224933 11:1435569-1435591 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077307006 11:1872977-1872999 GTGGGGGTATAGGGGGAAGCAGG + Intronic
1077830271 11:5860748-5860770 GTGGGGGACTGGGGGGAGGTGGG - Intronic
1077959078 11:7053932-7053954 GTGGGGGAATGAGGGGAAGAGGG - Intronic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1078859158 11:15231245-15231267 GAAGTGGTGTGGAGGGAAGAGGG + Intronic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1079137654 11:17785025-17785047 GTGGGGGTGTCAAGGGATGATGG + Intergenic
1079407125 11:20156839-20156861 GTCGGGGTGGGGAGAGAAGAGGG + Intronic
1079960980 11:26922943-26922965 GTTGGGGCCTGGGGGGAACATGG - Intergenic
1080445207 11:32331855-32331877 CTGGGGGTGTGGGGGGAATATGG + Intergenic
1080461931 11:32462301-32462323 GAGGGGAACTGGAGAGAAGAGGG - Intergenic
1080953965 11:37071098-37071120 TGGGGGGTCTTGGGGGAAGAAGG - Intergenic
1081160407 11:39741940-39741962 GTAGGGGGCTGAAGGGAAGGTGG + Intergenic
1081968314 11:47182759-47182781 TTGGGGCTGTGGAGGGCAGAGGG + Exonic
1083139042 11:60706501-60706523 TGGGGGCTCTGGAGGGGAGAAGG - Intronic
1083256042 11:61496065-61496087 GTGGGGGTGTGGAGCCTAGAGGG + Intergenic
1083307863 11:61770231-61770253 GTGGGGCTCTGCAGGAGAGATGG - Exonic
1083320327 11:61842153-61842175 GTTGCGGTCTGGGTGGAAGAGGG - Intronic
1083380610 11:62265312-62265334 CTGGGGGTCAGGTAGGAAGAAGG - Intergenic
1083734205 11:64670337-64670359 GTAGGGGTCTGGGTAGAAGAGGG + Intronic
1083827764 11:65212796-65212818 GTGAGGGGCTGGAGGGCAGGAGG + Intergenic
1083857390 11:65399938-65399960 GTGGGGGCCTGGGGGCAAGGTGG + Intronic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1083893399 11:65608098-65608120 GTGGGGGTTGGGAGAGAAAAGGG - Intronic
1084050322 11:66595267-66595289 GTGGTGATCTGGATGGAAGGAGG + Intronic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1084889080 11:72227956-72227978 GTGTAGGTCTGGTGGGGAGACGG + Intronic
1084949727 11:72657967-72657989 GAGGAGGGGTGGAGGGAAGAGGG + Intronic
1085022545 11:73218439-73218461 TGGGGCGTCTGGAGGGAACAAGG + Intronic
1085051283 11:73381523-73381545 GGGGGAGTCTGGAGAGGAGAGGG + Intronic
1085054100 11:73394135-73394157 GTGGTGGTATGGAGGGTAGGTGG + Intronic
1085462176 11:76700792-76700814 GGGTGGCTCTGGAGGCAAGAGGG + Intergenic
1085641800 11:78197362-78197384 GTGAGGGTCTGGAGAGGTGATGG + Intronic
1085746415 11:79118558-79118580 GCCAGGGTCTGGAGGGAAGGGGG - Intronic
1087007969 11:93487434-93487456 GTGGGTGTATGGAGGGGAGGAGG + Intronic
1087721371 11:101669620-101669642 GTGGTGTTCTAGAGGCAAGAAGG - Intronic
1088289299 11:108219179-108219201 GTGGGAGGCTGGAGGGCAGGAGG + Intronic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1088739818 11:112758083-112758105 GTGGGGTTCCGGAGTGAAGGGGG - Intergenic
1088820662 11:113453931-113453953 ATGGGGGGCTGGGGGGAGGATGG + Intronic
1089310836 11:117557187-117557209 GTGGGGGACTTGCAGGAAGAAGG + Intronic
1089377800 11:118007097-118007119 GTGGGGGTGGGGAGTGGAGAAGG - Intergenic
1089532110 11:119136907-119136929 GTGGGCTCCTGGAGGGAGGAGGG + Intergenic
1089589755 11:119532871-119532893 GTGGGGGTCTGGCCAGAAGGTGG - Intergenic
1089638443 11:119831615-119831637 GTGGGGGTCTTAAGGGATGGAGG - Intergenic
1089792175 11:120953227-120953249 GTGGGGGTCTGGGGAGAAGTGGG - Intronic
1089895929 11:121929902-121929924 GTGGGGGGCTTGAGGGAGGGTGG + Intergenic
1091387432 12:103764-103786 GTGGGGCTCAGGAGGGGAGGCGG + Intronic
1091555351 12:1569341-1569363 GTGGGGTTGAAGAGGGAAGAAGG - Intronic
1091823016 12:3490773-3490795 GTGGGTGTCTGGATGGGGGAGGG - Intronic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1092045530 12:5430034-5430056 CTGGCAGTCTGGAGGGAGGAGGG - Intergenic
1092085793 12:5758416-5758438 GTGGGGCTGTGGAGGGAAATAGG - Intronic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1092313928 12:7389522-7389544 ATGGGGGGCTGGAGAGAAGGTGG + Intronic
1092913718 12:13171164-13171186 GTGGGTGGGTGGGGGGAAGAGGG + Intergenic
1092942996 12:13427936-13427958 GTGGGGGACGGGAGGGATGGTGG - Intergenic
1093024882 12:14236535-14236557 GGGGTGGTCTGGAGGGGTGATGG - Intergenic
1093497868 12:19778705-19778727 GTGGGCATTTGGAGGAAAGAAGG + Intergenic
1093692255 12:22121767-22121789 GTGGGGGTGGAGTGGGAAGATGG + Intronic
1093724266 12:22485315-22485337 GTGGCAGGCTGGAGGGAAGGTGG + Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094092097 12:26661781-26661803 GTGGAGGTCTGGAGTGGGGAAGG - Intronic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1094734705 12:33222103-33222125 GTGGTTGTTTGGAGGAAAGAAGG + Intergenic
1095277153 12:40299832-40299854 GTGGTGGTGGTGAGGGAAGAAGG + Intronic
1095565113 12:43613839-43613861 GTGGGGGGCTGGAGGGGAGAAGG - Intergenic
1096155133 12:49337301-49337323 GTGGGGGAGTGGAGGGGAGGCGG - Intergenic
1096177954 12:49535380-49535402 GTTGGGGGCTGGAGGAAAGATGG + Intergenic
1096230287 12:49893030-49893052 GTAGTGGGGTGGAGGGAAGAGGG - Intronic
1096364587 12:51017863-51017885 GTGGGTGCCTTGAGGGAACACGG - Intronic
1096633653 12:52945296-52945318 GGGGTGGGCTGGAGGGAGGAAGG - Intronic
1096808519 12:54155304-54155326 CTAGAGCTCTGGAGGGAAGAGGG - Intergenic
1096891131 12:54772674-54772696 GTGGGGGGCTGGTGGGGAGGTGG - Intergenic
1097084187 12:56455108-56455130 GTGGGGTTCAGCAGGGAAGTTGG + Intronic
1097187315 12:57202783-57202805 GTGGGGGTATGGTGGGAGCACGG - Intronic
1097214325 12:57398110-57398132 GTGGGGGTGGGCAGGGGAGAGGG + Intronic
1097246357 12:57609834-57609856 GTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1097267261 12:57753374-57753396 GTGGTGGTCTGGAGGGTGCAGGG - Intronic
1097338832 12:58414748-58414770 GGGGGGGTGGGGAGGGAAGGAGG + Intergenic
1099304597 12:80937764-80937786 GCGGGGGTGGAGAGGGAAGACGG + Exonic
1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG + Intergenic
1100209030 12:92381941-92381963 GAGGGGGGATGGAGGGAGGAAGG + Intergenic
1100388926 12:94130046-94130068 GTGGGGTTGGGGAGGGAGGAGGG - Intergenic
1100677393 12:96882132-96882154 GTAGGGGTTTGGAGAGAAGAGGG + Intergenic
1100738294 12:97562456-97562478 GTGGGGGTTGGGAGGGTAGCTGG + Intergenic
1101222633 12:102657176-102657198 GTGGGATTCTGAAGAGAAGAAGG + Intergenic
1101249657 12:102919577-102919599 GTAGGGGCCTGGAGGGGAGGTGG - Intronic
1101676581 12:106922422-106922444 GTGGGGGGCTGGAGTGAGGGAGG - Intergenic
1101682488 12:106983314-106983336 ACTGGTGTCTGGAGGGAAGAGGG - Intronic
1102028875 12:109728648-109728670 GTGGGGCTCTGGAGGTGAGCAGG - Intronic
1102188098 12:110965390-110965412 GGGGGGGTGTGGAGGGGAGTGGG - Intergenic
1102212627 12:111138361-111138383 GTGGGGGTGGGGAGAGAGGAGGG + Intronic
1102569778 12:113820434-113820456 GTGGGAGCCTGCAGGGAGGAAGG + Intronic
1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG + Intronic
1102738455 12:115184299-115184321 GGTGGGGTCAGGAGGAAAGAGGG + Intergenic
1102959858 12:117085407-117085429 GTGAGGGTCGGGAAGGCAGAAGG + Intronic
1103202251 12:119097252-119097274 GTGGGGCTGTGGAGGGCTGAGGG + Intronic
1103240179 12:119406773-119406795 GTGGGGGTATGTAGGTAAGTGGG - Intronic
1103649355 12:122421664-122421686 GTGGGGCTGTGCAGGGAGGAGGG + Intronic
1104179073 12:126360698-126360720 GTGGGTGACTGGTGGGGAGAAGG + Intergenic
1104809101 12:131609897-131609919 GTGGGGTTTTGGTGGGAAGGCGG + Intergenic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105210514 13:18254342-18254364 GTGGGGGACTGGGGTGGAGAGGG - Intergenic
1105445911 13:20456943-20456965 GTAGGAGTCTGGTGGGATGAAGG + Intronic
1105847313 13:24304556-24304578 GTGGGGGGCTGCAGGGGAGAAGG - Exonic
1106117464 13:26829858-26829880 GTGGGGCTGGGGAGGGGAGATGG + Intergenic
1106506871 13:30378165-30378187 GAGCGGGTTTGGAGAGAAGATGG + Intergenic
1106654092 13:31723692-31723714 GGAGGGGTCAGTAGGGAAGAAGG - Intergenic
1107379880 13:39845399-39845421 GTGTGGATCTGTAGGGAAAATGG + Intergenic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1108626721 13:52236227-52236249 GTGGGGGTGTGGGAGGAAGATGG - Intergenic
1108659347 13:52570258-52570280 GTGGGGGTGTGGGAGGAAGATGG + Intergenic
1109592787 13:64508897-64508919 GTCGGGGTGTGGGGGGAAAAAGG - Intergenic
1111580803 13:90220658-90220680 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
1111640081 13:90957597-90957619 GTGGGGGTGGGGGGGGGAGAGGG - Intergenic
1111770326 13:92588070-92588092 GTTGGGGGCTGGAGGGAAAGGGG - Intronic
1112265573 13:97920359-97920381 CTGGGGGTCGGGGGAGAAGAGGG - Intergenic
1113604337 13:111594824-111594846 GGGGTGGTCTGGAGGGTGGATGG - Intronic
1113637513 13:111929707-111929729 GGGGGGGCATGGAGGGAGGAAGG + Intergenic
1113677252 13:112215304-112215326 GGGGAGGGCTGGAGGGGAGAAGG + Intergenic
1113867364 13:113535837-113535859 GTGGGGGTCTGGGGAGGGGATGG + Intronic
1114669612 14:24402059-24402081 GTTGGGGTCTGAGGGGAGGAGGG + Intronic
1114712760 14:24795048-24795070 GTGGGGGGTTGGAGGGAGGAGGG - Intergenic
1114731773 14:25000590-25000612 TTGGGTGGCTGTAGGGAAGAAGG - Intronic
1115105930 14:29762083-29762105 GTGGGGCTCTTGAAAGAAGATGG + Intronic
1115253355 14:31372915-31372937 GGTGGGGTCGGGAGGGAAGGAGG - Intronic
1115831775 14:37350708-37350730 GTTGAGGGCTGGAGGGAAGTGGG - Intronic
1116782542 14:49251708-49251730 GTGGTCGTTTGGAGGTAAGAAGG - Intergenic
1117435972 14:55715582-55715604 TTGGACGTCTGGAGGGAAGTGGG - Intergenic
1117461025 14:55944968-55944990 GAGGGGGTCTTGTGGCAAGATGG - Intergenic
1118096759 14:62546153-62546175 GTGGGGGTGGGGAGGGGGGAGGG - Intergenic
1118774087 14:68962529-68962551 GCTGGGGTGTGGAGGGAGGAGGG - Intronic
1118876369 14:69788097-69788119 GAGGGGTTCTGGAGGGGAGTGGG + Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119314732 14:73683602-73683624 GTGGGGGGCTGAGGGGAGGATGG - Intronic
1119348464 14:73944933-73944955 GAGGAGGTCTGGAGGGAGCAGGG - Intronic
1120191174 14:81441093-81441115 GTGGGGTGTTGGAGGGAAGGAGG - Intergenic
1120509801 14:85399372-85399394 GTGGGGCTCTGGGGAGAGGAGGG + Intergenic
1121253113 14:92513996-92514018 GTGGGGATCGCGAGGGAGGAGGG - Intronic
1121975092 14:98396098-98396120 TTGGGGGTGGGGAGTGAAGAGGG - Intergenic
1122081046 14:99268272-99268294 GTGGCGGTGGGGAGGGGAGAGGG - Intronic
1122084032 14:99287178-99287200 GTGGGGCGCTGGGGGGAGGAGGG - Intergenic
1122137734 14:99644682-99644704 GTAGGGGTGGGGAGGGAGGACGG - Intergenic
1122140948 14:99662747-99662769 GTGGAAGGATGGAGGGAAGAAGG + Intronic
1122316498 14:100828523-100828545 GGAGGGGTATGGAGGGAGGAAGG - Intergenic
1122787130 14:104168939-104168961 CTGGGGGTCTGCGGGGAACAAGG + Intronic
1123131821 14:105993602-105993624 GTGGTTGTTTGGAGGAAAGAGGG + Intergenic
1123468172 15:20531234-20531256 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123649943 15:22469830-22469852 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123728488 15:23126444-23126466 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123740346 15:23278649-23278671 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123746652 15:23323909-23323931 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1124118474 15:26868110-26868132 GTGGGGGTCCGGAGGGTCGTGGG + Intronic
1124177502 15:27440045-27440067 GTGGGAATCTGGAGAGAAGTGGG - Intronic
1124212672 15:27776341-27776363 GTGGGCGTGAGGTGGGAAGATGG - Intronic
1124278920 15:28347225-28347247 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1124303779 15:28564383-28564405 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1124723945 15:32138430-32138452 GTGGGGGTTGGGAGGGGACATGG - Intronic
1124759884 15:32440219-32440241 GTGGGGGGCGGGAGGGATGGCGG - Intergenic
1124975134 15:34523611-34523633 GTGGGGGGCGGGAGGGATGGCGG - Intergenic
1125281231 15:38044351-38044373 GTAGGGGAGGGGAGGGAAGAAGG + Intergenic
1126658476 15:51006985-51007007 GTTGGGGGCAGGAGGGCAGAAGG - Intergenic
1126723383 15:51606208-51606230 GTGGGGGTGTGGATGTGAGATGG + Intronic
1126825372 15:52543043-52543065 GGTGGGGTATGAAGGGAAGAGGG - Intergenic
1127236616 15:57059732-57059754 GTGGGGGGCTGGGGGGAGGGTGG + Intronic
1127254933 15:57281895-57281917 GCGGGGGGCTGGGGGGAAGGGGG - Intronic
1128087964 15:64898691-64898713 CTGGGGATCTGGAGGGCAAATGG + Intronic
1128264430 15:66254251-66254273 GTGGGGGTCTGGGGGTTAAATGG + Intergenic
1128278013 15:66370467-66370489 GTGGGGGGCTGGAGGGGAGGAGG + Intronic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128611741 15:69079359-69079381 TGAGAGGTCTGGAGGGAAGAGGG + Intergenic
1128701949 15:69811135-69811157 GAAGGGGCCTGGAGGGAAGTGGG - Intergenic
1128726290 15:69990810-69990832 GTAGGGGGCTGGGGGGAGGAGGG + Intergenic
1128944502 15:71811645-71811667 GAGGGGTTCTGGAGGGGTGAGGG + Intronic
1128968478 15:72085671-72085693 GTGGTTGTCTGGAGAAAAGAAGG + Intronic
1129161860 15:73752075-73752097 GTGGGGGTTCTGAGGGAAGGCGG - Intronic
1129843769 15:78758941-78758963 GTGGGGTTCTGGGGGCAGGAAGG - Intergenic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130258038 15:82334859-82334881 GTGGGGTTCTGGGGGCAGGAAGG + Intergenic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1130596894 15:85255104-85255126 GTGGGGTTCTGGGGGCAGGAAGG - Intergenic
1130643936 15:85706939-85706961 GTGGGGGACTGGAGTGATGATGG - Intronic
1130833645 15:87628586-87628608 GGAAAGGTCTGGAGGGAAGAGGG - Intergenic
1130877588 15:88028039-88028061 GTGAGGGTGAGGAGGGAAAATGG + Intronic
1130921306 15:88347362-88347384 TTGTGAGTCTGGAGGGAACAAGG + Intergenic
1130985812 15:88843692-88843714 ATGGGGTCCTAGAGGGAAGAGGG + Intronic
1130990936 15:88875232-88875254 GCGGGGGTGGGGAGGGGAGAAGG - Exonic
1131097138 15:89663329-89663351 TGGGGGGTGGGGAGGGAAGATGG - Intergenic
1131424092 15:92331133-92331155 GTGGGGGTTGTGGGGGAAGAAGG + Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132191122 15:99861788-99861810 GTGGCGGTGTGGAGGGAGGTGGG - Intergenic
1132243196 15:100276228-100276250 GTGGGTGCCTGGTGGGAAGGTGG + Intronic
1132345127 15:101103442-101103464 GTTGGGTTCTGGAGGGTGGAGGG - Intergenic
1132522407 16:397662-397684 GTGGGGGTGTGGGGGGGTGAGGG + Intronic
1132522428 16:397700-397722 GTGGGGGTGTGGGGGGGTGAGGG + Intronic
1132958011 16:2606641-2606663 GTGGGGGTCTGGAGAGGGGTTGG + Intergenic
1132970485 16:2685889-2685911 GTGGGGGTCTGGAGAGGAGTTGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133084028 16:3347523-3347545 GTGGAGGTGTGGACGGAGGAGGG - Intergenic
1133332549 16:4984162-4984184 GTGGGGGTGTTGAGGGATGAGGG - Intronic
1133421437 16:5650343-5650365 GTGGTGGTGTGGAGGGAGGGAGG + Intergenic
1133866025 16:9644134-9644156 GTGGGGGTGCAGAGGAAAGAGGG + Intergenic
1133895887 16:9928547-9928569 TTTGGGGTCTGGAGAGATGAGGG - Intronic
1133989680 16:10694870-10694892 GTGGGGCTCATGAGGGAGGATGG - Exonic
1134076773 16:11297583-11297605 GGGGGAGTCTGCAGGGAAGGGGG - Intronic
1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG + Intergenic
1134488442 16:14677779-14677801 GTGGGTGGATGGATGGAAGATGG + Intronic
1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG + Exonic
1134977228 16:18580307-18580329 CTGGGGGTCTTCAGGGAAGAAGG - Intergenic
1135164773 16:20129560-20129582 GGGGGGATGGGGAGGGAAGAAGG - Intergenic
1135621807 16:23962332-23962354 GTGGGGGTTGGGACGGATGAGGG - Intronic
1135892693 16:26371685-26371707 GTGGGGGAGGGGAGGGAGGAAGG + Intergenic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136171625 16:28493404-28493426 GTGGGGCTGGGGAGGGGAGAAGG + Intronic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1136504685 16:30695413-30695435 GTGGGAGAGAGGAGGGAAGATGG - Intergenic
1136543755 16:30943852-30943874 GAGGGGGCATGGTGGGAAGAAGG - Intronic
1137581181 16:49634522-49634544 GAGGGGGTGAGGAGGGCAGAGGG - Intronic
1137631894 16:49952447-49952469 TTGGGTGCCTGGAGGGGAGAAGG - Intergenic
1137693135 16:50442865-50442887 GTGGGGGGGTGGGGGGAAGTGGG + Intergenic
1138150026 16:54648307-54648329 GTGGCGGTCGGGGGGCAAGAAGG + Intergenic
1138707704 16:58934568-58934590 GTGGGGGTGGGGAGGAAGGAAGG - Intergenic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139337858 16:66245660-66245682 GTGGGGGTGAGGAGGGAGCAAGG - Intergenic
1139494912 16:67309377-67309399 GTTGGGATCTGGAGGCCAGAGGG + Intronic
1139662436 16:68430205-68430227 GAGGGGGCATAGAGGGAAGAGGG - Intronic
1140760057 16:78101962-78101984 GGGGGGGTCGTGAGGGAATATGG + Intronic
1141025229 16:80540807-80540829 GTGGGTCCCGGGAGGGAAGAGGG - Intronic
1141050665 16:80760342-80760364 GTGGGGGGTTGGAGGGGAGATGG + Intronic
1141088113 16:81110938-81110960 GTGGGGGCCAGGATGTAAGAGGG + Intergenic
1141517841 16:84558371-84558393 GTGGGAGGAGGGAGGGAAGAGGG - Intergenic
1141560228 16:84862924-84862946 GTGGGGATGGGGATGGAAGAAGG + Intronic
1141602229 16:85133817-85133839 GTGGGGGCCGGGAGTGCAGACGG + Intergenic
1141693009 16:85607066-85607088 GGGGGGGGCGGGAGGGAGGAGGG + Intergenic
1141693191 16:85607829-85607851 GTGGGGGCCTCAAGGGAAGAAGG - Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141995833 16:87635897-87635919 GAGAGGGTCTGGAAGGAAGCAGG + Intronic
1142719469 17:1766744-1766766 CTGGGGGCCTGGAGGGGTGAGGG + Intronic
1142748738 17:1974712-1974734 GTGGGGGTGGGGAGGGGGGAGGG + Intronic
1142964694 17:3573286-3573308 GGGTGGTCCTGGAGGGAAGAAGG - Intronic
1143379345 17:6486310-6486332 GTGGGGGTGGGGTGTGAAGAAGG - Intronic
1143671369 17:8398136-8398158 ATAGGGGTGTGGGGGGAAGATGG - Intergenic
1143854285 17:9837232-9837254 GTGGAGGTGGGGAGGGATGATGG - Intronic
1144084780 17:11798852-11798874 GTGGGGGACTGGGGGTAAGGAGG - Intronic
1144164906 17:12601213-12601235 GTGGGGGTGGGGCGGGGAGAGGG - Intergenic
1144206431 17:12982895-12982917 GTGGGGGTGGGGTGGGGAGAAGG + Intronic
1144665458 17:17099025-17099047 GAGGGGCTTTGGAGGGAGGAGGG + Intronic
1145304965 17:21668960-21668982 CTGGGGGTCTGCAGGGAGGTCGG + Intergenic
1145958790 17:28873350-28873372 GTGGGGGTAGGGAGTGAGGAGGG - Intergenic
1146261945 17:31427701-31427723 ATGGGAGGCTGGAGGGTAGAGGG + Intronic
1146263908 17:31438566-31438588 ATGGGGGTGTGGAGAGAGGAAGG - Intronic
1147558909 17:41497085-41497107 GTCGGGTTCTGGAGGGAGGAGGG - Intergenic
1147646654 17:42038325-42038347 CTGGGGATCTGGAGGGAGGGAGG - Intronic
1148109709 17:45137495-45137517 GGGGAGGGCTGGAGGGGAGAAGG + Intronic
1148113461 17:45161130-45161152 ATGGGGGTGGGGAGGGAAGCTGG + Intronic
1148554659 17:48571284-48571306 GAGGGGGTCTGGTTGGAAAACGG - Intronic
1148645548 17:49217970-49217992 CTGGGGTTCTGGAGGGAAAGGGG - Intronic
1148734805 17:49859292-49859314 GTGGGGACCTGGGGGGAAGGGGG + Intergenic
1148786263 17:50147709-50147731 GTGGGGTTCTGAAGGGAATGGGG - Intronic
1148819901 17:50354338-50354360 GTGGGGGTGAGATGGGAAGAGGG - Intronic
1148996625 17:51716033-51716055 GTAGGGGGCTGGAGGGGAGGTGG - Intronic
1149938677 17:60838412-60838434 GTGGGTGTGGGGAGTGAAGAGGG + Intronic
1150005069 17:61464140-61464162 GTGCGTGCCTGGAGGGAGGAGGG - Intronic
1150228804 17:63538692-63538714 GTTGGGGATTGGATGGAAGAGGG + Intronic
1150266478 17:63835377-63835399 GGGAGGTTCTGGAGGGAAGGAGG - Intronic
1150341746 17:64374070-64374092 GAGGGGATCGGGAGGAAAGAGGG - Intronic
1150765003 17:67995695-67995717 GTGGAGGGCTGGGGGGAAGCGGG - Intergenic
1151077177 17:71287357-71287379 GTGGAGATCTGGAGGGAAAGGGG + Intergenic
1151104188 17:71593292-71593314 GTGTGTGTGTGGAGGGAATAGGG + Intergenic
1151128879 17:71875235-71875257 GTGGGGGTGTGATGGGAAGGTGG + Intergenic
1151201016 17:72468082-72468104 GTGCGTGTCTGGAGGGCGGAGGG - Intergenic
1151247252 17:72804394-72804416 GTGGGGAGTGGGAGGGAAGAGGG - Intronic
1151426424 17:74033767-74033789 GTGGGGGTCTGGGGTGTGGAAGG - Intergenic
1151543386 17:74776703-74776725 GTGGGGTTCTTGAGAAAAGAGGG + Intronic
1151586016 17:75008978-75009000 GTGGTGATCAGGAGGGAAGAAGG - Intergenic
1152128251 17:78460250-78460272 GTGACGTTCTGGAAGGAAGATGG + Exonic
1152210786 17:79001958-79001980 GTGGGGCTGGGGAGGGAGGAGGG - Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152371604 17:79891914-79891936 GTGGGGGCTTGGAGGGGAGGTGG - Intergenic
1152401477 17:80069071-80069093 ATGGGTGTCAGGAGGGAGGAGGG - Intronic
1152552414 17:81036175-81036197 GTGGGGGTCTGGACCGAGAACGG - Intronic
1152610819 17:81314332-81314354 GTTATGGTCTGGAGGGAGGAGGG - Intronic
1152738326 17:82008228-82008250 GTGGGAGACTGCAGGGTAGACGG + Intronic
1152901935 17:82947316-82947338 GTGGGTGTGTGGAGGGAAGGTGG - Intronic
1153235880 18:2986969-2986991 GTGGAGGTCGGGGGTGAAGAGGG + Intronic
1153543750 18:6185321-6185343 GTATGGATCTGGAGGGGAGAAGG - Intronic
1154408074 18:14114662-14114684 GTGGGGGGTTGGTGGGAAGTGGG + Intronic
1156114105 18:33766486-33766508 ATGGGGCTTTGGAAGGAAGAAGG + Intergenic
1156310561 18:35918489-35918511 CTGGGGGTCAGGAGTGCAGAGGG + Intergenic
1156377630 18:36529039-36529061 GAGGGTTTCTGGAGGGCAGATGG + Intronic
1157475284 18:48020142-48020164 GTGGAAGTCTGGATGGAGGAGGG - Intergenic
1157515310 18:48306995-48307017 GTGGGAGAGTGGAGGGAAGGTGG - Intronic
1157580985 18:48774040-48774062 GTGGCTGTCTGGAGGGGAGCTGG - Intronic
1157632443 18:49112128-49112150 GTGGGGGTGCGGAGGGGAGGGGG - Intronic
1157689412 18:49668835-49668857 GTGGGTGGGTGGAGGGAGGAGGG + Intergenic
1157721831 18:49931352-49931374 GTGGGGCTTGGGAGGGCAGAGGG - Intronic
1158285122 18:55872053-55872075 GTGGGGGGCTGGGAGGAAGGTGG + Intergenic
1158479526 18:57808485-57808507 GTGCAGGTCAGGAAGGAAGAGGG - Intergenic
1158483468 18:57843556-57843578 GAAGGGGGCTGGAGGGATGAGGG + Intergenic
1159138609 18:64365969-64365991 GTGGAGGTGGGGAGGGTAGAAGG + Intergenic
1159365750 18:67464172-67464194 CTGGGGGTGTGGTGGAAAGATGG + Intergenic
1159590763 18:70332721-70332743 TTGGGGGTGGGGAGGGTAGAGGG - Intergenic
1160387539 18:78505619-78505641 TTGGGGGCCAGGAGGGAGGAAGG - Intergenic
1160589766 18:79936979-79937001 GTGGGGTCCTTGAGGGCAGAAGG + Intronic
1160739396 19:679086-679108 AGGGGGGTCTGGAGGGAGCAGGG - Intronic
1160812615 19:1019490-1019512 CTGGGGGGCTGCAGGGAGGAAGG + Intronic
1160867196 19:1261175-1261197 GGCGGGGCCTGGACGGAAGAGGG + Intronic
1160918341 19:1508192-1508214 GACGAGGCCTGGAGGGAAGATGG + Intronic
1160967483 19:1753071-1753093 CTGGGGGTCTGTAGGGAACGGGG + Exonic
1161070455 19:2257306-2257328 CTGGGAGTCCTGAGGGAAGAGGG + Intronic
1161241352 19:3225368-3225390 GTGGGGGTCTGGGGGATGGAAGG - Intronic
1161297220 19:3526198-3526220 GTGGGGGCCTGCAGGGCGGATGG - Intronic
1161313845 19:3608832-3608854 GTGAGGGGCTGGGGGGCAGATGG + Intergenic
1161395763 19:4044137-4044159 GTGGGCGGCTGCAGGGAAGGTGG - Intergenic
1161611966 19:5248075-5248097 GTGGGGGTGTGGGGGGAGAATGG + Intronic
1161777372 19:6270937-6270959 GTGGGAGTACGGAGGGGAGAAGG - Intronic
1162110367 19:8396712-8396734 GGGGGGGGCGGGAGGGAGGAGGG + Intronic
1162172776 19:8804554-8804576 GAGGTGGTCTGGAGGAAAGGTGG - Intergenic
1162185255 19:8899974-8899996 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162186055 19:8905986-8906008 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1162820563 19:13220977-13220999 GTGGGGGACTGGAGGGGTGGAGG - Intronic
1163054237 19:14706360-14706382 GTTGAGGGGTGGAGGGAAGATGG - Intronic
1163737750 19:18991814-18991836 GTGGGGGCCTGGAGTGGAGCTGG - Intronic
1164799220 19:31062222-31062244 GTGGTGGTGTGGATGGCAGAGGG + Intergenic
1164971108 19:32533265-32533287 GTGTGGCTCCGGAGGTAAGAGGG - Intergenic
1165018058 19:32898401-32898423 GTGGGGGGCTGGGGGGCAGGTGG + Intronic
1165148838 19:33749441-33749463 GTGGGGGGATGGTGGGGAGATGG - Intronic
1165149863 19:33753976-33753998 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165149881 19:33754016-33754038 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165806359 19:38583526-38583548 GTGGGGGTGGGGAGGGAGCATGG - Intronic
1165868342 19:38952863-38952885 GTGGGGCACTGGAGGGAATGAGG - Intronic
1166180758 19:41106853-41106875 GTGGAGGACTGGGGGGAAGGTGG - Intergenic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1166250486 19:41565976-41565998 GTGGGGTTCTGGAGGATTGATGG + Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167267917 19:48492795-48492817 GTGTGGGTCTGGAAGGAAAGAGG - Intronic
1167429459 19:49446253-49446275 GTGGGTGTTGGGAGGGAAGAGGG - Intergenic
1167471024 19:49676659-49676681 GGGGGAGTCTGGAGGAAAAAGGG - Intronic
1167512531 19:49903349-49903371 GATGGTGTCTGGAGGGGAGACGG + Intronic
1167565678 19:50255176-50255198 GTGGGTGGGTGGAGGGGAGATGG - Intronic
1167952414 19:53037938-53037960 GACGGCGTCGGGAGGGAAGAAGG + Intergenic
1167956891 19:53073121-53073143 GTTGGGGACTGGAGGGAATAGGG - Intronic
924987253 2:283400-283422 GTGGGGCAGCGGAGGGAAGAGGG + Intronic
925068952 2:951141-951163 GAGGGGGCGTGGAGGGAGGAGGG - Intronic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925291524 2:2751461-2751483 AGAGGGGTCTGGAGGGAAGAGGG - Intergenic
925343092 2:3150162-3150184 GTCGGGGCCTGGAGGGGAGTAGG + Intergenic
925398237 2:3552543-3552565 GTGGTGGTGTGGAGGGGAGGGGG - Intronic
925398248 2:3552568-3552590 GTGGTGGTGTGGAGGGGAGGGGG - Intronic
925451090 2:3969696-3969718 GTGGGGGGCAGCAGGGCAGAGGG - Intergenic
925689373 2:6505618-6505640 GTGGGGTAGAGGAGGGAAGAGGG - Intergenic
925969027 2:9094148-9094170 GTGGGCGTGAGGTGGGAAGAAGG - Intergenic
925978083 2:9155093-9155115 GTGGGAGATTGGAGGGAGGAAGG + Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926112400 2:10191720-10191742 TGCGGGGTCTGGAGGGAACACGG + Intronic
926722486 2:15971494-15971516 ACGAGGGTCAGGAGGGAAGAAGG + Intergenic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
927646978 2:24884063-24884085 GTGAGAGGCTGTAGGGAAGAGGG - Intronic
927799324 2:26083423-26083445 TTGGGGGAGGGGAGGGAAGAGGG - Intronic
927849745 2:26491360-26491382 GTGGAGGGGTGGAGGGAAAAAGG + Intronic
928287345 2:30004439-30004461 GTGGGGGTGAGGAGGAAAAAAGG - Intergenic
928404649 2:31005272-31005294 GTGGGGGTGGGGAGTGGAGATGG + Intronic
928549730 2:32358063-32358085 GTGGGGGTGGGGAGGGAAGTAGG + Intronic
929018334 2:37524666-37524688 GTGGGGGACAGGTGGAAAGATGG + Intergenic
929077181 2:38087664-38087686 GTGGAGGTCTTGAGGGAATGAGG - Intronic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929280391 2:40072008-40072030 GTGGTGATTTGGAGGAAAGAGGG + Intergenic
929434648 2:41919232-41919254 TTTGGGGGGTGGAGGGAAGATGG - Intergenic
929510452 2:42562406-42562428 GTGGGGAGGGGGAGGGAAGATGG - Intronic
929668619 2:43852487-43852509 GTGAGGGCCTGGGGGGCAGATGG + Intronic
929789694 2:45013764-45013786 GTGAAGGCCTGGAGGGCAGAGGG - Intergenic
930989312 2:57631579-57631601 GTGGGGGGCGGGAGGCAGGAAGG + Intergenic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931987950 2:67759097-67759119 GTTGGACCCTGGAGGGAAGAGGG - Intergenic
932048636 2:68376901-68376923 GTGGGGGACTGCAGGGAGGTGGG - Intronic
932128876 2:69169464-69169486 GTTGGGGTCAAGAGGGAGGAGGG + Intronic
932405647 2:71511223-71511245 CTGGGGGGCAGGAAGGAAGAGGG + Intronic
932418584 2:71588217-71588239 CTGGGGGTCTGAATGGGAGAAGG + Intronic
932465590 2:71922153-71922175 TGGGGGGACTGGAGAGAAGAGGG - Intergenic
932688104 2:73890796-73890818 TGGGGATTCTGGAGGGAAGAGGG - Intergenic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
933720136 2:85392471-85392493 GAGGGGGTCCGGAGGACAGAAGG - Intergenic
934048323 2:88190138-88190160 GTGGTGGTCTGAAGGCTAGATGG + Intergenic
934301456 2:91778992-91779014 GTGGGGCTCAGGGGGGAAGCAGG + Intergenic
934543388 2:95194743-95194765 GTGGGGGGTGGGAGGGAAGTGGG + Intergenic
934554767 2:95281446-95281468 GTGGGGGTCGGGGGGTAAAAGGG + Intronic
934706433 2:96484837-96484859 GTGGAGGGTAGGAGGGAAGATGG - Intergenic
934893365 2:98089509-98089531 GTGGGGGTGGGGTGGGGAGAAGG + Intronic
934902097 2:98167576-98167598 CTGAGGGTCTGGAGGGACCAAGG + Intronic
936133805 2:109871534-109871556 GTGGGGGACTGGAGTAAGGAAGG - Intergenic
936210892 2:110499951-110499973 GTGGGGGACTGGAGTAAGGAAGG + Intergenic
936328270 2:111524063-111524085 GGGGGCTTCTGGAGGGGAGAAGG + Intergenic
936435420 2:112501054-112501076 GTGGGGGACTGGAGTAAGGAAGG + Intronic
936944925 2:117921622-117921644 GTGGGGGTTTTGAGTGCAGAAGG - Intronic
937223153 2:120353542-120353564 AGGGAGGGCTGGAGGGAAGAAGG - Intergenic
937225021 2:120363740-120363762 GTGGGGGTCAGGAGGGCACCAGG + Intergenic
937305450 2:120867795-120867817 GGGGGGAGCTGGAGGGAAGGAGG + Intronic
937339164 2:121079968-121079990 CTGAGGGTCTGGAGGGTAGGAGG + Intergenic
937365431 2:121257576-121257598 GTGGGGTGCAGGTGGGAAGAGGG - Intronic
937694192 2:124789546-124789568 GAGGGTGTCGGGTGGGAAGAGGG - Intronic
938014698 2:127857884-127857906 GTGGGGCTGGGGAGGGAACATGG - Intronic
938663848 2:133513501-133513523 GAGTGGATCTGGAGGGAAAATGG + Intronic
939083806 2:137693293-137693315 GAGTGGGTCTAGAGGGAAAAAGG - Intergenic
939217771 2:139262017-139262039 TCTGGGGTGTGGAGGGAAGAAGG - Intergenic
939629126 2:144513646-144513668 GTGGGAGGCAGGAGGGAAGCAGG + Intronic
940206911 2:151213167-151213189 GTGGTGGTTTCCAGGGAAGAGGG + Intergenic
940864408 2:158803729-158803751 TTTGGGGTCTGGATGGAAGGTGG + Intronic
941225146 2:162838829-162838851 GTGGGGGTGGGGTGGGAAGGGGG + Intergenic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
941867239 2:170347906-170347928 GTCAGGGGCTGGAGGGGAGAAGG - Intronic
942229591 2:173847691-173847713 GAGGGGCTCTGGAGGGCAGAAGG + Intergenic
942245293 2:174002639-174002661 GCTAGGGTTTGGAGGGAAGAAGG + Intergenic
942255521 2:174093205-174093227 TTGGGGATTTGGTGGGAAGATGG + Intronic
943725270 2:191245851-191245873 GGGGGTGGCGGGAGGGAAGAAGG + Intronic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
944333939 2:198506417-198506439 GTGGGGGACTGGAGGGGAGGTGG + Intronic
944889766 2:204105244-204105266 GTGGGGGGCAGTGGGGAAGAAGG - Intergenic
945027017 2:205629427-205629449 TAGGGGGTCGGGAGGCAAGATGG - Intergenic
946019590 2:216632327-216632349 GGAGGGGTCTGGGGGGAAGAGGG + Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946174836 2:217916285-217916307 TGGGGGGTCTGGAGGGGAGGAGG - Intronic
946190062 2:218003284-218003306 GCGGGGGTCTGCAGTGAGGAGGG - Intergenic
946353212 2:219169006-219169028 GTGGGTATCTGGAGGTGAGAAGG - Intronic
946391161 2:219417867-219417889 GTGGGGGTCTCTAGGCAGGAAGG - Intergenic
946488660 2:220126215-220126237 GAGGAGGACTGCAGGGAAGAAGG + Intergenic
947275672 2:228389465-228389487 TTGGGAATCGGGAGGGAAGAAGG - Intergenic
947546217 2:231012086-231012108 TTGGGAGTCTGGAGGAAAGGAGG + Intronic
947552155 2:231053952-231053974 GTCGTGGTCTGGAAAGAAGAAGG + Intergenic
947614738 2:231548549-231548571 GTGGGTGTCTCCAGGGGAGACGG + Intergenic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
948130970 2:235600399-235600421 ATGGGGGTCTATAGGGCAGAGGG - Intronic
948274396 2:236697008-236697030 GTGGGGGACTGGATGGATGATGG + Intergenic
1168869826 20:1118738-1118760 TTCGGCGTCTGGAGGAAAGAAGG - Exonic
1169205703 20:3739443-3739465 GTGGGAGGCCGGAGGCAAGAGGG + Intronic
1169236570 20:3934409-3934431 GGGAGGCTCTGGAAGGAAGAGGG - Intronic
1170255201 20:14334657-14334679 GTGGGGGGTGGGAGGGAAGGGGG + Intronic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1171021049 20:21584426-21584448 GTGGGGCTCCCCAGGGAAGATGG - Intergenic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1171239369 20:23552419-23552441 GTGGGGCTCTGGAGAGAGCACGG - Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171291657 20:23986032-23986054 GTGGGGGACTGGGGTGGAGAGGG - Intronic
1171978025 20:31607656-31607678 CTGCGGGTCTGGAGTGAAGGTGG + Intergenic
1172010453 20:31843153-31843175 GAGGGCCTCTGGAGGGGAGAGGG + Intergenic
1172120082 20:32593264-32593286 GTGGAGGTCTGGAGGGAAAAGGG + Intronic
1172188153 20:33044327-33044349 CTTGGGATCTGGAGGGAAGCTGG + Intergenic
1172478421 20:35256007-35256029 GTAGGAGTTTGGAGGAAAGAGGG + Intronic
1172587355 20:36093840-36093862 GTGGGGGGCTGGGGGGAGGCCGG - Intronic
1172611282 20:36254501-36254523 GCCAGGGCCTGGAGGGAAGAGGG + Intronic
1172766751 20:37355224-37355246 GTGGGGGTGGGGAGGGCAGGAGG - Intronic
1172814083 20:37672552-37672574 GTGGGGGGCTACAGGGCAGAAGG + Intergenic
1172865118 20:38089968-38089990 CTGGGGGGCTGGGCGGAAGAAGG - Exonic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173336440 20:42115849-42115871 TTGGGGGTCTGGAAGGAGAAAGG + Intronic
1174135685 20:48377415-48377437 GTGGGGGTCTTGTGGGAAGGTGG - Intergenic
1174199445 20:48797330-48797352 GGGGGGGTCTGGGGGGAGCAGGG - Intronic
1174205965 20:48839324-48839346 GTGGGTGTCTGTGGGGGAGAGGG - Intergenic
1174467391 20:50728793-50728815 TTGGGGGTGGGGAGGGATGATGG + Intergenic
1175062811 20:56259192-56259214 GTGGAGGGGTGGTGGGAAGATGG - Intergenic
1175124814 20:56743292-56743314 GTGGGGCTGAGGCGGGAAGATGG - Intergenic
1175259912 20:57667801-57667823 GTGGGGGTAGGTAGGGGAGAGGG - Intronic
1175385380 20:58591655-58591677 CTGGGGGTCTGGAGGGCTGCAGG - Intergenic
1175428754 20:58888805-58888827 GTGGGTGGCTGGAGGTAAGGAGG + Intronic
1175493797 20:59398463-59398485 GAGGGGGTGTGGGGGGAAAAGGG - Intergenic
1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG + Intergenic
1175727032 20:61325552-61325574 GTGGGGGTCTGTGGGGCAGGGGG + Intronic
1175779220 20:61671756-61671778 GTGGGTGTGTGGATGGATGATGG + Intronic
1175807613 20:61838473-61838495 ATGGGAGCCTTGAGGGAAGAAGG - Intronic
1176061863 20:63175992-63176014 GTGGGGGACGGGAGGGGAGGGGG + Intergenic
1176123876 20:63466489-63466511 GTGGAGGCCAGGAGGGAGGATGG - Intronic
1178730183 21:35094830-35094852 GTAGGGGTCAGGTGGGCAGAGGG - Intronic
1178855981 21:36250811-36250833 GTGGGGGTCTTGCAGGAAGCCGG - Intronic
1178996497 21:37405491-37405513 GTGGGGATCTGGAGGTACTAAGG - Intronic
1179030693 21:37717377-37717399 GTGGGTGTGTGGAGGGAGGCAGG + Intronic
1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG + Intronic
1179647502 21:42784672-42784694 GTGGGGGTGTGGTGGGATGAGGG - Intergenic
1179792658 21:43764478-43764500 GTGGGGGTGGGGACGGCAGATGG + Intergenic
1180156216 21:45978352-45978374 GAGGGGGAGAGGAGGGAAGAGGG + Intergenic
1180692862 22:17731985-17732007 GTGGGGCTGTGGAGTGAAGTAGG + Intergenic
1180765741 22:18345061-18345083 GTGGGGGACTGGGGTGGAGAGGG + Intergenic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180780569 22:18517317-18517339 GTGGGGGACTGGGGTGGAGAGGG - Intronic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180813288 22:18774638-18774660 GTGGGGGACTGGGGTGGAGAGGG - Intergenic
1180954688 22:19736395-19736417 GTGGGGGCCTCGAGGGCAGCTGG + Intergenic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181199463 22:21208954-21208976 GTGGGGGACTGGGGTGGAGAGGG - Intronic
1181201168 22:21218067-21218089 GTGGGGCTCAGGGGGGAAGCAGG - Intronic
1181295759 22:21837312-21837334 GCAGGGCTCTGGAGGAAAGAAGG + Intronic
1181339311 22:22165680-22165702 GTGAGGGGCAGAAGGGAAGAGGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181527776 22:23500043-23500065 GTGGAGGTGAGGCGGGAAGAGGG - Intergenic
1181640042 22:24191507-24191529 GTGGGAGGCTGGAGGGCAGGGGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181649069 22:24248888-24248910 GTGGGGGACTGGGGTGGAGAGGG - Intergenic
1181702271 22:24628001-24628023 GTGGGGGACTGGGGTGGAGAGGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182090895 22:27594137-27594159 GGGAGGGACTGGAGGGAGGAAGG + Intergenic
1182249921 22:28992156-28992178 GCGGGGGGTTGGGGGGAAGAGGG - Intronic
1182624141 22:31633790-31633812 GTGGAGGTCTGGTTGGAAGGTGG - Intronic
1183085827 22:35486405-35486427 GTGGAGGTAAGGAGGGGAGAGGG - Intergenic
1183339362 22:37271072-37271094 ATGGGGGTGAGGAGGGTAGAGGG + Intergenic
1183469641 22:37998580-37998602 GAGGGAGTCTGGAAGGAACAGGG - Intronic
1183591077 22:38779606-38779628 GCGGCGCTCTGGAAGGAAGAGGG + Exonic
1183617458 22:38954329-38954351 GTGGGGGTATGGGGGACAGAGGG + Intronic
1183724835 22:39582754-39582776 GTGGGTGTATGGGGGAAAGATGG - Intronic
1183729962 22:39612845-39612867 GTGGAGGGATGGAGGGAAGGAGG - Intronic
1183966570 22:41446206-41446228 AGTGGGGTCTGGAGGGAAGCTGG + Intronic
1184236863 22:43187344-43187366 GCGGGGGGCTGGGGGGAGGACGG - Intergenic
1184552537 22:45212242-45212264 GTGGGGGTCGGGAGTGGTGAGGG - Intronic
1184741385 22:46430744-46430766 GTGGGGGCCTGGAGGGGTGGCGG - Intronic
1184924195 22:47625930-47625952 GTGGGAGTATGGAGGGCAGAGGG - Intergenic
1185025528 22:48408196-48408218 GTGGGGGTGTAGAGAGAAGCAGG - Intergenic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
1185232942 22:49693758-49693780 GGGGGGGTCTGGGAAGAAGAGGG + Intergenic
1185417126 22:50716367-50716389 GTGGGGGACGGGAGACAAGATGG - Intergenic
1203225745 22_KI270731v1_random:77364-77386 GTGGGGCTCAGGGGGGAAGCAGG + Intergenic
1203227363 22_KI270731v1_random:85952-85974 GTGGGGGACTGGGGTGGAGAGGG + Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1203263390 22_KI270734v1_random:320-342 GTGGGGGACTGGGGTGGAGAGGG - Intergenic
1203265083 22_KI270734v1_random:9420-9442 GTGGGGCTCAGGGGGGAAGCAGG - Intergenic
950098390 3:10343255-10343277 CTCGGGGGCTGGAGGGGAGAGGG - Intronic
950894853 3:16439676-16439698 GTGGGTGGCTGGAGTGAGGAAGG + Intronic
950903411 3:16516477-16516499 GATGGGGTCTGGTGGGAAGAAGG - Intergenic
951369319 3:21826024-21826046 GTGGGGGGTTGAGGGGAAGAAGG - Intronic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952943849 3:38462955-38462977 GTTGGGGTGTGGAGGTAGGAAGG - Intronic
953232998 3:41081064-41081086 GTGTTGGTCTGTATGGAAGATGG + Intergenic
953403184 3:42644784-42644806 GTGGAGATCTGCAGGGTAGATGG - Intronic
954063399 3:48088161-48088183 GTGGGGGTGGGGAGGGTACAGGG - Intronic
954460826 3:50625921-50625943 GTGGGGGTGGGGAAGGAAGGAGG + Intronic
954916147 3:54149973-54149995 GAGGGGGAGGGGAGGGAAGAAGG - Intronic
955059830 3:55485150-55485172 CTGGTGGTCGGGAGGGATGAAGG + Intronic
955389790 3:58513118-58513140 CTGGGGGTCAGTAGGGAGGAGGG - Intronic
956066372 3:65401369-65401391 GTGGGGGGCTGGAGGTGGGAGGG - Intronic
956159669 3:66335891-66335913 GTGGTGGTGGGGAGGGAAGGAGG + Intronic
956725694 3:72154905-72154927 GTGGGGGCATGGAGAGAAGCAGG - Intergenic
956860218 3:73315867-73315889 GCAGGGGGCTGGAGGGAGGAGGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
957228003 3:77473917-77473939 ATGGGGGTTTGGAGGAAGGAAGG - Intronic
957893207 3:86386685-86386707 GTGGGGGTCGGGAGGAAGGTCGG + Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
959095684 3:101952942-101952964 GTTGGGGTCTAGGGGGAAGAAGG - Intergenic
959521394 3:107326567-107326589 GCAGGAGTTTGGAGGGAAGAAGG + Intergenic
959612803 3:108313927-108313949 GTTGGGGTCTGGAGACAAAAAGG - Intronic
959822607 3:110754460-110754482 GTGGAGGTCTGAAGGAGAGAGGG + Intergenic
960013756 3:112862049-112862071 GTGGGGGAATGGTGGGAAGGTGG - Intergenic
961214268 3:125147552-125147574 GAGGGGATCCGGAGGGAGGAGGG - Intronic
961666757 3:128497600-128497622 GTGCGAGTGTGGAAGGAAGAGGG + Intergenic
961736411 3:129004515-129004537 GTGGGGGGATGGATGGATGATGG - Intronic
961909623 3:130301264-130301286 GTGGGGGCTGGGAGGGCAGAGGG + Intergenic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
962502694 3:136011070-136011092 GTGGGGGTGTTGTAGGAAGAAGG - Intronic
962755088 3:138460478-138460500 GTGGGGGTTCGGAGGAAAGCAGG - Intronic
963607059 3:147420873-147420895 GCGGGGGTTTGGAGGAACGAGGG - Intronic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
964037888 3:152220830-152220852 GTGGGGGTTTGGGGGAGAGAGGG - Intergenic
964131962 3:153299266-153299288 GTGGGGGGCTGGTGGGAGGAGGG + Intergenic
964209633 3:154212595-154212617 GTGGGGGGCTGGGGGGTAGGTGG + Intronic
964242343 3:154611261-154611283 GAGGGGGAAGGGAGGGAAGAAGG - Intergenic
964853263 3:161117975-161117997 GTGGGGGTCTGGGGGGTAGGTGG + Intronic
965883410 3:173414108-173414130 GTGGGGGCCTGGAAGGGAGAGGG + Intronic
967072586 3:185974461-185974483 GTGGGAGGCTGTAGGGAAGCAGG + Intergenic
967236005 3:187384260-187384282 GTGGGATGCTGGAAGGAAGAAGG - Intergenic
967870340 3:194224209-194224231 GTGGGGTGCTGGAGGGGAGGGGG - Intergenic
968479551 4:827138-827160 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
968534043 4:1112873-1112895 GTGGGGGGCTGCAGGGAGGAAGG - Intronic
968890341 4:3365342-3365364 CAGGGAGTCTGGAGGGAGGAGGG + Intronic
968909043 4:3467283-3467305 GGGGAGGGCGGGAGGGAAGAAGG - Intronic
968937048 4:3617069-3617091 GGGAGGGACAGGAGGGAAGAAGG - Intergenic
969088555 4:4675117-4675139 GTAGGTGTTTGGAAGGAAGAAGG - Intergenic
969515679 4:7646955-7646977 GAGGGGGTTTGGTGGGAACAGGG + Intronic
969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG + Intronic
969738001 4:9003948-9003970 GTGGGGGGGTGGAGGGTGGAGGG + Intergenic
969939862 4:10721187-10721209 GTTGGGGGCTGGAGGGAACTGGG + Intergenic
970510968 4:16781443-16781465 GAGGGAGTCTGGAGGACAGAAGG + Intronic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
970976752 4:22050500-22050522 GTGGAGGGGTGGAGGGCAGAGGG + Intergenic
971664331 4:29462184-29462206 GAGGGGGGATGGAGGGAGGAGGG + Intergenic
971787505 4:31123812-31123834 ATGGGGGTCTGGAAAGAGGATGG + Intronic
971891903 4:32535075-32535097 GTGGAGGACTGGAGGGAAGGTGG + Intergenic
972645334 4:40962721-40962743 GTGGGGGAAGGGAGGGAAGGAGG + Intronic
972726048 4:41746995-41747017 TTGGGGGGCGGGAGGGGAGAAGG + Intronic
972843513 4:42959424-42959446 GTGGGGGATGGAAGGGAAGAAGG + Intronic
974109628 4:57511317-57511339 GTGGGGGTTCCCAGGGAAGAGGG + Intergenic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
975924269 4:79430191-79430213 GTCGAGGGCTGGAGGAAAGATGG - Intergenic
976047526 4:80968855-80968877 GTGGGGGGAAGGAGAGAAGAGGG - Intergenic
976145465 4:82038703-82038725 GCAGGGTTCTGGAGGAAAGAGGG + Intronic
976613400 4:87052418-87052440 GTGGTGGTGTGGGGGGAGGAGGG - Intronic
976806068 4:89048457-89048479 GTGGGGGTGGGGAGGGATGGTGG + Intronic
976953744 4:90867675-90867697 GTGGAGGTATTGGGGGAAGAGGG - Intronic
977260411 4:94790434-94790456 TTGGGGTTCTGGAGGCAGGAAGG + Intronic
977539082 4:98293676-98293698 GCGGGGGCGTGGAGGGAAGTAGG - Intronic
978324729 4:107539551-107539573 GTGGTGGTCTGGAATGAAGTGGG + Intergenic
979306855 4:119155580-119155602 GTGGGGCTGAGGAGGGCAGAGGG + Intronic
979346915 4:119598836-119598858 CTGGGGGGTTGGAAGGAAGATGG + Intronic
979689654 4:123547152-123547174 GTTGGGGGCTGGAGGGGGGAGGG - Intergenic
980836730 4:138203108-138203130 ATTGGGGTGGGGAGGGAAGAAGG - Intronic
981093754 4:140758157-140758179 GTGGGAGACAGGAGGGCAGAAGG - Intergenic
981113744 4:140965750-140965772 GTGGGGGAGTGGAGAGAAAATGG + Intronic
981346862 4:143685867-143685889 GTGGGGGCCTGGAGGAGGGATGG + Intronic
981607868 4:146559061-146559083 GTAGGGGACTGGAGCCAAGACGG - Intergenic
982101247 4:151970352-151970374 GTAGGGGATTGGAGGGGAGAAGG - Intergenic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
983060076 4:163149871-163149893 TTGGGGGACTGCAGAGAAGAGGG + Intronic
983111691 4:163758195-163758217 GAGGGAGTCTGGAAGGCAGAAGG + Intronic
984256965 4:177400869-177400891 GGGAGGGACTGAAGGGAAGATGG - Intergenic
984533885 4:180948427-180948449 GTGGGGGATTGGAAGGAAGCAGG - Intergenic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
984933625 4:184870313-184870335 GTGGGGGTGTGTAGGAAAGCAGG - Intergenic
985100990 4:186458486-186458508 GTGGGGGGAGGGAGGGACGAGGG - Intronic
985484482 5:140796-140818 GTGGGGGTTTGTAGGGAAGGGGG - Intronic
985484507 5:140863-140885 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985484554 5:140990-141012 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
986056472 5:4142201-4142223 GTGGGTGACTGGAGGTAAGAGGG + Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986533931 5:8766845-8766867 GAGGGGAGATGGAGGGAAGAGGG + Intergenic
986602554 5:9487490-9487512 GTGGAGGTTTGGGGGAAAGATGG + Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987595155 5:19988369-19988391 GTGGGGGGTTGGGGGGGAGAAGG - Intronic
988813477 5:34807545-34807567 GTGGGGTGCTGGAGTGATGAGGG + Intronic
989304559 5:39938391-39938413 GTGGTGGCATGGTGGGAAGAGGG - Intergenic
989553758 5:42766768-42766790 GTGGGGGGCTGGAAGGGAGGTGG + Intronic
991493792 5:67208545-67208567 GAAGGGGTCTGGAGGGAAGCAGG + Intergenic
991577849 5:68123150-68123172 GTGGTTGTTTGGAGGAAAGAAGG - Intergenic
991659704 5:68938015-68938037 GTCGGGGTGGGGTGGGAAGAGGG - Intergenic
991666759 5:69006981-69007003 GAGGGGCACAGGAGGGAAGAAGG + Intergenic
992103752 5:73432898-73432920 GTGGGGGTCCGAATGTAAGAGGG - Intergenic
992571514 5:78064017-78064039 GGGGGGGTCGGGCAGGAAGAGGG + Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993413741 5:87601234-87601256 GTGGGGGTTCCCAGGGAAGAGGG + Intergenic
993467778 5:88269141-88269163 GTGGGGAGCGGGAGGGGAGAGGG + Intronic
993564029 5:89450405-89450427 GTGGGGAGCTAGAGGGATGAGGG + Intergenic
993971341 5:94423178-94423200 CTGGGGGGTTGGAGGGATGAAGG + Intronic
994742379 5:103636736-103636758 GTTGGGACCTGGAGGAAAGATGG + Intergenic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
996928050 5:128852413-128852435 GTGGGGGATTGGAGGGAGGGAGG + Intronic
997394933 5:133552125-133552147 GTGGAGGGCAGGAGGGAAGGTGG - Intronic
997603523 5:135156555-135156577 GGATGGGTCTGGAGGGAACAAGG + Intronic
998401865 5:141852547-141852569 GGGGGTTTCTGGAAGGAAGAGGG + Intergenic
998707736 5:144782959-144782981 GCGGGGGGGTGGGGGGAAGAGGG + Intergenic
999125795 5:149244947-149244969 GTAGGGGTCTGGCGAGTAGATGG - Exonic
999156951 5:149464885-149464907 GTGAGGGTCTGGCTGGAAGATGG - Intergenic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
999493430 5:152073670-152073692 TAGGGGGTCTGGAGAGAGGAGGG + Intergenic
999620803 5:153471273-153471295 GTTGGGGGGTGGAGGGCAGAAGG - Intergenic
1000109681 5:158095943-158095965 GTGGGGGAGTGGAAAGAAGATGG + Intergenic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1001209186 5:169794283-169794305 GTGGGGAAGTGGAGGGAAGGAGG - Intronic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1001961216 5:175881146-175881168 GTGGGGATGGTGAGGGAAGAGGG + Exonic
1002063045 5:176637738-176637760 GAGGAGGGCTGGAGGGAGGAGGG + Intronic
1002123336 5:177022720-177022742 GTGAGGGTTTGCGGGGAAGATGG + Exonic
1002193861 5:177491969-177491991 GTGGGGGCCTGGGTGGAAGTGGG + Intronic
1002584332 5:180232571-180232593 GTGGGGGTTTTCAGGGAGGAGGG - Intergenic
1002670409 5:180861596-180861618 GTGGGGGCCTGGCGGGAAATGGG + Intergenic
1002698712 5:181107672-181107694 GTGGGTGTCTCCCGGGAAGACGG + Intergenic
1003583760 6:7367152-7367174 GAAGGGGGATGGAGGGAAGAGGG - Intronic
1003885246 6:10515785-10515807 GTAGGGGTATGGAGGGAAAGGGG - Intronic
1004179333 6:13367456-13367478 ATGGGGGTCGGGAAGGAAGCAGG - Intronic
1004250784 6:14021726-14021748 GAGGGGGAGGGGAGGGAAGAAGG - Intergenic
1004538463 6:16525533-16525555 GTAGGGGGCTGGAGGGGAGGTGG + Intronic
1004570540 6:16840389-16840411 GTGGGGGTGGGGAGGGAAAGTGG + Intergenic
1005907559 6:30277748-30277770 GTGGGGGGCTGAAGGGAAGGTGG - Intergenic
1005996925 6:30937137-30937159 GTGGGGGTCTGGGGGGCTGGAGG + Intergenic
1006058861 6:31404683-31404705 TTGGGGGTCTGGAGGGGAGTGGG - Intronic
1006071346 6:31499568-31499590 TTGGGGGTCTGGAGGGGAGTGGG - Intronic
1006104269 6:31707233-31707255 GAGGGGGTCTGAGGGCAAGAGGG - Intronic
1006104933 6:31710749-31710771 GTGGGGGACTGAAGGAAAGGAGG + Intronic
1006635336 6:35457637-35457659 GTTGGGGTCTGGGTAGAAGATGG - Intronic
1006907685 6:37544144-37544166 ATGGGAGACTGGAGGGAGGAAGG + Intergenic
1007246993 6:40470132-40470154 GTGGGGTTCTGCAGGCAGGATGG - Intronic
1007436916 6:41820361-41820383 GTGGTGGTAGGGAGGGAAGCTGG - Intronic
1007742384 6:44020807-44020829 GTGGGGCTCTGAAGGAAGGAAGG + Intergenic
1007809859 6:44478064-44478086 GTGCCAGGCTGGAGGGAAGAGGG + Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008688197 6:53946891-53946913 GTGGTTGTTTGGAGGAAAGAAGG - Intronic
1008740777 6:54605349-54605371 GTTGGGGGCTGGAGGGAAACGGG - Intergenic
1009469180 6:64010404-64010426 GTGGTGGTGTGGAGAGAAGGGGG + Intronic
1009998308 6:70921639-70921661 GGGGTTGTCTGGAGGTAAGAAGG + Intronic
1010018382 6:71130950-71130972 GTGGTGGGCAGGAGGGAAGTGGG - Intergenic
1011268197 6:85548082-85548104 AGGGGGGGCTGGAGGGAGGAAGG + Intronic
1011704349 6:89985952-89985974 GTGTGGGGCTGGAGGGATGCGGG + Intronic
1011716511 6:90111239-90111261 GTGGTGGCCTGGACAGAAGATGG - Intronic
1011997623 6:93613120-93613142 GTGGGGCGGTGGGGGGAAGAGGG + Intergenic
1012028868 6:94032410-94032432 GTGGGGATCAAGAGGGAAGTAGG + Intergenic
1012945748 6:105463845-105463867 GTGGGGGGATGGGGGGGAGAGGG - Intergenic
1013512371 6:110856766-110856788 TTCAGGCTCTGGAGGGAAGAAGG + Intronic
1013718694 6:112995738-112995760 GTCAGGGACTGGAGGGAGGAAGG - Intergenic
1013878216 6:114860617-114860639 GTGGGGGTGTGGAGGGTAGGGGG + Intergenic
1014132236 6:117847299-117847321 GTGGTTGTTTGGAGGAAAGAAGG - Intergenic
1014246732 6:119078296-119078318 GCTGGGGTCTGTTGGGAAGATGG - Exonic
1015325765 6:131921695-131921717 GTGGGGGGCTGGCGGGGAGGTGG + Intergenic
1015667932 6:135652492-135652514 GTGGGGGGCTGGGGGGAGGGGGG - Intergenic
1015678983 6:135782293-135782315 GTGGTTGTTTGGAGGAAAGAAGG - Intergenic
1016559909 6:145384410-145384432 GTGGGGGCATGGAAGGAAGAAGG + Intergenic
1016631093 6:146232659-146232681 TTGGGGGGCTGGAGGGCAGGTGG - Intronic
1016672134 6:146721492-146721514 GGGGGAGTATGGAGGTAAGAGGG + Exonic
1016683132 6:146853373-146853395 CTGGGGGTCTGGAGGAAATGAGG - Intergenic
1016692812 6:146958189-146958211 GTGGCAGTCTAGAGGGAAGGTGG + Intergenic
1016706914 6:147119470-147119492 GCCAGGGGCTGGAGGGAAGAGGG + Intergenic
1016762495 6:147753689-147753711 GTGAGGGGCTGGGGGGAAGGTGG - Intergenic
1017065754 6:150527757-150527779 GTCGGGGGCTGGAGGGAGGCTGG - Intergenic
1017356379 6:153514174-153514196 GTGGGGGGCTGGAGAGCAGGTGG - Intergenic
1017385276 6:153875875-153875897 GTGAGGGTGTGGAGGGGTGAGGG - Intergenic
1017479533 6:154837773-154837795 GTGGGGGTATGGGGAGTAGAGGG + Intronic
1018033794 6:159865188-159865210 GTGGGGATGTGGGGTGAAGAGGG + Intergenic
1018040373 6:159916327-159916349 GCCGGGGGCTGGAGGGAGGAGGG + Exonic
1018476061 6:164142934-164142956 GGGAGGGTCTGGAGGAAGGAAGG + Intergenic
1018767266 6:166944459-166944481 GTGGGGGGCTGGAGGGGAAGAGG - Intronic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1018897172 6:168027697-168027719 GTGGGGATGTGGAGGGAAGCCGG - Intronic
1019000337 6:168744240-168744262 GTGGGGGGCTGAAGGGCTGAAGG + Intergenic
1019422800 7:958847-958869 GATGGGGTCTGGAGTGGAGAAGG + Intronic
1019455417 7:1124309-1124331 GTGGGGATCTGGCTGGAGGAGGG + Intronic
1019494907 7:1333325-1333347 GAGGAGGTGAGGAGGGAAGAGGG - Intergenic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1020013581 7:4818791-4818813 GCGGGGCACTGGTGGGAAGAGGG + Intronic
1020035277 7:4959942-4959964 GTGGGGGGTTGGTGGGAAGAAGG + Intergenic
1020283541 7:6663779-6663801 GTGGGGGGGTGAAGGGAAGAGGG + Intergenic
1021174667 7:17437428-17437450 GTGGGGAATTGGAGGGCAGAAGG + Intergenic
1022239932 7:28500738-28500760 GGGGGAAGCTGGAGGGAAGATGG + Intronic
1022393014 7:29959951-29959973 GTGGGGGGAGGGAGGGAGGAGGG + Intronic
1022471253 7:30682942-30682964 GAGGAGGCCTGGAGGGAAGCAGG + Intronic
1022510287 7:30930971-30930993 CTGGGGGTCTGGTGGGAGGCTGG + Intergenic
1022879679 7:34573491-34573513 GTAGAGGACTGGAAGGAAGAGGG - Intergenic
1023063207 7:36349514-36349536 GTGGGTGTGTGGAGGCAAGGAGG - Intronic
1023255880 7:38311632-38311654 GTGGGGGTCTGCTGGGCAGCAGG - Intergenic
1023367159 7:39475425-39475447 GAGGGGCTTTTGAGGGAAGATGG + Intronic
1023699373 7:42877616-42877638 GAGGGGGACTGGTGGGCAGAGGG - Intergenic
1023862998 7:44226797-44226819 GGGGGGGTGTGGGGGGAAGATGG + Intronic
1023864924 7:44234025-44234047 GTGGGGTCCTGGTGGGGAGAGGG + Intronic
1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG + Intronic
1026447525 7:70498575-70498597 GTGGGGGGTTGGTGGGCAGAAGG + Intronic
1026531044 7:71197576-71197598 GTGGGGGAGTGGAGGAAAGTGGG - Intronic
1026877963 7:73890553-73890575 GAGGGGGTCTGCAAGGAAGTGGG - Intergenic
1028365713 7:90028293-90028315 GTGGGGGGCTGCAGGGGAGGTGG + Intergenic
1029146124 7:98447381-98447403 GTGGGAGGATGCAGGGAAGAGGG + Intergenic
1029452054 7:100646867-100646889 GCAGGGGTCTGGGGGGAAGGGGG - Intronic
1029605593 7:101597863-101597885 GTGGGGGTGGGGAGGATAGAAGG - Intergenic
1029745163 7:102512445-102512467 GTGGGGGTTAAGAGGGAAGGGGG + Intronic
1029763155 7:102611606-102611628 GTGGGGGTTAAGAGGGAAGGGGG + Intronic
1029985662 7:104921012-104921034 GTGGGGTGGGGGAGGGAAGATGG - Intergenic
1030445337 7:109642216-109642238 GTGGTGGTATGGAGGGATAATGG + Intergenic
1031140762 7:117940507-117940529 GAGGGCGACTGGAGGGGAGAAGG + Intergenic
1031542608 7:123013323-123013345 GTGGGTGAAGGGAGGGAAGAAGG - Intergenic
1031746062 7:125499612-125499634 GTGGGAGTTTGCAGGGGAGATGG - Intergenic
1031966377 7:128031027-128031049 GTGGGGGCGGGGAGGGCAGAGGG + Exonic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032100508 7:128972687-128972709 GTGGGGGGTTTCAGGGAAGAAGG + Intronic
1032502230 7:132408849-132408871 GTGGGGGGCGGGAGGGAGGCAGG - Intronic
1033036323 7:137879330-137879352 GTGGAAGTGTGGAGGGAGGAGGG + Exonic
1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG + Intronic
1033480581 7:141736341-141736363 GTGGGGGGCTGGAGGGAAGGTGG - Intergenic
1033544275 7:142385963-142385985 GGCGAGGTCTGCAGGGAAGATGG - Intergenic
1033755664 7:144397017-144397039 GTGGGGGTCCTGAAGGAAGCAGG - Intergenic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034436357 7:151064511-151064533 GCGGTGGTCTGCAGGGAGGAGGG - Exonic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034460033 7:151193095-151193117 GTGGGGGAATGAAGGGAAAAGGG - Intronic
1034527574 7:151675466-151675488 GTCGGGCTCTGGAAGGAAGACGG + Exonic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1034994837 7:155571037-155571059 GTGGGGGTGGGGAGGGAGGTGGG - Intergenic
1035121313 7:156570244-156570266 GTGGGTGGCTGCAGGGAAGGTGG - Intergenic
1035130689 7:156650451-156650473 GTGGGGTTCTAAAGGCAAGATGG + Intronic
1035553283 8:545406-545428 GTGGGGGTCGGCGGGGGAGAAGG - Intronic
1036051093 8:5197701-5197723 GTGGTGGGGTGGAGGGAGGACGG + Intergenic
1036776681 8:11617666-11617688 TTGGGGGTGTGGGAGGAAGAGGG - Intergenic
1037326669 8:17698733-17698755 GTTGGGGGCTTGAGTGAAGAGGG - Intronic
1037768967 8:21788025-21788047 GTGGGGGGCTGGCGGGAGGTCGG - Intronic
1038007401 8:23444403-23444425 GTGGGTTCCTGGAGGGGAGAGGG - Intronic
1038067074 8:23974369-23974391 GTGGGGGAGGGGAGGGAGGAGGG + Intergenic
1038271766 8:26081403-26081425 TTTGGGGACTGGAGGGAGGAGGG - Intergenic
1038435366 8:27532086-27532108 GTGGGGGTCTGGAGGGTCCCAGG - Intronic
1039455261 8:37701732-37701754 GTGGGTCTCTGAAGGAAAGAGGG - Intergenic
1039610644 8:38916396-38916418 GTGGGGGGCTGGGGGGAAATGGG - Intronic
1039625976 8:39053690-39053712 GTGGGAGTTTGGGGGTAAGAAGG + Intronic
1039885422 8:41651440-41651462 GTGGGAGCCTGCTGGGAAGAGGG + Intergenic
1040102283 8:43516396-43516418 GTGGGAGTGTGGAGGGTAGTAGG + Intergenic
1041719588 8:60964138-60964160 GAGGGGGTGGGGAGGGAAGAAGG + Intergenic
1042586848 8:70349008-70349030 GTGGGGGATGGGAGGGAAAAGGG + Intronic
1042803967 8:72751892-72751914 ATGGAGGCCAGGAGGGAAGAAGG + Intronic
1043523796 8:81074313-81074335 GTGAGGATCATGAGGGAAGAGGG + Intronic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1044624528 8:94223787-94223809 GAGGGGGGATGGAGGGAAAATGG + Intergenic
1044839621 8:96326765-96326787 GGGAGAGTCTAGAGGGAAGATGG + Intronic
1044866254 8:96574030-96574052 GAGGGGGTGTGGAGGGGAGGGGG - Intronic
1044994703 8:97828205-97828227 GGGGTGGTATGGAGGGATGATGG + Intronic
1046360494 8:113147660-113147682 GTAGGTGTGTGGAGGGGAGAGGG + Intronic
1046791449 8:118326601-118326623 TTGGGGGGCTAGAGGGAGGATGG - Intronic
1047191645 8:122683649-122683671 GGGGGAGTATGGAGGGAAAATGG + Intergenic
1047204097 8:122789553-122789575 GTGGTGGTCCGGAGGGAGTAGGG + Intronic
1047343628 8:124006233-124006255 GTGGGGGTTTCAGGGGAAGATGG + Intronic
1047364726 8:124201464-124201486 GAGGGGGTGGGGAGGGACGATGG - Intergenic
1047676633 8:127209562-127209584 GGGAGGGTGGGGAGGGAAGATGG + Intergenic
1048336086 8:133503516-133503538 GTGGGGGGCTGGACGGAGGGAGG - Intronic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048440903 8:134458380-134458402 CTGGGAGGCTGGAGGGAGGAGGG + Intergenic
1048890218 8:138940483-138940505 GTGGGGGGGTGGGGGGAAGGTGG - Intergenic
1048998628 8:139810072-139810094 GTGGGTTTCAGGAGGGAACAGGG - Intronic
1049070405 8:140351217-140351239 GTGGGGGGCTGGAGGGGTGCGGG - Intronic
1049097628 8:140558227-140558249 GTGAGGCTCAGGAAGGAAGAGGG + Intronic
1049271926 8:141700575-141700597 GGGGTGGTCTTGGGGGAAGATGG + Intergenic
1049380817 8:142314960-142314982 GTGGGGGTCTGCAGGCCAGGTGG - Intronic
1049469101 8:142767447-142767469 GTGGGGGGTAGCAGGGAAGATGG + Intronic
1049582205 8:143417959-143417981 GGAGGGCTCTGGAGAGAAGAGGG + Intergenic
1049702310 8:144020834-144020856 GAGAGGGTCTTTAGGGAAGAGGG - Intronic
1049702333 8:144020914-144020936 GAGGGGGTCCTGAGGGGAGAAGG - Intronic
1049702858 8:144022998-144023020 AAGAGGGTCTTGAGGGAAGAGGG - Intronic
1049703323 8:144024651-144024673 GAGAGGGTCTTGAGAGAAGAGGG - Intronic
1049850078 8:144826328-144826350 CTGGGGGTCTGGAGGGCGGCTGG + Intergenic
1051726142 9:20089531-20089553 GTGGGGGTTCCCAGGGAAGAGGG - Intergenic
1052077321 9:24159223-24159245 GTGGAGGGCTGGGGGGAAGATGG - Intergenic
1052290779 9:26837600-26837622 GTCGGGGAGTGGCGGGAAGAGGG + Intergenic
1053026304 9:34731417-34731439 GTGGGGGTTTGGGTGGGAGAAGG - Intergenic
1053391568 9:37740001-37740023 GTGGGGGTCAGGGGGCTAGAAGG + Intronic
1053542787 9:38992719-38992741 GTGGTCATTTGGAGGGAAGAAGG + Intergenic
1053564628 9:39235981-39236003 GTGGGGGGCTGGGGAGGAGATGG + Intronic
1053807235 9:41816236-41816258 GTGGTCATTTGGAGGGAAGAAGG + Intergenic
1054132524 9:61383053-61383075 GTGGGGGGCTGGGGAGGAGATGG - Intergenic
1054454100 9:65420619-65420641 GGGAGGGACGGGAGGGAAGAAGG + Intergenic
1054623357 9:67371191-67371213 GTGGTCATTTGGAGGGAAGAAGG - Intergenic
1054758363 9:68981476-68981498 GTGGGGGTGGGGAGGGCAGGAGG + Intronic
1054825330 9:69567564-69567586 GTGGGGTTGTGGAGGGGGGAGGG - Intronic
1054865868 9:70000290-70000312 GTGGGAGGCTGGAGGGAGGTGGG + Intergenic
1055338123 9:75253617-75253639 GTGGGGGGCTGGTGGGGAGGTGG - Intergenic
1055368011 9:75566646-75566668 GTGGTTGTTTGGAGGAAAGAAGG + Intergenic
1056067978 9:82956684-82956706 GTGGGGATCTGGAGAGGAGGTGG + Intergenic
1056805792 9:89727616-89727638 AGGGGGGTGTGGAGGGGAGATGG + Intergenic
1056920111 9:90780058-90780080 GTAGGGGTTTGGTGGGAAGAGGG - Intergenic
1057077240 9:92144393-92144415 TTGGGGATCGGGAGGGAAGGTGG + Intergenic
1057206678 9:93177766-93177788 ATGGGGGTCTGGAGTGCAGAGGG - Intergenic
1057254526 9:93534253-93534275 GTGGGGGACAGGAGGGGAGGTGG + Intronic
1057307435 9:93920459-93920481 CTGGGGGTCAGGAGTGAAGAAGG + Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1058090672 9:100802214-100802236 GTGAGTATCTGGAGGGATGAAGG + Intergenic
1058112567 9:101046967-101046989 TTGGGGGTCGGGGGAGAAGAGGG + Intronic
1058705405 9:107633942-107633964 GTGGGGGTCTGGTGGGTTGTGGG + Intergenic
1058923592 9:109640733-109640755 GTGCGGGTGGGGAGGGGAGACGG + Intergenic
1058944199 9:109841616-109841638 GTGGGGGGGTGGAGGGAAAGAGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060336719 9:122730639-122730661 ATGGTTGTTTGGAGGGAAGAAGG - Intergenic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1060481459 9:124018776-124018798 GAGGGGGTAGGGACGGAAGATGG - Intronic
1060721792 9:125984486-125984508 CTGGGACTCTGGAGGGAAGGAGG - Intergenic
1060807857 9:126588698-126588720 GTGGTGCTCTGGGGGGCAGATGG + Intergenic
1060848290 9:126854636-126854658 GTGGGGATCTGGAGAGTAGGAGG - Intergenic
1061244587 9:129394901-129394923 TTGGGGGTCTGCTGGGCAGAGGG - Intergenic
1061249820 9:129420230-129420252 GCGGGGCCCTGGAGGGGAGATGG + Intergenic
1061256463 9:129456434-129456456 GTGGAGGTGAGGCGGGAAGAAGG + Intergenic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061826447 9:133261108-133261130 GTTGGGGACTGGAGGTCAGAAGG + Intronic
1061874970 9:133539114-133539136 GTGAGGGGCTGGAGGGAGGCAGG + Intronic
1061895605 9:133645649-133645671 GTAGGGGTGTCGAGGGAAGAAGG + Intronic
1062343296 9:136103385-136103407 CTGGGGGTCTCGAGGGACGGAGG - Intergenic
1062430671 9:136525634-136525656 GTGGGGGTCCTGTGGGAAGCCGG - Intronic
1062567758 9:137170829-137170851 GTGAGGGCCTGCAGGGAGGACGG + Intronic
1062677077 9:137752926-137752948 GGTGAGGACTGGAGGGAAGAGGG + Intronic
1185495289 X:549972-549994 GTGGGTGGATGGATGGAAGAAGG - Intergenic
1185664908 X:1757915-1757937 GGGGTGGTCTGCAGGGGAGAGGG - Intergenic
1185680008 X:1880799-1880821 GAGGGGGTAGGGAGGGAAGGAGG + Intergenic
1185867929 X:3639453-3639475 GTGGGGGGGTGGATGGATGAAGG + Intronic
1185870116 X:3657813-3657835 GTGGGGGTAGGGATGAAAGAAGG + Intronic
1186130464 X:6460116-6460138 GTGGGGGGGTAGAGGGTAGATGG + Intergenic
1186894296 X:13990569-13990591 CTGGGGGTCAGGAGTGAAGGAGG - Intergenic
1187884710 X:23878758-23878780 GTGGGGGTCTGGGGGAAAGGTGG - Intronic
1188697722 X:33216445-33216467 GAGGGGGAATGGAGGGAAGCGGG + Intronic
1188977626 X:36694055-36694077 GTGGGGGCCTGGCGGGAGGTGGG + Intergenic
1189115896 X:38342346-38342368 GTGGGGGTATGAAAGAAAGACGG + Intronic
1189381423 X:40505208-40505230 GTGGGGGCCTGGAGGGCTGTGGG + Intergenic
1189579304 X:42388929-42388951 GTGGGGTTGGGAAGGGAAGATGG + Intergenic
1189858085 X:45243744-45243766 GTGGGGGGCTGGGAGGAAGTGGG - Intergenic
1189913466 X:45834785-45834807 GTGGGGGGTTGGAGGAAAGTGGG + Intergenic
1190107482 X:47570527-47570549 GTGGGGGTCTGGGGCCTAGAGGG - Intronic
1190276975 X:48905145-48905167 GTGGGGCTCTGGTGGGCTGAGGG - Exonic
1190322691 X:49187911-49187933 GTAGGGGTCTGGAGGGGAGAAGG + Exonic
1190322724 X:49188051-49188073 GTGGAGGTGTGGAGGGAGGGAGG + Exonic
1190415269 X:50174501-50174523 GTGGGGGATTGAAGGGATGATGG + Intergenic
1191911925 X:66160680-66160702 GTGGAGGGGTGCAGGGAAGAGGG - Intergenic
1192172861 X:68867658-68867680 GTGGGGGCGAGGAGGCAAGAGGG - Intergenic
1192175231 X:68881036-68881058 GTAGGGGTTTGGAGAGAGGAGGG - Intergenic
1192667159 X:73100065-73100087 ATGGGGGGCTGGAGCCAAGATGG - Intergenic
1193736273 X:85160277-85160299 GTGGTTGTTTGGAGGAAAGAAGG - Intergenic
1193790092 X:85807381-85807403 GTGGTTGTTTGGAGGAAAGAAGG + Intergenic
1193820871 X:86163177-86163199 GTGAAGGGCTGGAGGGAAGGTGG - Intronic
1194255205 X:91626598-91626620 ATGGAAGTCTGGAGGGGAGAGGG + Intergenic
1194406309 X:93500134-93500156 TTGGGGGTGTGGTGGGAGGAGGG + Intergenic
1194668907 X:96706524-96706546 TTGGGGATCTGGATGGGAGAAGG + Intronic
1194766950 X:97852459-97852481 GTGGGGGTAGGGTGGGAAGTTGG + Intergenic
1194838986 X:98715360-98715382 GTGGGAGTTTGCAGAGAAGAGGG + Intergenic
1194921516 X:99772109-99772131 GTGGGGGCCTGGGGGAGAGAGGG - Intergenic
1194978653 X:100417630-100417652 GTGGGGGTGGGGTGGGAAGGAGG + Intergenic
1195101352 X:101557195-101557217 GTGGGGGACTGAGGGGAAGTGGG - Intergenic
1195122335 X:101768067-101768089 GTGGGGGCCTGGAGGGGAATGGG - Intergenic
1195378443 X:104249836-104249858 GGGGAGGTGTGGAGGGAAAATGG + Intergenic
1195889133 X:109672284-109672306 ATGGGGGTGGGGAGGGGAGAGGG + Intronic
1196574011 X:117297489-117297511 GTGGGGGTGTTGTGGGAAGTTGG - Intergenic
1196683983 X:118495576-118495598 GCGAGGGTCACGAGGGAAGAGGG - Intergenic
1196916861 X:120545868-120545890 GTGGGGGTGGGGAGGGGTGATGG + Intronic
1197032435 X:121833588-121833610 GTGAGGGTTGGGAGGGAAGTGGG + Intergenic
1197275432 X:124473732-124473754 ATGGGGGCCTGGAGGGAATGGGG - Intronic
1197354861 X:125425911-125425933 GTGGGGGAATTGAAGGAAGATGG + Intergenic
1197404118 X:126029103-126029125 GTGGTTGTATGGAGGAAAGAAGG + Intergenic
1197809278 X:130427197-130427219 GCAGGGGTCTGGCGGGGAGAAGG + Intergenic
1197825808 X:130589137-130589159 GTGGGGGTGGGGAGAGCAGAAGG - Intergenic
1197969187 X:132097119-132097141 GTGAGGATCTGGAGAGAGGATGG - Intronic
1198342769 X:135731418-135731440 GTGGGGGTGTCGGGGGAAGCGGG - Intergenic
1198345220 X:135751877-135751899 GTGGGGGTGTCGGGGGAAGCGGG + Intergenic
1199795924 X:151196761-151196783 GTGGGGGTCAGGTGGGGGGATGG - Intergenic
1200296081 X:154921875-154921897 GTTGGGGGGTGGGGGGAAGAGGG + Intronic
1200397326 X:155998941-155998963 CTGGGAGTCTGGAGGTGAGACGG - Intronic
1200573932 Y:4865859-4865881 ATGGAAGTCTGGAGGGGAGAGGG + Intergenic
1201172827 Y:11285756-11285778 GTGGGGGGGGGGAGGGGAGAGGG + Intergenic