ID: 1001948499

View in Genome Browser
Species Human (GRCh38)
Location 5:175799433-175799455
Sequence CTGGAAGGTGGAAAAGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1016
Summary {0: 1, 1: 0, 2: 6, 3: 111, 4: 898}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001948491_1001948499 3 Left 1001948491 5:175799407-175799429 CCATTTTCTTCTCTAGCTCAAAG 0: 1
1: 0
2: 2
3: 31
4: 425
Right 1001948499 5:175799433-175799455 CTGGAAGGTGGAAAAGGAAGGGG 0: 1
1: 0
2: 6
3: 111
4: 898
1001948490_1001948499 4 Left 1001948490 5:175799406-175799428 CCCATTTTCTTCTCTAGCTCAAA 0: 1
1: 0
2: 2
3: 39
4: 422
Right 1001948499 5:175799433-175799455 CTGGAAGGTGGAAAAGGAAGGGG 0: 1
1: 0
2: 6
3: 111
4: 898

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001948499 Original CRISPR CTGGAAGGTGGAAAAGGAAG GGG Intronic
900016225 1:152092-152114 CTAGAAGCTGGAAAAGGCAAAGG - Intergenic
900046491 1:510683-510705 CTAGAAGCTGGAAAAGGCAAAGG - Intergenic
900068692 1:752400-752422 CTAGAAGCTGGAAAAGGCAAAGG - Intergenic
900978730 1:6034331-6034353 CTGGGAGGTGGCAAAGGTGGTGG + Intronic
901078158 1:6568534-6568556 CTGTAAGGCGGGAAAGGAATTGG + Intronic
901257530 1:7843366-7843388 CTGGAAGGTGGGAAATCAATAGG - Exonic
901355417 1:8643180-8643202 CAGGAAGGTGGAAAGTTAAGAGG + Intronic
902005521 1:13228916-13228938 CTGGAAGTTGATAAAGGAGGTGG - Intergenic
902622297 1:17657526-17657548 CTGGCTGGCGGAAAAGGCAGGGG - Intronic
902785434 1:18730063-18730085 CGGGGAGGTGAAAAAGGAAGGGG + Intronic
903128091 1:21261295-21261317 TTTGAAGGAGGCAAAGGAAGGGG - Intronic
903221543 1:21872378-21872400 CTGGCAGGGGAAAAAGGAGGGGG + Intronic
903228331 1:21906466-21906488 CTGTAAGGAAGAAGAGGAAGGGG + Intronic
904033823 1:27548837-27548859 CTGGAAGGAGGAGGAGGAGGAGG + Exonic
904310612 1:29627113-29627135 GTGGAGGGTGGAAAGGGAGGTGG - Intergenic
904440275 1:30525421-30525443 AGGGAAGGAGGAAGAGGAAGAGG + Intergenic
904619978 1:31769509-31769531 ATGGAAGGCTGAAAAGGAAGAGG - Intergenic
905191202 1:36236465-36236487 AAGGAAGGAGGAAAAGGAAAGGG - Intronic
905222687 1:36459738-36459760 CAGGAGGGTGGAAGAGGAGGAGG + Intronic
905450269 1:38051656-38051678 CTGCCAGGAGGGAAAGGAAGTGG - Intergenic
905819128 1:40976130-40976152 CAGGATAGAGGAAAAGGAAGAGG + Intergenic
905923423 1:41733729-41733751 CTGGAAAGAGGAAAGGGATGTGG + Intronic
906147107 1:43566671-43566693 CTGGATGGGAGAGAAGGAAGAGG + Intronic
906180525 1:43814562-43814584 CTGGAACCTGGAAAAGCAAGAGG - Intronic
906277038 1:44524113-44524135 CTGGAGGGGGGCAAAGGGAGGGG + Intronic
906476405 1:46172173-46172195 CAGGCAGGTGGAGAAGGAAGTGG - Intronic
907407547 1:54262895-54262917 CTGGAAGGCTGGACAGGAAGTGG - Intronic
907447364 1:54517184-54517206 CTGGTAAGTGGCAGAGGAAGGGG - Intergenic
907639662 1:56174640-56174662 CTGGAATGTGGCATAGGGAGGGG - Intergenic
907662348 1:56404876-56404898 GTGGAACGTGGAAGAGGAAGTGG - Intergenic
907831316 1:58066817-58066839 CTGCAAGGTGGAAAACGGACAGG - Intronic
907986079 1:59532153-59532175 CTGGGAAGTAGAAAAAGAAGTGG + Intronic
908149847 1:61288735-61288757 CTGACAGGTGGGAAAGGAGGAGG + Intronic
908210313 1:61893889-61893911 CAGGAAGGTGGAAAATGGAGAGG + Intronic
908250383 1:62261075-62261097 CTGGATGGTTGAGAAGGCAGTGG - Intronic
908459713 1:64337666-64337688 CTGGAAGGTGGAAACAGATGGGG - Intergenic
908514182 1:64875357-64875379 ATGGAAGATAGAAACGGAAGCGG + Intronic
909069519 1:70977688-70977710 CAGGAAGTTGGAAGAGGGAGGGG - Intronic
909656412 1:78038410-78038432 ATGGAAAGAGGAAAAGGAGGTGG - Intronic
909932639 1:81515196-81515218 CTGGGAGGAGGAAAGGCAAGAGG + Intronic
910002957 1:82359599-82359621 CAGGAAAGTGGAAAAGGAGTGGG + Intergenic
910047562 1:82936336-82936358 CTGAAAGCTGGAAAAGGCAAGGG - Intergenic
910117567 1:83749195-83749217 GTGGAAGGTGGAAAGGCAAGAGG + Intergenic
910184747 1:84526085-84526107 CTGGAATGGGAAAAAGAAAGAGG + Intergenic
910679732 1:89850416-89850438 TTGAAAAGTGGAGAAGGAAGAGG - Intronic
911157603 1:94652622-94652644 CTAGAGGCTGGAAAAGGTAGGGG - Intergenic
911637140 1:100248190-100248212 CAGGAAGGTGGAAGAGGAGGAGG - Intronic
912022542 1:105123165-105123187 GTGGAAGGTGGAAGGGCAAGTGG + Intergenic
912194346 1:107379812-107379834 CTAGCAGGTGGTAAAGCAAGTGG + Intronic
912257871 1:108079884-108079906 CTGGAAGGCAGGAAATGAAGCGG - Intergenic
912269153 1:108192039-108192061 CTGGAAGGGGGCAGTGGAAGTGG - Intronic
912398457 1:109367787-109367809 CTGTAAGGAGAAAAGGGAAGAGG - Intronic
912560848 1:110550544-110550566 CTGGAGGCTGGAAGAGGAAAGGG - Intergenic
912606522 1:110995553-110995575 CTGGAGGCTGGGAAAGGTAGTGG - Intergenic
912608291 1:111015875-111015897 CTAGAAGTTGGTAAAGGTAGGGG - Intergenic
913075989 1:115340707-115340729 CTTGAAAGTGGAAGAGGCAGGGG - Intergenic
913101441 1:115571416-115571438 CTGGAAGGTGGAAGTTGCAGTGG + Intergenic
913403129 1:118457996-118458018 ATGGAATTTGGAAAAGGTAGAGG + Intergenic
913680569 1:121185139-121185161 CCGGGAGGAAGAAAAGGAAGAGG - Intronic
914032400 1:143972781-143972803 CCGGGAGGAAGAAAAGGAAGAGG - Intergenic
914157045 1:145095186-145095208 CCGGGAGGAAGAAAAGGAAGAGG + Intronic
914900580 1:151709160-151709182 CTTGGGGGTGGAACAGGAAGGGG + Intronic
914960103 1:152197502-152197524 GGGGAAGGGGAAAAAGGAAGGGG - Intergenic
915010256 1:152678922-152678944 CTGGAAGGTTGATTAGGCAGGGG + Intergenic
915333842 1:155129379-155129401 CGGGGAGGTGGGTAAGGAAGAGG - Intronic
915463062 1:156081281-156081303 CTGGAAGAGGGAAAGGGGAGGGG - Intronic
915526920 1:156481478-156481500 ATGGGATGTGGAAAAGGAAAGGG + Intronic
915684075 1:157613603-157613625 CCAGAAGCTGGGAAAGGAAGGGG + Intergenic
915954788 1:160212753-160212775 ATGGAAAGTGGAAAAGGATGGGG + Intronic
916143723 1:161722278-161722300 CTGGAAGGTGGAGAAGGGATGGG + Intronic
916172438 1:162011008-162011030 CATGCAGGTGGAAAAGGAAAGGG + Intronic
916188765 1:162158861-162158883 TTGCCAGCTGGAAAAGGAAGGGG + Intronic
916733692 1:167588555-167588577 CCAGAAGCTGGGAAAGGAAGTGG + Intergenic
917064170 1:171073767-171073789 CTGTAAGGTGGTAGAGGAAGAGG - Intergenic
917136135 1:171789773-171789795 AAGGAAGCTGGAAAAGGAAATGG - Intronic
917448136 1:175123985-175124007 CTGGAAGATGGAAACAGAAGAGG - Intronic
917910404 1:179638710-179638732 CTGGGAAGGGGAAAAAGAAGTGG + Intronic
918259506 1:182782833-182782855 CTGGTAGGTGGAAAGACAAGAGG + Intergenic
918326219 1:183413227-183413249 CTGGAAGATGTAAAGGGAGGAGG + Intronic
918574062 1:186034215-186034237 CTAGAAGTTGGAAAAGGCAAGGG + Intronic
918721877 1:187863332-187863354 CTGGGAGGCAGAAAAGAAAGTGG - Intergenic
919046919 1:192463991-192464013 CGGGAAGGTGGAACTGAAAGAGG + Intergenic
919801971 1:201359561-201359583 CTGGAAGGTAGGGAAGGAGGGGG + Intronic
920467878 1:206203665-206203687 CCGGGAGGAAGAAAAGGAAGAGG - Intronic
921035177 1:211370902-211370924 CTAGAAGGTGGAGAATGAAATGG - Intronic
922081975 1:222306196-222306218 CTTGAAGGGGGAAAGGGAAAAGG + Intergenic
922104048 1:222497785-222497807 CTAGAAGCTGGAAAAGGCAAAGG - Intergenic
922170714 1:223152181-223152203 GTGGAAGGTGAAGAAGGAGGAGG - Intergenic
922191169 1:223319870-223319892 GTGGATGGTGGAAAAGGCAAGGG + Intronic
922199803 1:223392544-223392566 CAGCAAGGTGGAATGGGAAGTGG - Intergenic
922264369 1:223970306-223970328 CTAGAAGCTGGAAAAGGCAAAGG - Intergenic
922589852 1:226766617-226766639 CTGCAGGGTGGAAAAGGCAACGG + Intergenic
923073272 1:230585389-230585411 CTAGAAGCTGGAAAAGGCATGGG + Intergenic
923327394 1:232892763-232892785 CTGCAAGCTGGAAAAGGCAAGGG + Intergenic
923562544 1:235052227-235052249 CAGGCATGTGGAATAGGAAGGGG - Intergenic
923703170 1:236319091-236319113 CTGAAAGGGGGAAAGGTAAGGGG + Intergenic
924075067 1:240325079-240325101 GTTGAAGGGGGAAAATGAAGGGG + Intronic
924165960 1:241283719-241283741 CTGTAAGGAGGAAAATAAAGAGG - Intronic
924346218 1:243075300-243075322 CTAGAAGCTGGAAAAGGCAAAGG - Intergenic
924387297 1:243510682-243510704 GGGGAAGATGGAACAGGAAGAGG + Intronic
924577395 1:245292780-245292802 AGGGAAGGTGGAAAGGGAAATGG - Intronic
924598597 1:245468151-245468173 CTGGAAGGTGGAAATGAAGTTGG - Intronic
1063142847 10:3270946-3270968 CTGGAAAGTGGAGAAGGTAAAGG - Intergenic
1063963390 10:11325852-11325874 GTGGAAGGTGGTAAATAAAGAGG - Exonic
1064273083 10:13882422-13882444 CTTGGAGGAGGAAGAGGAAGAGG + Intronic
1064604000 10:17019377-17019399 CAGGGATGGGGAAAAGGAAGGGG - Intronic
1064932491 10:20642818-20642840 CTGGAAGGGAATAAAGGAAGCGG + Intergenic
1065380897 10:25088953-25088975 CTGGAGGCTGGAAAGGGTAGTGG - Intergenic
1065875825 10:29996424-29996446 CTAGGAGGTGGGAAAGGAAGGGG - Intergenic
1066221228 10:33336902-33336924 CTGGCAGGTTGACAGGGAAGGGG + Intergenic
1066334652 10:34463261-34463283 GGGGAAGGGGGAAGAGGAAGGGG + Intronic
1066730127 10:38429526-38429548 CTAGAAGCTGGAAAAGGCAAAGG + Intergenic
1068018925 10:51555964-51555986 CAGGAAGGGAGAAAAGAAAGGGG + Intronic
1069054577 10:63831534-63831556 CTGGAAGCTGGGAAAAGAAAAGG + Intergenic
1069542380 10:69304970-69304992 CTGGAAGCTGGAAGAGGCAAGGG - Intronic
1069559892 10:69422046-69422068 ATGGCAGGTGGAGGAGGAAGTGG + Intergenic
1070329063 10:75405118-75405140 GTGGGAGGAGGAGAAGGAAGGGG + Intergenic
1071549146 10:86552846-86552868 GTGGAAGGTGGAAGGGTAAGAGG - Intergenic
1071892010 10:90019591-90019613 CTTGCAGGCGGAAAGGGAAGAGG + Intergenic
1072542440 10:96408548-96408570 CAGAAAGGGGGAAGAGGAAGAGG - Intronic
1072677818 10:97481561-97481583 CTGGAAGGTTACAAAGTAAGAGG + Intronic
1073044823 10:100630737-100630759 CAGGAGGGTGGAAAAGGGTGGGG - Intergenic
1073307914 10:102517577-102517599 CAGAAAGGTGGATAAGGGAGAGG - Intronic
1073563861 10:104519086-104519108 CTGGAAGGAGCAGAGGGAAGAGG - Intergenic
1073651077 10:105358970-105358992 ATGAAAGCTGGAAAAAGAAGTGG - Intergenic
1074134956 10:110618144-110618166 CTGGAAGGAGGAGGAGGAGGAGG + Intergenic
1074164107 10:110859575-110859597 CTGGCAGGAGGCAAGGGAAGTGG + Intergenic
1074423160 10:113327291-113327313 CTGTAAGGCAGAAGAGGAAGAGG - Intergenic
1074791222 10:116889514-116889536 GTGGAAGGTGGAAAGGGACTAGG + Intronic
1074791251 10:116889779-116889801 CTGGAAGATGGAGATGGAAACGG - Intronic
1074875262 10:117608622-117608644 CTGGAAGAAAAAAAAGGAAGGGG - Intergenic
1074915055 10:117947485-117947507 CTGGGAGTTGGAAAAGCAAAGGG - Intergenic
1075122808 10:119676662-119676684 CTGGGAGGAGGACAAGGAACTGG - Exonic
1075182581 10:120225198-120225220 CTGGAAGGTGGCAATGGAGTGGG + Intergenic
1075301712 10:121330624-121330646 ATGGATGGAGGAAAAGAAAGAGG - Intergenic
1075469631 10:122678365-122678387 CTGGCAGATGGGACAGGAAGAGG - Intergenic
1075909363 10:126110597-126110619 ATGGAAAGTGGATATGGAAGTGG + Intronic
1076138740 10:128063251-128063273 AGGGAAGTAGGAAAAGGAAGTGG - Intronic
1076157304 10:128213673-128213695 CTGGAATGTGGAGAAAGAAGGGG - Intergenic
1076191326 10:128485497-128485519 CTGGGAGGAGGAGAGGGAAGAGG + Intergenic
1076902056 10:133344432-133344454 AGGGAAAGTGAAAAAGGAAGGGG + Intronic
1076972818 11:147161-147183 CTAGAAGCTGGAAAAGGCAAAGG - Intergenic
1077079081 11:715554-715576 GTGGAAGGTAGAAAATTAAGAGG - Intronic
1077231545 11:1460077-1460099 CTGCAAGGTGGGGAGGGAAGGGG + Intronic
1077377180 11:2210578-2210600 TTGGAAAGTGGAAAGGGAAATGG + Intergenic
1077701104 11:4443478-4443500 GGGGAGGGTGGAGAAGGAAGGGG + Intergenic
1077701142 11:4443573-4443595 GGGGAGGGTGGAGAAGGAAGGGG + Intergenic
1077701149 11:4443592-4443614 GGGGAGGGTGGAGAAGGAAGGGG + Intergenic
1077763918 11:5136294-5136316 ATGGAAGGTGGAAGTGGAGGTGG - Intergenic
1077871695 11:6268330-6268352 CTGGAAGGTAGAGAGGGCAGGGG - Intronic
1077903179 11:6506753-6506775 CAGGAAGGGGGAAAAAGAACAGG - Intronic
1077968560 11:7162717-7162739 CTGGAAGTTAGACAAGCAAGGGG + Intergenic
1078210220 11:9264788-9264810 CTGGAGGGGGGAAACGGATGAGG - Intronic
1078254325 11:9644572-9644594 GTGGAAGGAAGAAAAGAAAGTGG - Intergenic
1078659377 11:13274874-13274896 CTGGAAAGTAGAAAAGAAAAGGG + Intergenic
1079418571 11:20264185-20264207 CTGGGAAGTGGAAGAGGAAGAGG + Intergenic
1080265545 11:30397214-30397236 AAAGAAGGTAGAAAAGGAAGAGG - Intronic
1080460431 11:32450209-32450231 ATGGAAGGTGTAGAAGGGAGAGG - Intergenic
1081452400 11:43184146-43184168 GTGGAAGGTGGAAGGAGAAGAGG + Intergenic
1082095530 11:48126550-48126572 CTGCAACCTGGAAGAGGAAGAGG - Intronic
1082762675 11:57142680-57142702 CTGGGAGCAGGAAAAAGAAGGGG + Intergenic
1083054928 11:59810546-59810568 CTGGAGGGTGGGGGAGGAAGAGG + Intronic
1083414526 11:62516973-62516995 CTGGAAGGTGGGAAAGTTAAAGG - Exonic
1083475098 11:62910260-62910282 CTGGAAGGAAGAAGAGGAAGAGG - Exonic
1084038946 11:66530604-66530626 GTGGGAGGTGGAACAGGCAGGGG + Intronic
1084213353 11:67633991-67634013 CAGGCAGGTGGAAAAGGGGGTGG - Intronic
1084643976 11:70443687-70443709 CTGGAAGCCGGGCAAGGAAGTGG + Intergenic
1084756515 11:71242475-71242497 CTTAAAGGAGGTAAAGGAAGCGG - Intronic
1085289845 11:75390125-75390147 CTGGAGGGTGGAAAGGGAGTGGG - Intergenic
1085388845 11:76172018-76172040 GTGGGAGGAGGAAGAGGAAGAGG + Intergenic
1086166798 11:83788771-83788793 CAGAAAGGTCTAAAAGGAAGAGG + Intronic
1086378861 11:86230335-86230357 CTGGGAGGAGGAAGAGCAAGTGG - Intergenic
1086518767 11:87646107-87646129 GGGGAAGGGGGAAAGGGAAGGGG - Intergenic
1086603613 11:88666345-88666367 CAACAAGGTGGAAAAGGAAGTGG + Intronic
1087622678 11:100560265-100560287 ATAGGAGGTGGAAAAAGAAGTGG - Intergenic
1088183888 11:107142341-107142363 GGGGAAGGAGGAGAAGGAAGAGG - Intergenic
1089012283 11:115141158-115141180 CTGGGCGGTGGGGAAGGAAGAGG - Intergenic
1089210043 11:116793806-116793828 CAGGAAGGAGGAAAAGGAGAAGG + Intergenic
1089967952 11:122669312-122669334 CTTGAAGATGGAGGAGGAAGGGG - Intronic
1089999319 11:122940808-122940830 AAGGAAGGAGAAAAAGGAAGAGG - Intronic
1090218255 11:124990797-124990819 CTGAAAGATGGAAAAAGGAGTGG + Intronic
1090511459 11:127379950-127379972 GTGGAAGGTGGAGGAGGTAGAGG - Intergenic
1090719037 11:129455925-129455947 CTGGATGCCGGAAAAGGGAGAGG - Intergenic
1090726204 11:129529543-129529565 CTGTCAGGTGGAACAGAAAGAGG - Intergenic
1090916613 11:131169939-131169961 CTGGAAAGGAGAGAAGGAAGAGG + Intergenic
1090951953 11:131481454-131481476 CTGGATGGTGGAGAAGAAGGGGG + Intronic
1091414087 12:265269-265291 CATCAAGGTGGCAAAGGAAGTGG + Intergenic
1091928363 12:4374143-4374165 CAGAAAGGTGAGAAAGGAAGAGG + Intronic
1091936540 12:4439355-4439377 CTGGATGGTGGTTAAGGGAGAGG + Intronic
1091985263 12:4905940-4905962 CCTGAGGGTAGAAAAGGAAGAGG - Intergenic
1092157721 12:6295218-6295240 CTGGGAGCCAGAAAAGGAAGAGG + Intergenic
1092281510 12:7101243-7101265 AAGGAAGGAGGAAAAGGGAGAGG - Intronic
1092486207 12:8904078-8904100 CTGAAAGTTGGAAAAGGAAGAGG + Intergenic
1092926635 12:13278194-13278216 GTGGGAGGTGGAGAATGAAGGGG - Intergenic
1092984116 12:13828704-13828726 TTGGAAGGGGGAAAAGAAAATGG - Intronic
1093370393 12:18357775-18357797 CTTGGAGATAGAAAAGGAAGAGG - Intronic
1093590752 12:20899387-20899409 ATGGCAGAAGGAAAAGGAAGTGG + Intronic
1093604607 12:21074524-21074546 ATGGCAGAAGGAAAAGGAAGTGG + Intronic
1094491633 12:30964277-30964299 ATAGAAGGAGGAAGAGGAAGAGG - Intronic
1094491666 12:30964439-30964461 CTAGAAAGAGGAAGAGGAAGAGG - Intronic
1095106364 12:38237983-38238005 CAGGAAAGTGAAAAAGGAAAGGG + Intergenic
1095318919 12:40801650-40801672 CTGGAATGTGGTGAAGGAGGGGG + Intronic
1095678419 12:44946836-44946858 CTGGATGGTGGAAAAACCAGAGG - Intergenic
1096192301 12:49627821-49627843 ATGGGTGGTGGAAAAGGAAATGG + Intronic
1096490706 12:52011234-52011256 CTCAAAGAAGGAAAAGGAAGAGG - Intronic
1096961382 12:55581629-55581651 CTGGAGGGTGGAGAGGGAGGAGG - Intergenic
1096984829 12:55749423-55749445 CTGGCAGGTGGGAAAGGAACAGG + Intronic
1097137161 12:56867552-56867574 AAGGAAGGTTGAAAAGGAAGAGG - Intergenic
1097167601 12:57094006-57094028 GTGGAAGGGGGAAGAGGGAGTGG + Intronic
1097178868 12:57159646-57159668 CAGGAGGCTGGAAAAGGAATAGG - Intronic
1097267237 12:57753101-57753123 TTGGAAGTTGGAAAAGTGAGAGG - Intronic
1097693968 12:62759748-62759770 CAGGAAAGTGGAAAAGGAGTGGG - Intronic
1097818895 12:64107064-64107086 CTTAAAGGTGGGAATGGAAGTGG + Intronic
1098117000 12:67189782-67189804 CTGGAAAGTTGAAAAGAATGGGG - Intergenic
1098442004 12:70528861-70528883 CTGGAAGGTGCAAAAGCAGGAGG + Intronic
1098645296 12:72893111-72893133 ATAAAAGGAGGAAAAGGAAGAGG + Intergenic
1098782643 12:74706354-74706376 CTACAACGTGGAAAAGCAAGTGG - Intergenic
1099167236 12:79321595-79321617 CCTGAAGGTAGAAAAGGAATGGG + Intronic
1099582114 12:84462620-84462642 ATGGAGGGTGGAAGAGGGAGAGG - Intergenic
1099631741 12:85157286-85157308 GAGGAGGGTGGAGAAGGAAGAGG + Intronic
1099661260 12:85566503-85566525 CTGGATGGTTGGAGAGGAAGTGG + Intergenic
1100382699 12:94076372-94076394 CTAGAAGCTGAAAAAGGGAGAGG + Intergenic
1100442862 12:94633029-94633051 CTGAAAGGTGGAAGACGCAGTGG + Intronic
1100478138 12:94952843-94952865 CTGGATGCTGGAAAAGGACCTGG + Intronic
1100533902 12:95487615-95487637 CTGGAAGGAAGGAAAAGAAGAGG - Intronic
1100609884 12:96182853-96182875 CTGAATGGGAGAAAAGGAAGAGG - Intergenic
1100789953 12:98119577-98119599 CTAGAAGGAAGAAAATGAAGGGG + Intergenic
1100845068 12:98649936-98649958 AGGGAAGGTGGGAAAGGTAGTGG + Intronic
1101155673 12:101925428-101925450 CTGGAATGAGGAAAGGGGAGTGG + Intronic
1101800602 12:108018660-108018682 CAGGAAAGAAGAAAAGGAAGAGG - Intergenic
1101843062 12:108341809-108341831 GTGGACAGTGGAAGAGGAAGAGG + Intergenic
1102185811 12:110947817-110947839 CTAGAAGCTGGAAAAGGCAAGGG - Intergenic
1102260566 12:111440746-111440768 CCGAAAGATGGAAAAGGAAGAGG + Intronic
1102479673 12:113213149-113213171 CTGGCAAGTGGAAAAGTCAGAGG + Intronic
1102628412 12:114255117-114255139 GGGGAAGGGGGAAGAGGAAGTGG + Intergenic
1102660402 12:114522177-114522199 GTGGAGGGTGGAGAAGGGAGAGG + Intergenic
1102843486 12:116151980-116152002 ATGTATAGTGGAAAAGGAAGAGG - Intronic
1102897822 12:116612575-116612597 CTAGAAGCCGGAAAAGGAAAAGG - Intergenic
1103103951 12:118206289-118206311 CAGGACATTGGAAAAGGAAGTGG - Intronic
1103188982 12:118984245-118984267 GTAGAATGTTGAAAAGGAAGTGG - Intronic
1104477967 12:129085643-129085665 CTGGAATGTGGGAATGGCAGTGG - Intronic
1104492480 12:129206951-129206973 CTGGAGGGTGGGAAGGGGAGAGG + Intronic
1104570056 12:129917370-129917392 TTTGGAGGAGGAAAAGGAAGGGG - Intergenic
1104936970 12:132370451-132370473 CTGGATGGTGGGAAGGGGAGGGG - Intergenic
1104999398 12:132679877-132679899 CTGGCAGGTGGGATCGGAAGAGG - Intronic
1105342995 13:19545517-19545539 CTGGATGGGGGAAAAGGATTGGG - Intergenic
1105443161 13:20431977-20431999 CTGGAAGCTGGGAAAGTCAGAGG - Intronic
1105466491 13:20646665-20646687 ATGGAAGTTGGAAAGGTAAGAGG - Intronic
1105801814 13:23911357-23911379 CAGGAAGGAGAAAAAGGAGGAGG + Intergenic
1105850642 13:24332390-24332412 TTAGAGGGTGGAAAGGGAAGGGG - Intergenic
1106196630 13:27499651-27499673 CTGGGAGGTGGGGAAGGATGTGG - Intergenic
1107270123 13:38606437-38606459 CAGGAAGAGGGAAAAGGAAAGGG + Intergenic
1107417177 13:40211539-40211561 GTGGGAGATGGAAGAGGAAGGGG - Intergenic
1108229828 13:48325117-48325139 GTGGAGGGTGGGAGAGGAAGCGG - Intronic
1109224538 13:59676404-59676426 CTGGTGGGTGGAAGAGGAATTGG - Intronic
1109250380 13:60012621-60012643 CAGGTAGGTGGGAAAAGAAGGGG - Intronic
1109318965 13:60786129-60786151 CTTGAAGGTTGAATAGAAAGTGG + Intergenic
1109347762 13:61136472-61136494 GAGGAAGGAGGAAAGGGAAGAGG + Intergenic
1109512943 13:63403564-63403586 CTAGAAGTTGGAAAGAGAAGAGG + Intergenic
1109665141 13:65524797-65524819 GTGGAAGAGGGAGAAGGAAGAGG - Intergenic
1110767289 13:79295271-79295293 CTGCAAGGTGGGGAAGAAAGAGG + Intergenic
1110816809 13:79870318-79870340 GTGGGAGGTGGAACAGGAAAAGG - Intergenic
1111376048 13:87380105-87380127 CTGGAAGGAGGATGAGGCAGTGG - Intergenic
1111757351 13:92415091-92415113 CTGGAATGTGGAGCAGCAAGTGG + Intronic
1111762247 13:92480979-92481001 CTTGAAGTTGGAAAAGGCAAAGG + Intronic
1111797933 13:92946859-92946881 AGGAAAGGAGGAAAAGGAAGAGG + Intergenic
1111893028 13:94106833-94106855 CTGGAAGATGGATAAGGAATAGG + Intronic
1113350446 13:109524435-109524457 CTGGAAGCTGGAAAAGGCAAGGG - Intergenic
1114195823 14:20475271-20475293 CTGGAAGCTTGAAGAGGGAGGGG + Intronic
1116312034 14:43340115-43340137 CCAGAAGGGGGAAAAAGAAGAGG + Intergenic
1117286150 14:54287523-54287545 CAGGAAGGAGGAGGAGGAAGGGG + Intergenic
1117302758 14:54444714-54444736 GTGGAAGGTGGGAAGGAAAGGGG + Intergenic
1117356113 14:54925323-54925345 CTGCAAGGTGGAAAACTAATAGG + Intergenic
1117845528 14:59907530-59907552 TTGGAAGGTGTGAAAGAAAGAGG - Intergenic
1118824099 14:69364803-69364825 GTGGAAGGAGCCAAAGGAAGGGG + Intergenic
1118869442 14:69728763-69728785 CTATATGGTGTAAAAGGAAGAGG - Intronic
1119398831 14:74348600-74348622 CTGGAAGGTGGAGCGAGAAGTGG + Exonic
1119431644 14:74571913-74571935 GTGAAAGGTCTAAAAGGAAGTGG - Intronic
1119638230 14:76293871-76293893 CTGTGAGGTGGTCAAGGAAGGGG + Intergenic
1120147413 14:80994046-80994068 GAAGAAGGAGGAAAAGGAAGAGG - Intronic
1120327643 14:83050672-83050694 GTGGAAGGCAGAAAGGGAAGGGG - Intergenic
1120448970 14:84641588-84641610 GGAGAAGGGGGAAAAGGAAGGGG - Intergenic
1120758430 14:88265416-88265438 CTAGAAGCTGGAAAAGGCAAGGG + Intronic
1121650414 14:95553909-95553931 ATGGATGGTGGGAAAGGGAGGGG + Intergenic
1121740589 14:96249383-96249405 CTGGAAGGTGGAATTGAAAATGG + Intronic
1121763100 14:96462164-96462186 CTGGGAGGGGGCAGAGGAAGTGG + Intronic
1122014377 14:98781633-98781655 CTGCAAGGTGAAAAGGAAAGAGG - Intergenic
1122062699 14:99147330-99147352 GAGGAAGATGGAAAATGAAGAGG - Intergenic
1122322257 14:100862133-100862155 AAGGAAGGAGGAAAAGGAAGAGG - Intergenic
1123787035 15:23684500-23684522 GTGGAAGATGGATAATGAAGAGG - Intergenic
1123884499 15:24711529-24711551 CTAGAAGATGGAAAGGGTAGAGG + Intergenic
1124100600 15:26689420-26689442 CAGGAAGGGGCAAAAGGAACTGG + Intronic
1124601220 15:31134096-31134118 CTGGAGTGTTGAGAAGGAAGGGG + Intronic
1124994813 15:34713146-34713168 TTAGAAGGTGGAAAAGGAGATGG + Intergenic
1125102834 15:35934745-35934767 CTGGGAGGTGAAAAAGGACCTGG + Intergenic
1125194395 15:37030184-37030206 GTGGAAGGTGGAGAAGAAATGGG - Intronic
1125273783 15:37969693-37969715 GTGGAAGGTGGAGGAGGGAGAGG - Intergenic
1125508477 15:40280899-40280921 CTGGAGGGTTGAGGAGGAAGGGG - Intronic
1125853932 15:42931294-42931316 CTAGAAGCTGGAAAAGGCAAGGG - Intergenic
1126899655 15:53301802-53301824 CTGGAAGCTGGAAAAGGCAAGGG - Intergenic
1126947643 15:53841301-53841323 CTGGGAGATGGCAAAGGTAGGGG - Intergenic
1127224260 15:56913883-56913905 CTGGCTGGTGGAAAAGAATGCGG + Intronic
1127328648 15:57918299-57918321 CTGGGAGGTGGCAGAGGACGTGG - Intergenic
1128221395 15:65971203-65971225 CTGGAAGATGGAAAAGCAGGTGG + Intronic
1128266477 15:66271098-66271120 CGAGAAGGAGGAAGAGGAAGAGG + Intergenic
1128462619 15:67882745-67882767 CTGGAAGGAAGGAAGGGAAGGGG - Intergenic
1128608896 15:69058368-69058390 CTGAAAGGGGCAATAGGAAGGGG + Intronic
1128721144 15:69949332-69949354 CTGTAATGAGGAAAAGGAGGAGG - Intergenic
1128875669 15:71199226-71199248 CTGAAAGGAGGAAAGGGATGGGG - Intronic
1129023708 15:72548448-72548470 CTTGAAGGTGGGAAAGGAAATGG + Intronic
1129254820 15:74328242-74328264 CAGCAAGGAGGAAGAGGAAGGGG + Intronic
1130286581 15:82560283-82560305 GTGAAATGTGGAAAAGGATGAGG - Intronic
1130350931 15:83091211-83091233 CTGGGAGAAGGAAAAGGAAAGGG - Intergenic
1130395155 15:83494965-83494987 CTGGAAGGGGGAGAGGGAGGAGG - Intronic
1130834987 15:87641244-87641266 CTGCAAGGTGGAAAATGAGACGG - Intergenic
1130895362 15:88166264-88166286 CTGGAAGGCAGAAGTGGAAGGGG + Intronic
1131117006 15:89801913-89801935 CTGGGAGGAGGACAAGAAAGAGG + Intronic
1131229385 15:90648754-90648776 CTATATGGTCGAAAAGGAAGAGG + Intergenic
1131532439 15:93205246-93205268 CTAGAAGCTGGAAAAGGCAAGGG + Intergenic
1131717651 15:95130795-95130817 CTGGAAGATTGAAAAAGCAGGGG + Intergenic
1131809712 15:96160355-96160377 TTGGAAGGGGGAAAAAGATGAGG - Intergenic
1131978110 15:97966065-97966087 AGGGAAGGAGGAAAAGGAGGAGG - Intronic
1132157885 15:99509226-99509248 CTGGAAACTGGAAAGGGGAGCGG + Intergenic
1132183277 15:99779023-99779045 CTTGAAGTTGGAAAAGGCAAAGG - Intergenic
1132252669 15:100345939-100345961 TTGGAAGGTGGAACAGCTAGGGG - Intergenic
1133636457 16:7670494-7670516 GTGAAAGATGGGAAAGGAAGAGG + Intronic
1134692067 16:16197615-16197637 GGGGAAGGAGGAAAAGGAAGGGG + Intronic
1135149163 16:19990345-19990367 CTGCAAGATGGGAAAGGAAAGGG - Intergenic
1135256096 16:20942610-20942632 TTGGAAGGTGGAGAAGGGAAGGG + Intronic
1135589038 16:23692091-23692113 CTGGAGGATGGAAGAGGAGGAGG + Intronic
1136197957 16:28667012-28667034 GTGGAAAGTGGGAGAGGAAGGGG + Intergenic
1136259024 16:29061034-29061056 GTGGAAAGTGGGAGAGGAAGGGG + Intergenic
1137270925 16:46901828-46901850 CTGGCAGGTGGGAAAGCAAGGGG - Intronic
1137410418 16:48223338-48223360 CTGGAAGGAGGAAGAAGATGAGG - Intronic
1137574391 16:49589147-49589169 CTGGAATGTGGAGTGGGAAGAGG - Intronic
1137792201 16:51184788-51184810 TTGGGAGGAGGAAAAGGAAGAGG + Intergenic
1138186078 16:54978614-54978636 CTTGAATGGGGAGAAGGAAGCGG - Intergenic
1138371752 16:56532604-56532626 CTGGCAGGTGGAGATGAAAGTGG - Intergenic
1138419995 16:56892825-56892847 CTGGCAGGTGGAACAGGAACCGG - Intronic
1138434321 16:56988857-56988879 CTGGAGGGGGCAGAAGGAAGGGG - Intergenic
1138541600 16:57691051-57691073 AAGGAAGGAGGAGAAGGAAGAGG + Intergenic
1138652762 16:58471045-58471067 CTGGAAGCTGGAAAAGGCAGGGG + Intronic
1139004277 16:62551567-62551589 ATGGAAGGGGAAAAAGGAAAGGG - Intergenic
1139148313 16:64349263-64349285 CTGAAAGGAGGTAGAGGAAGAGG - Intergenic
1139183283 16:64771772-64771794 CTGGAAAGTGAAGCAGGAAGGGG + Intergenic
1139235331 16:65332364-65332386 CATGAAGAAGGAAAAGGAAGAGG - Intergenic
1139293233 16:65876671-65876693 GTGGAATGGGGAAAAGGAAGAGG + Intergenic
1140554652 16:75907982-75908004 GTGGAAGGTGGAAGAGCAAGAGG - Intergenic
1140770897 16:78203130-78203152 CTGGATGGTGGGGAAGAAAGAGG + Intronic
1141410795 16:83831616-83831638 CAGGGAGGTGGCAAAGGGAGAGG - Intergenic
1141597552 16:85106610-85106632 CTGGAAGCTGGAAAAGGCGAGGG + Intronic
1142447432 16:90150366-90150388 CTAGAAGCTGGAAAAGGCAAAGG + Intergenic
1142460061 17:84966-84988 CTAGAAGCTGGAAAAGGCAAAGG - Intergenic
1142532270 17:588579-588601 CTGAAAGGTAAAAAGGGAAGAGG - Intronic
1142716310 17:1748776-1748798 CTGGGAGGTGGGGAAGGGAGTGG + Intronic
1142835202 17:2580426-2580448 CTGGGAGGAAGAAAAGGCAGTGG + Intergenic
1143017870 17:3900976-3900998 CTGGAAGGTGGTCAGAGAAGGGG + Intronic
1143346060 17:6250096-6250118 CTGGGAGGTGGCAAGGCAAGGGG + Intergenic
1143478415 17:7215878-7215900 CTGGGGGGTGGGACAGGAAGTGG - Intronic
1143618782 17:8069373-8069395 GTGGAAGGTGCAGAAGAAAGGGG - Intergenic
1143710986 17:8735255-8735277 CTGGAGAGTGGATAAGGACGGGG + Intronic
1143821434 17:9567162-9567184 CTGGAAGGAGGAAGAGGATTAGG + Intronic
1143893032 17:10116869-10116891 CTGGAAGGTGATAAATGATGAGG + Intronic
1143941507 17:10547158-10547180 CTGGAGTGGGGAAAAGGAATGGG + Intronic
1144101403 17:11945179-11945201 CTGGCAGGGGGAAGGGGAAGAGG + Intronic
1144115388 17:12084677-12084699 CTGGCAGGTGGAAATGGGAGAGG + Intronic
1144201413 17:12945695-12945717 CTGGAAATTCGAAAAGGAATGGG + Intronic
1144309757 17:14001751-14001773 CAGGAAGAAGGAAAAAGAAGAGG - Intergenic
1144738615 17:17568836-17568858 CTGGGAGGAGGAAGAGGAGGAGG - Intronic
1144741457 17:17584863-17584885 CTGGGAGGTGGGAATGGTAGAGG + Intronic
1144887948 17:18476810-18476832 CTGGCAGGTGTCAAAGGCAGTGG + Exonic
1145144260 17:20467491-20467513 CTGGCAGGTGTGAAAGGCAGCGG - Exonic
1145175711 17:20698891-20698913 CTGGCAGGTGTGAAAGGCAGCGG - Intergenic
1145721996 17:27082348-27082370 ATGGAGGGTGGGAAAGGAAGGGG + Intergenic
1145749087 17:27342350-27342372 CTTGAATGTGGAAAAGCAAATGG + Intergenic
1145775482 17:27524902-27524924 CTGTAAGGTGGAAAACGGTGGGG + Intronic
1145956481 17:28858335-28858357 CAGGAAGAAGGAAAAGGAAATGG - Intronic
1146227489 17:31079487-31079509 CTGGGAAGTGGGAAAGGGAGCGG + Intergenic
1146274026 17:31503471-31503493 AGGGAAGGGGGAAGAGGAAGAGG + Intronic
1146285722 17:31572991-31573013 ATGGAATGGGGAGAAGGAAGGGG + Intronic
1146466306 17:33089372-33089394 CTAGAAGCAGGAAAAGGCAGGGG + Intronic
1146472858 17:33138604-33138626 CAGGAAGGTGGGGCAGGAAGGGG - Intronic
1147455686 17:40536737-40536759 CTGGAAGGTGTAGGAGGAAAGGG + Intergenic
1148071399 17:44910878-44910900 AAGGAAGATGGAAAAGGGAGGGG + Intronic
1148212429 17:45816613-45816635 CTGGGAGGTGGGACAGGATGGGG + Intronic
1149015398 17:51903382-51903404 TGTGAAGGAGGAAAAGGAAGCGG - Intronic
1149028797 17:52061337-52061359 CTAGAAGGTGGAGAAGGCAAGGG + Intronic
1149066433 17:52485964-52485986 ATGGAAGATGAAAGAGGAAGAGG - Intergenic
1149532678 17:57407971-57407993 CTAGAAGGTGGAGGAGGCAGAGG - Intronic
1149792575 17:59492215-59492237 CTGGCAGGTGAAACTGGAAGGGG + Intergenic
1150125596 17:62632616-62632638 CTGGAAGGTGGGAAAGAAGAGGG - Intronic
1150221799 17:63499848-63499870 CTGGAAGGTAGCAGAGGAAGAGG + Intronic
1150718576 17:67594424-67594446 CTGGGTGGTGAAAAAGGAATAGG - Intronic
1150911377 17:69390921-69390943 CTAGAAGGAGGAAGAGGCAGAGG - Intergenic
1151330223 17:73402111-73402133 CTGGGAGCCGGAACAGGAAGAGG - Exonic
1151434716 17:74087883-74087905 CTAGAAGCTGGAAAAAGCAGGGG - Intergenic
1151516555 17:74599926-74599948 CTGGAAGGATGAGAAGGAACAGG - Intergenic
1151523992 17:74651187-74651209 GGGAAAGGTGGAATAGGAAGCGG + Intergenic
1151647822 17:75445617-75445639 CTGAACGGTGGAAATGGCAGAGG - Intronic
1151805630 17:76403186-76403208 CAGGAAGGAGAAGAAGGAAGAGG + Intronic
1153113681 18:1627025-1627047 CTGGAAAGTGGTATAAGAAGGGG + Intergenic
1153264797 18:3259683-3259705 TTGGAAGATGGAAGAGCAAGTGG - Intergenic
1153917110 18:9755815-9755837 CTGGACAATGGAAGAGGAAGTGG + Intronic
1154174585 18:12076926-12076948 CAGGAATATGGAGAAGGAAGGGG + Intergenic
1154199490 18:12289372-12289394 CTGGAAGGAGGGGAGGGAAGTGG + Intergenic
1155068488 18:22290119-22290141 GTGGAAGGTGGAAAGGGAGGAGG + Intergenic
1155495248 18:26436292-26436314 TGGGAAAGTGGAGAAGGAAGTGG - Intergenic
1155898567 18:31360023-31360045 CTGGAAGGATGAGAAGGAAATGG - Intergenic
1156034742 18:32753769-32753791 CTGGGAGGTGGAGAAGGAGGGGG - Intronic
1156045566 18:32873567-32873589 CCAGAAAGTGGAAGAGGAAGAGG - Intergenic
1156214022 18:34977696-34977718 CGGGTGGGTGCAAAAGGAAGCGG + Intronic
1156218033 18:35021404-35021426 CTGGAAGATGGAAAGGGCATAGG + Intronic
1157910176 18:51610075-51610097 CTGGAAGCTTGAAAGGCAAGTGG - Intergenic
1158362030 18:56685549-56685571 CTGGAAGGTGGCAAGGTATGTGG + Intronic
1158427258 18:57351836-57351858 CTGGAAGACGGAAAGGGGAGAGG + Exonic
1158587076 18:58749452-58749474 CTGGAGGGTGGAAATGGCAGGGG - Exonic
1159067784 18:63588997-63589019 ATGGTATTTGGAAAAGGAAGAGG - Intronic
1159146853 18:64465757-64465779 GTGGAATGTGGAAAAAAAAGAGG + Intergenic
1159491055 18:69135065-69135087 CTTGAAAGTGTAAAAGGATGAGG - Intergenic
1159987230 18:74857941-74857963 CAGGAAGGTGGGGAAGGAAGGGG - Intronic
1160121621 18:76135382-76135404 ATGGAAGGTGAAAAGGGAACAGG + Intergenic
1160573233 18:79832508-79832530 AGAGAAGGTTGAAAAGGAAGAGG - Intergenic
1160649776 19:217466-217488 CTAGAAGCTGGAAAAGGCAAAGG - Intergenic
1160965309 19:1744723-1744745 CTGGAGGGGGGAAGAGGAGGAGG - Intergenic
1161243560 19:3236256-3236278 TAGGAAGGTGGAGGAGGAAGTGG + Intronic
1161293402 19:3507379-3507401 CTGGACGGTGGAAGAGGGGGAGG - Intronic
1161303897 19:3556632-3556654 CTGGATGGTGGGACAGGCAGGGG + Intronic
1161865966 19:6832448-6832470 CCAGAAGGAGGAGAAGGAAGAGG - Intronic
1162079652 19:8210289-8210311 CTGGAAGGTGTGATAGGAAGTGG + Intronic
1162246464 19:9405719-9405741 GTGGAAGGGAGGAAAGGAAGGGG + Intergenic
1162977902 19:14219062-14219084 CTGGCAAGTGGAAAAGAAATGGG + Intergenic
1163019053 19:14473050-14473072 CCGGAAAGAGGAAAAGCAAGGGG + Intronic
1163105163 19:15119132-15119154 GGGGAAGGAGGGAAAGGAAGAGG + Intronic
1164607640 19:29611451-29611473 CTGGAAGGTGGGCAAGCAAGTGG - Intronic
1164718718 19:30415354-30415376 AAGGAAGAAGGAAAAGGAAGAGG - Intronic
1165347477 19:35257909-35257931 CTGGAATGTGGGGATGGAAGGGG + Intronic
1165505856 19:36228782-36228804 CTGTATGGTGGAGAAAGAAGTGG + Exonic
1165730790 19:38143368-38143390 CTGCAAGGAGGAGGAGGAAGGGG - Intronic
1166329346 19:42069552-42069574 GAGGAAGGTGAAAACGGAAGGGG + Intronic
1166656484 19:44615724-44615746 CTGGAAGGAGGAAAGGGACGTGG + Intronic
1166739445 19:45105116-45105138 ATGGCAGGTGGAGAAGGAAGTGG + Intronic
1166750550 19:45162289-45162311 CAGCCAGGTGGAATAGGAAGGGG + Intronic
1166986593 19:46663697-46663719 CTGGAAGGTAGAATAGGGAGGGG + Intergenic
1166998588 19:46731761-46731783 CTGGAGGGAGGAACAGGAGGAGG - Intronic
1167240847 19:48342225-48342247 AGGGAAAGGGGAAAAGGAAGGGG + Intronic
1167244954 19:48367565-48367587 CTGGGAGGTGGAAAATAAATGGG - Intronic
1167408490 19:49330526-49330548 AAGGAAGGAGGAAAAGCAAGAGG + Intergenic
1167504433 19:49863643-49863665 CTGGAGTGAGGAAAAGGAGGGGG + Intronic
1167616419 19:50536801-50536823 CTGGAAGGGTGGGAAGGAAGGGG + Intronic
1167645483 19:50703121-50703143 CTGGAGGGAGGATGAGGAAGGGG - Intronic
1167695786 19:51015093-51015115 CTGGAAGGTAGGAATGGAGGTGG + Intronic
1167752171 19:51387787-51387809 CTGGGTGGTGGGTAAGGAAGGGG + Intronic
1202645268 1_KI270706v1_random:133339-133361 CTGGATGCTGGACAAGGAACTGG + Intergenic
925913603 2:8588738-8588760 TTGTAAGGTGGGAAAGGATGTGG - Intergenic
927127273 2:20023187-20023209 ATGGAAAGAAGAAAAGGAAGTGG - Intergenic
927246537 2:20961228-20961250 CTTGAAGGTGAAAAAGGGAAGGG - Intergenic
927608604 2:24513259-24513281 GTGGAAGGGGTAAAAGAAAGAGG - Intronic
927866823 2:26594096-26594118 CTGGAAGAAGGAAACGGTAGTGG - Intronic
927946491 2:27137934-27137956 CTGGGAGGGAGAAAAGGAAGGGG + Exonic
928118447 2:28564633-28564655 CTGGCAGGTAGCAAAGGAACTGG + Intronic
928125067 2:28609859-28609881 GTGGCAGTGGGAAAAGGAAGAGG - Intronic
928239495 2:29574287-29574309 CTGGAAGGTGGATGGAGAAGTGG - Intronic
928466692 2:31528879-31528901 ACTGAAGGTGGAAATGGAAGCGG + Intronic
929990204 2:46780455-46780477 ATGGAAGGTGTGAGAGGAAGAGG + Intergenic
930064083 2:47314188-47314210 CTGGAAGGTGGAGACTGTAGTGG + Intergenic
930140082 2:47942665-47942687 CTGGATGGTGTATAATGAAGAGG - Intergenic
930252352 2:49048870-49048892 TTGGAAGGTGGACAGGCAAGAGG + Intronic
930317936 2:49820305-49820327 TTGGAAGATGGAAAAGAAAAAGG - Intergenic
930638252 2:53829198-53829220 CTGGAAGTGGGAAAACGATGAGG + Intergenic
930731906 2:54735968-54735990 CAGGGAGGTGGAAAAAGAATGGG + Intronic
930733709 2:54753589-54753611 CTAGAAGGTAGAAAAAGCAGAGG + Intronic
931721564 2:65070852-65070874 CTGGAAGGTGGCAAAGTTAGGGG + Intronic
931728780 2:65134907-65134929 CAGGAGGGAGGAAAAGGAAAAGG - Intergenic
931942969 2:67273286-67273308 GAGGGAGGTGGAGAAGGAAGTGG - Intergenic
932140523 2:69273417-69273439 CTAGAAGGTGGATGAGGAAAAGG - Intergenic
932457354 2:71858073-71858095 CTGGGAGCTGGGACAGGAAGTGG + Intergenic
932766718 2:74475169-74475191 ATGGAACTGGGAAAAGGAAGGGG - Intronic
932819436 2:74887004-74887026 CTGGAAGATGGAGGAGGGAGAGG - Intronic
934862336 2:97774692-97774714 CTGGCAGGTGGGAAGGGAAGTGG + Intronic
935326573 2:101943049-101943071 CTGGAAGGTCGAAAAGGGCAGGG + Intergenic
935850487 2:107213652-107213674 TTTGAAGGTGGTAAAGGAAGTGG - Intergenic
936456949 2:112682576-112682598 CTGGGAAGGGGAAAGGGAAGAGG - Intergenic
936456992 2:112682800-112682822 TTGGGAAGGGGAAAAGGAAGAGG - Intergenic
937114543 2:119395522-119395544 AGAGAAGGAGGAAAAGGAAGAGG + Intergenic
937507950 2:122558262-122558284 ATGGAAGGTGGAGAAGAAAAGGG + Intergenic
937562156 2:123239358-123239380 CTAGAAGCTGGAAAAACAAGAGG + Intergenic
938704074 2:133905219-133905241 GTAGAAGGTGGAAAGGCAAGGGG + Intergenic
940424077 2:153511086-153511108 GTGGAAGGAGGAAGAGGATGTGG + Intergenic
941038214 2:160590562-160590584 GGGGAAGGGGGAAGAGGAAGGGG - Intergenic
941240625 2:163032122-163032144 CTAGAAGCTGGAAAAGGCAAGGG + Intergenic
941488584 2:166114053-166114075 CTGGAAGGGAGGTAAGGAAGTGG - Intronic
942176438 2:173339151-173339173 ACAGAAGCTGGAAAAGGAAGTGG + Intergenic
942502569 2:176607087-176607109 CTGGAAGAAGGAGAAGGAAGAGG + Intergenic
942539215 2:176997917-176997939 CAAGAGGGTGGAAAAGGGAGAGG + Intergenic
942592090 2:177557075-177557097 GTGGAAGGTCAAAGAGGAAGTGG - Intergenic
942868785 2:180709474-180709496 TGGGAAGAAGGAAAAGGAAGTGG + Intergenic
943321939 2:186455370-186455392 GTGGAAGGTGAATAAAGAAGAGG - Intergenic
944154957 2:196598402-196598424 GGGGAAGGGGGGAAAGGAAGGGG + Intergenic
944400556 2:199320785-199320807 CTTGAATGGGGAATAGGAAGAGG - Intronic
944493997 2:200288061-200288083 GTGGAGGGTGGAAGAGGTAGAGG - Intergenic
945514637 2:210748011-210748033 CTGGAGGGAGAAAAAGGGAGAGG - Intergenic
945786779 2:214249395-214249417 CTAGAAGAAGGAGAAGGAAGAGG + Intronic
945876105 2:215279816-215279838 AAGGGAGGTGGAAAGGGAAGGGG + Intergenic
945898962 2:215516761-215516783 AAGGAAGGAGGACAAGGAAGGGG + Intergenic
946660519 2:221994071-221994093 ATGGAAGCTGGAATAGGGAGTGG + Intergenic
946734810 2:222743658-222743680 CTGGAGCGAAGAAAAGGAAGTGG - Intergenic
947831005 2:233141698-233141720 CTGTTAGGTGGAAAAGCAAATGG + Intronic
948113924 2:235479723-235479745 CTGGGATGAGGAAGAGGAAGAGG - Intergenic
948328304 2:237144218-237144240 TTGTAATGGGGAAAAGGAAGAGG - Intergenic
948445947 2:238032988-238033010 CTGGAAGGGGCTAAGGGAAGTGG - Intronic
948660392 2:239503141-239503163 CGGGAAGGAGGAAAACGGAGAGG - Intergenic
948947646 2:241229182-241229204 GAGGGAGGTGGGAAAGGAAGAGG + Exonic
1168949158 20:1784700-1784722 CTGGAAGGCTGAAGGGGAAGTGG + Intergenic
1169135788 20:3196260-3196282 CTGGAAGTTAGAGAAAGAAGGGG - Intronic
1169177772 20:3533518-3533540 CAGGAAGGAGGAAAAGAAAACGG - Intronic
1169554212 20:6732209-6732231 CTGGCAGGGGGGAAAGGGAGAGG + Intergenic
1169563838 20:6830794-6830816 TTTGAATGTGGAAAATGAAGAGG - Intergenic
1169812204 20:9619701-9619723 CTGGAAGGAAAAATAGGAAGAGG - Intronic
1169812748 20:9625169-9625191 ATTGATGGTGGAGAAGGAAGTGG - Intronic
1169914715 20:10673776-10673798 CCGGGAGGTGGAAGAGGAGGGGG - Exonic
1169975385 20:11320496-11320518 CTGGAAAGTGGATATGAAAGAGG + Intergenic
1170050340 20:12136336-12136358 CTGGAGGCTGGGAAAGGAAGTGG - Intergenic
1170192263 20:13656016-13656038 CTAGAAGTTGGAAAAGAAAATGG + Intergenic
1170601329 20:17843599-17843621 CTGGGAGGTGGAAGATGACGTGG + Intergenic
1170795351 20:19542074-19542096 CTGGAAGGTGGCATTGAAAGGGG + Intronic
1170966672 20:21078921-21078943 ATGGAAAGAGGAAAAGAAAGAGG - Intergenic
1171393073 20:24813926-24813948 CAGGAAGGTGAAAATGGAATGGG + Intergenic
1171726167 20:28623051-28623073 CTAAAAGTTGGAAAAGGAAATGG - Intergenic
1171895230 20:30752259-30752281 CTGGATGCTGGACAAGGAACTGG + Intergenic
1171949076 20:31405133-31405155 CAGAAAGGTGTGAAAGGAAGAGG + Intronic
1172063737 20:32205367-32205389 CTGGAGGGAGGTAAAGTAAGGGG - Intronic
1172190838 20:33061027-33061049 CTGGAAGGTGGACACAGAACGGG - Intronic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1172876591 20:38168130-38168152 GTGGAATGTGGGAGAGGAAGTGG - Intergenic
1173346263 20:42203146-42203168 CTACAAGGTGGAAATGGAGGGGG + Intronic
1173905465 20:46625193-46625215 CTGGAAGCTGGGAGAGAAAGAGG - Intronic
1174109135 20:48185805-48185827 CAGGAAGGGTGCAAAGGAAGAGG - Intergenic
1174339576 20:49887436-49887458 CAGGATGCTGGAGAAGGAAGCGG - Intronic
1174886967 20:54346468-54346490 CTGGTAGGAGAAAGAGGAAGTGG + Intergenic
1175093771 20:56525546-56525568 CTTTCAGGTAGAAAAGGAAGGGG + Intronic
1175320178 20:58080000-58080022 CTAGAAGCTGGAAAAGGCAAAGG - Intergenic
1175432067 20:58912299-58912321 CTGGAAACTAGAATAGGAAGTGG - Intergenic
1175638598 20:60606804-60606826 CCTGAACGTGGAAAAGGAGGTGG - Intergenic
1175647457 20:60686965-60686987 CTGGAGGAGGGAAAAGGAACAGG + Intergenic
1175677503 20:60959251-60959273 CTGTTAGGTGGAGTAGGAAGGGG - Intergenic
1175988751 20:62777183-62777205 CTGGAAGGAGGAAATGGGACAGG + Intergenic
1176242733 20:64082611-64082633 TGGGAGGGAGGAAAAGGAAGCGG + Intronic
1176606618 21:8839403-8839425 CTGGATGCTGGACAAGGAACTGG - Intergenic
1176898351 21:14410324-14410346 TTGGAAGGTTGCAAAGAAAGGGG - Intergenic
1177286390 21:19057022-19057044 CTGGGAGGTGGAAGAGGATCAGG - Intergenic
1178151001 21:29793529-29793551 CAGGAAGGGGGAGAAGGAGGAGG - Intronic
1178398422 21:32262884-32262906 CTCGAAGGTAGAGAAGGGAGGGG - Intergenic
1178931111 21:36820121-36820143 CGGGAATGAGGCAAAGGAAGGGG + Intronic
1179038598 21:37782202-37782224 CTAGAAGCTGGAAAAGGCAAGGG + Intronic
1179165759 21:38933944-38933966 CGGAAAGGTGGCAAAAGAAGTGG - Intergenic
1179708498 21:43195896-43195918 GTGGGAGGTGGGGAAGGAAGGGG + Intergenic
1180114044 21:45684627-45684649 GTGGAAGGTGAAAGAGGAACAGG - Intronic
1180211385 21:46297262-46297284 ATGGGAGGTGGGAAGGGAAGGGG - Intronic
1180356691 22:11849105-11849127 CTGGATGCTGGACAAGGAACTGG - Intergenic
1180381570 22:12143226-12143248 CTGGATGCTGGACAAGGAACTGG + Intergenic
1180559547 22:16603689-16603711 CTGAAATTTGGAGAAGGAAGTGG + Intergenic
1180982253 22:19884334-19884356 CTGGCACGCGGGAAAGGAAGAGG + Intronic
1181619154 22:24076335-24076357 GTGGGAGGTGGAATGGGAAGGGG + Intronic
1182000995 22:26919671-26919693 CTAGAAGCTGGAAAAGGCAAGGG + Intergenic
1182497320 22:30718743-30718765 CTGGCAGGGGGAAAAAAAAGGGG - Intronic
1182619668 22:31611966-31611988 CAGGAAGGTGGTAGAGGAGGTGG - Intronic
1182835424 22:33337802-33337824 CTGGCAGGGAGATAAGGAAGTGG + Intronic
1182871821 22:33654332-33654354 CTGGCTTGAGGAAAAGGAAGGGG - Intronic
1182908307 22:33957669-33957691 GTGGAAGGTGGAACAGGAGCAGG - Intergenic
1183129486 22:35820349-35820371 CTGGAAGGTGAAACAGTACGTGG - Intronic
1183529824 22:38347331-38347353 GTGGGAGGGGGAAACGGAAGAGG + Intronic
1184946225 22:47805894-47805916 CTGGAAGGTGGGAAAGAAACTGG + Intergenic
1185063121 22:48617312-48617334 CTGGAATCTGGAAAAGCAAAGGG + Intronic
949648427 3:6126325-6126347 CCGGAAAGGGGAAAGGGAAGGGG + Intergenic
949854018 3:8443530-8443552 TGGGAAGGTGGAGCAGGAAGAGG + Intergenic
949920947 3:9000096-9000118 CTAGAAGATGGTAAAGGGAGAGG - Intronic
950326609 3:12116354-12116376 CTGGAAGAAGGAAAAGGAAAAGG + Intronic
950539990 3:13606436-13606458 CTGGAAGGAGTCAAAGGTAGGGG - Intronic
950713326 3:14829366-14829388 CTGGCAGGTGGAGAACGGAGGGG + Intronic
950879110 3:16307666-16307688 ATGGTAGCTGGAAAGGGAAGTGG + Intronic
950924221 3:16724069-16724091 TTGGGAGGTAGAAAAGGAAAAGG - Intergenic
951091432 3:18577864-18577886 CAGGAAACTGGAAAAGGAATGGG - Intergenic
951097577 3:18649798-18649820 TTGAAAGGTTGAAAAGGATGGGG - Intergenic
951184855 3:19701855-19701877 CTGGCAGGAGGAAAAGGAGAGGG + Intergenic
951317967 3:21209458-21209480 CTGGAAGGTGGAAGGGGACCTGG - Intergenic
951497301 3:23344497-23344519 CTGGAAAGTGGAAAAAGGAGTGG - Intronic
951785600 3:26415298-26415320 AGGGAGGGTGAAAAAGGAAGAGG + Intergenic
951792856 3:26505437-26505459 CAGGAAGGAGGAAAAGGAAAGGG - Intergenic
951912123 3:27761764-27761786 CTGGAAGGTGGGAGTGTAAGGGG - Intergenic
952282244 3:31935054-31935076 CAGGAAGGTGGGAAGGGAAATGG + Intronic
952404869 3:32996943-32996965 TTGGAATGTGGAAATGGAAAAGG - Exonic
952512004 3:34067516-34067538 CTAGAGGGAGAAAAAGGAAGAGG - Intergenic
952910748 3:38182649-38182671 CTGAAAGGTAGAAAAGAGAGAGG - Intronic
953039495 3:39242704-39242726 GTGGGAGGAGGAAAAGGAACAGG + Intergenic
953354692 3:42245673-42245695 ATGAAAGGTGTAAAGGGAAGGGG + Intergenic
954436367 3:50498450-50498472 CTGGAATCTGGAGAAGGAAATGG + Intronic
954558351 3:51535903-51535925 CTGGGAGGAGGGAATGGAAGAGG + Intergenic
954570378 3:51636077-51636099 CTAGAAAGTGGTAAAGGAAATGG - Intronic
954630089 3:52043405-52043427 CTGGAAGCAGGAACAGCAAGAGG + Intergenic
955226332 3:57063405-57063427 CTGAAAGGAGGTAAAGGCAGAGG + Intronic
955242739 3:57193690-57193712 CTGGAAGGCTTAAGAGGAAGAGG + Intergenic
955475111 3:59328503-59328525 CTGGGAGGTAGACAAGGCAGGGG + Intergenic
955760096 3:62270982-62271004 CTGGACAGTGGAGAAGGAATGGG + Intronic
955879676 3:63530145-63530167 CTGGAAGGAGATAAAGGAAGGGG + Intronic
955992498 3:64642906-64642928 AGGGAAGGTGGAAAAAGAAGAGG + Intronic
956011302 3:64834450-64834472 CTGGCAGGTGCAAATGGAAGTGG - Intergenic
956086406 3:65615644-65615666 CTGGAAGGTGGTGAGGGAAGCGG - Intronic
956643936 3:71438386-71438408 CTTAAAGGTGGATAAAGAAGTGG - Intronic
957284883 3:78205138-78205160 GAGGAATTTGGAAAAGGAAGAGG + Intergenic
957447388 3:80331654-80331676 GTGGAGGGTGGAAGAGGGAGAGG - Intergenic
957679388 3:83413093-83413115 CTGGCAGGTTGAAAAGCAATGGG - Intergenic
958427978 3:94001529-94001551 AAGGAAGGTGAAAAAGGGAGGGG - Intronic
958474537 3:94564195-94564217 CTGAAAGGAAGAAAAGGAAGAGG + Intergenic
958732918 3:97977802-97977824 CTGGAAGGTGACAAAGAGAGTGG + Intergenic
959099825 3:101997521-101997543 TTGGAAGGTGGAAAAAGCAAGGG + Intergenic
960813985 3:121654694-121654716 CTAAAAGCAGGAAAAGGAAGTGG - Intronic
960945882 3:122966234-122966256 CTGGAGGCTGAAAAAGGAAGTGG - Intronic
961161527 3:124730665-124730687 CGGGAAGGAGGACAAGGAAATGG + Intronic
961184989 3:124906938-124906960 AAGGAAGATGGTAAAGGAAGAGG - Intronic
961636230 3:128334876-128334898 CTGGGAGGTGGAATGGGGAGAGG - Intronic
961642776 3:128375300-128375322 CTGGAAGATGGCACATGAAGAGG - Intronic
962527078 3:136246538-136246560 TAGGAAGGAGGAAATGGAAGAGG - Intergenic
962718813 3:138152986-138153008 CTGGAAGGAGGTAAGGGAATAGG + Intergenic
963185404 3:142410348-142410370 GTGGAAGGTGGAAAAAAAACTGG + Intronic
964222159 3:154359354-154359376 TTGGAAGGTGGAAAAAGCAATGG + Intronic
964236442 3:154535942-154535964 ATGGAAGGTGGAGGAAGAAGAGG - Intergenic
964742700 3:159984272-159984294 TTGGAATTTAGAAAAGGAAGAGG - Intergenic
965292407 3:166900315-166900337 CAGGAAGGTGGAGAAGGGATAGG - Intergenic
965566934 3:170129480-170129502 TTGGAAGGTGGTGAATGAAGAGG + Exonic
966731447 3:183154713-183154735 TTTGAAGGTGGAGAATGAAGAGG - Intronic
966939655 3:184737581-184737603 CTGCAAGGTCGCAGAGGAAGAGG + Intergenic
967375612 3:188797137-188797159 CAAGAAGGAGGAAGAGGAAGAGG - Intronic
968368075 3:198202663-198202685 CTAGAAGCTGGAAAAGGCAAAGG + Intergenic
969160956 4:5258587-5258609 ATGTAGGGTGGGAAAGGAAGAGG - Intronic
969283352 4:6186307-6186329 ATGGAAGTTGGAAAAGGAGGTGG + Intronic
969495339 4:7523116-7523138 CTGGAAGGAAGAAAGGGAGGAGG - Intronic
969506451 4:7591169-7591191 GTGGGAGGAGGAAGAGGAAGTGG - Intronic
969864936 4:10069191-10069213 AGGGAAGGTGGAGGAGGAAGCGG - Intergenic
970245840 4:14061934-14061956 ATAGAGAGTGGAAAAGGAAGAGG - Intergenic
970650534 4:18172528-18172550 CTGGCAGGAGGCAAATGAAGAGG + Intergenic
971025235 4:22582837-22582859 CTGAAAGGAGGAGGAGGAAGAGG - Intergenic
971101929 4:23476438-23476460 TTGGAAGGTGGAAAAGGAAATGG + Intergenic
971170267 4:24226446-24226468 AGGGAAGGTGGAAAACGAGGTGG + Intergenic
971804387 4:31336308-31336330 CTGAAAGGTGGAAAGGGAACAGG + Intergenic
972358932 4:38308910-38308932 TTTGAAGGGGGAAAAGGGAGGGG - Intergenic
972523115 4:39880954-39880976 CAAGAAGCTGGAAAAGGTAGTGG - Intronic
973371494 4:49251754-49251776 CTGGATGCTGGACAAGGAACTGG + Intergenic
973389514 4:49543557-49543579 CTGGATGCTGGACAAGGAACTGG - Intergenic
973543173 4:51954352-51954374 GTGGAAGGTGGAGAGGAAAGAGG - Intergenic
973730080 4:53814878-53814900 CAGGAAGGAGGAAAAGGAATGGG - Intronic
973835324 4:54803649-54803671 CTGGAAAATGGAAAATGAAGAGG - Intergenic
973907961 4:55549245-55549267 CTGGAAGTTGGAAAAGCTATTGG - Intergenic
974198546 4:58609696-58609718 TTGGAAGGTGGAATAGCAAAAGG + Intergenic
974688682 4:65267065-65267087 CAAGAGGGTGGAAATGGAAGTGG + Intergenic
975052879 4:69887892-69887914 GTGGAAGGTGGAAGGGCAAGTGG + Intergenic
975330131 4:73103341-73103363 CTGGAGGGTGGAACAGGAGGAGG + Intronic
975391143 4:73818746-73818768 CTAGAAGGTGGGAAGGGTAGTGG + Intergenic
976152641 4:82107528-82107550 CAGGAAGGAGGAAAGAGAAGGGG + Intergenic
976286676 4:83377170-83377192 GTGGAAGCTGCAAAAGGGAGGGG - Intergenic
976673063 4:87674949-87674971 GTGGAAGGTGGAAGACAAAGAGG + Intergenic
976723564 4:88194089-88194111 ATGTCAGGTGAAAAAGGAAGTGG - Intronic
977566295 4:98583978-98584000 CTGGAAGGTGGGAGTGGGAGAGG - Intronic
978755910 4:112302641-112302663 CTGAAAGAGGAAAAAGGAAGGGG - Intronic
978829295 4:113064517-113064539 CTGGCAGGTGGGGAGGGAAGGGG - Intronic
979312687 4:119222451-119222473 CTAGAGGCTGGGAAAGGAAGTGG - Intronic
979688465 4:123537567-123537589 CAGGAAGATGAAAAAGGGAGTGG + Intergenic
980237328 4:130125820-130125842 CTGGAAGGTGGGAATAGAAGAGG - Intergenic
980878404 4:138685469-138685491 AGAGAAGGTGGAAAATGAAGAGG + Intergenic
981621371 4:146703389-146703411 CTGGAAAGTGCAAAATTAAGGGG + Intergenic
981884049 4:149651293-149651315 CTGGAAGGTGGAAATAGATGAGG + Intergenic
983200476 4:164855396-164855418 CTGGAACATAGCAAAGGAAGAGG + Intergenic
983380628 4:166987819-166987841 GTGGTAGGTGGAAAAGCAAATGG + Intronic
983809826 4:172047468-172047490 TTCTCAGGTGGAAAAGGAAGAGG - Intronic
984159993 4:176240556-176240578 CTGGAAGGTTGAAATCGAAGAGG + Intronic
984289637 4:177779590-177779612 CTGGAAGGAGCAAGAGGAAACGG - Intronic
984350842 4:178590987-178591009 CTGGAAGGAGGAAGAGGATAAGG - Intergenic
985409699 4:189670279-189670301 ATGTGAGGTGGAGAAGGAAGGGG - Intergenic
985434364 4:189914708-189914730 CTACAAGTTGGAAAAGGAAATGG + Intergenic
985647808 5:1093330-1093352 CCGGACGGTGGAGAGGGAAGAGG + Intronic
985671117 5:1207156-1207178 CTCGAAGGTGGAGAAGGACGAGG - Intronic
986082298 5:4407756-4407778 CTAGAAGCTGGAAAGGGAACAGG - Intergenic
986082912 5:4412794-4412816 CTGGAAGATGGAAGAGGCACTGG + Intergenic
986237130 5:5921777-5921799 CAGGTAGGTGGAAAAAGAACAGG + Intergenic
986457997 5:7939942-7939964 CTGGAAGGTGGTGAAGGAAATGG + Intergenic
986843726 5:11728392-11728414 CTGGGAGGTGGAGGTGGAAGAGG + Intronic
987293890 5:16533415-16533437 CTGGGAGATGGAGAAGGATGGGG - Intronic
987328779 5:16836429-16836451 CTGGAATGTAGAAAATGAGGTGG - Intronic
987961262 5:24812491-24812513 ATGTAAGGTGGAAAAGTAAAAGG + Intergenic
988662596 5:33288925-33288947 CTGGATGCTGGAACAGAAAGAGG - Intergenic
989609128 5:43274554-43274576 CTGAAAAGTAGAAAAGAAAGGGG + Intronic
989706554 5:44339622-44339644 TTGCAAAGTGGAAAAAGAAGTGG - Intronic
989811371 5:45680725-45680747 AAGGAAGGGGAAAAAGGAAGAGG - Intronic
990099993 5:52170887-52170909 GAGGAAGGAGGAAAAGGAGGAGG - Intergenic
991231685 5:64340922-64340944 AGGGAAGGAGGTAAAGGAAGAGG - Intronic
991565354 5:67998906-67998928 ATGGAAAGTGGAAAAGGCAAGGG - Intergenic
991633767 5:68682511-68682533 CTGGTGGGTGGAAAAGGGTGAGG - Intergenic
992865305 5:80951807-80951829 CCAGAAGGGGAAAAAGGAAGGGG + Intergenic
992974971 5:82106482-82106504 CAGGCAAGTGGAAAAGGCAGTGG - Intronic
993164587 5:84335942-84335964 GAGGAAGGTGGAAAAGCAAAAGG + Intronic
993350579 5:86844956-86844978 AGGGAAGGTGGGAGAGGAAGGGG + Intergenic
993464033 5:88222508-88222530 CTGGAAGGAGGTCAGGGAAGTGG + Intronic
994250838 5:97535174-97535196 CAGAAAGGTGGGAAAGGCAGAGG - Intergenic
994702910 5:103159926-103159948 CCAGAGGCTGGAAAAGGAAGGGG - Intronic
995478545 5:112572326-112572348 GTGAAAAGTGGAAAAGGAATTGG - Intergenic
995487375 5:112652951-112652973 CTGGAAAGTGAAAAGGGATGTGG + Intergenic
995658186 5:114450440-114450462 CTGGAAGTTAGAAAAGGAACAGG + Intronic
995948073 5:117674457-117674479 CTGTAAGGTGCAAAAAGACGAGG - Intergenic
996016385 5:118538571-118538593 CTAGAAGCTGGAAAAGGAAAGGG - Intergenic
996466873 5:123813109-123813131 CTTGAAGAAGGAGAAGGAAGAGG + Intergenic
996587581 5:125107740-125107762 CTAGAAGGAGGAGAAGGAGGAGG - Intergenic
998057878 5:139094790-139094812 TTGGATGCTGGAACAGGAAGAGG - Intronic
998107244 5:139476380-139476402 GCGGCAGGAGGAAAAGGAAGAGG - Exonic
998383518 5:141742654-141742676 TTGGAAAGTGGAAAAGAATGTGG + Intergenic
998408004 5:141885020-141885042 AAGGAAGGAGGTAAAGGAAGGGG - Intergenic
998532843 5:142901468-142901490 GAGGAAGGCAGAAAAGGAAGTGG - Intronic
998550684 5:143075021-143075043 CTGGGAGGTGGGAAGAGAAGTGG + Intronic
999233465 5:150076787-150076809 CAGAAGGGTGGGAAAGGAAGGGG - Intronic
999475910 5:151898730-151898752 GTGGGAGGTGAAAGAGGAAGAGG + Intronic
999520937 5:152350070-152350092 CTGGAATGTTAAAAAGGGAGAGG - Intergenic
1000017418 5:157290321-157290343 CTAGAAGCTGGAAAAGGCAAGGG - Intronic
1000210686 5:159104235-159104257 CTGGCAGGTGGCGAGGGAAGGGG - Intergenic
1000337843 5:160254640-160254662 CTGGCAGGTGGAAGGGGAACTGG + Intronic
1000380940 5:160628789-160628811 CTGGCAGATGGAAAATGAAATGG - Intronic
1000430960 5:161152100-161152122 CTGGAATGTGGAAAGGGAGGTGG - Intergenic
1000822231 5:165998816-165998838 CTCAGTGGTGGAAAAGGAAGAGG + Intergenic
1001249301 5:170134150-170134172 TGGGAAGGTGTATAAGGAAGTGG + Intergenic
1001617051 5:173051115-173051137 CTGGAAAGTGGAGAAGGTGGGGG + Intergenic
1001682494 5:173569306-173569328 CTGGATGCTGGAAGAGAAAGAGG + Intergenic
1001948499 5:175799433-175799455 CTGGAAGGTGGAAAAGGAAGGGG + Intronic
1002071607 5:176681710-176681732 CTGGGAGGCGGGACAGGAAGAGG - Intergenic
1002083095 5:176749016-176749038 CTGGAAGAGAAAAAAGGAAGGGG - Intergenic
1002495768 5:179610458-179610480 ATAGAAGGTGGAGAAGGATGAGG - Intergenic
1002633749 5:180597005-180597027 AGGGAAGGGGCAAAAGGAAGTGG - Intergenic
1002702096 5:181131388-181131410 CTGGAAGCTGGATCAGGAAGAGG - Intergenic
1002727294 5:181307892-181307914 CTAGAAGCTGGAAAAGGCAAAGG + Intergenic
1003191268 6:3877227-3877249 CTGGAAGGTAGATTAAGAAGAGG + Intergenic
1003426201 6:5999837-5999859 TGGGAAGGAGGAAGAGGAAGTGG - Intronic
1004182971 6:13396763-13396785 CTAGAAGCTGGAAAAGGCAAGGG + Intronic
1004249895 6:14015213-14015235 GTGGAAGGTGGAAGGGTAAGAGG + Intergenic
1004367982 6:15028053-15028075 GGGGAAGGAGGAAAAGAAAGGGG + Intergenic
1004381257 6:15134493-15134515 CTGGGAGGTGACAAAGGTAGTGG + Intergenic
1004683230 6:17917172-17917194 CGGGAAGGAGGAAAACGGAGGGG + Intronic
1004973565 6:20938966-20938988 GGGGAAGGAGGAAAAGGAGGAGG - Intronic
1005068710 6:21844402-21844424 TTGGGATGTGGAAAAAGAAGAGG + Intergenic
1005146792 6:22700937-22700959 CTAGAAGGTGGAAAAAGCAAGGG - Intergenic
1005161068 6:22864374-22864396 ATGGCAGGTGGCACAGGAAGTGG + Intergenic
1005217703 6:23551080-23551102 CTGGAATGGGGTAATGGAAGGGG + Intergenic
1005495329 6:26383307-26383329 CTAGAAGGTAGGAAAGGGAGAGG + Intronic
1005758360 6:28945783-28945805 CTGGAAGAACAAAAAGGAAGAGG - Intergenic
1005891946 6:30147282-30147304 CTGGGAGGTGTAAGAGGGAGGGG + Intronic
1006337188 6:33426929-33426951 CTGGAAGGAGCCAAAGGATGGGG - Intronic
1006710447 6:36064485-36064507 CTTGAAGAGGGAAATGGAAGTGG + Intronic
1006770539 6:36549001-36549023 TTGGAAGGAGGAAAGAGAAGAGG - Intergenic
1006822308 6:36907049-36907071 ATGGAAGGAGGAAAAGAAGGAGG - Intronic
1006924383 6:37646452-37646474 CTGGGAGGTGGGCACGGAAGGGG - Intronic
1007301637 6:40872137-40872159 CTGGAGTGGTGAAAAGGAAGGGG - Intergenic
1007415868 6:41690918-41690940 CTGGGAGGGGGAAAAGGCAAGGG + Intronic
1007474073 6:42107406-42107428 GTGGAAGGTGGAGATGGCAGTGG + Exonic
1007631743 6:43276695-43276717 CTGAGAGCTGGGAAAGGAAGGGG - Intronic
1007752542 6:44079258-44079280 CTGTAAGGGAGAAAAGGAGGAGG - Intergenic
1007782729 6:44263671-44263693 ATGGAAGTGGGAAGAGGAAGTGG - Intronic
1007796969 6:44356982-44357004 CTGGAAGCTGTGAAAGGAATGGG - Intronic
1008088040 6:47264779-47264801 CTCAGAGGTGGAAAAGGCAGTGG + Intronic
1008929417 6:56922667-56922689 CTGGAAGGAGGATATGGAAGAGG - Intronic
1009419049 6:63444904-63444926 CTGGAAGGAGGGAAAGGACAAGG + Intergenic
1009541557 6:64966587-64966609 CTAGAAGCTAGAAAAGGAAATGG - Intronic
1009562691 6:65269717-65269739 CTGAAACTTGGAAGAGGAAGAGG - Intronic
1010630022 6:78188451-78188473 ATGGCAGGAGCAAAAGGAAGAGG + Intergenic
1010771342 6:79835028-79835050 GTGGAGGGTGGAGGAGGAAGAGG + Intergenic
1010941564 6:81924817-81924839 GTGGAAGGAGAAGAAGGAAGAGG + Intergenic
1011351725 6:86431561-86431583 CTGCAATGTGGAAAACAAAGGGG + Intergenic
1011903845 6:92335552-92335574 TTGACAGATGGAAAAGGAAGAGG - Intergenic
1012225649 6:96700437-96700459 CTAGAAGCTGGAAAAGGGAAGGG - Intergenic
1012402082 6:98849030-98849052 CAGGAAGCAGGAAAAGGCAGAGG + Intergenic
1012825028 6:104137161-104137183 GTGGAAGGTGAAACAGGGAGAGG - Intergenic
1013962371 6:115915740-115915762 CAGAAAGGTGGAGAAGGTAGAGG + Intergenic
1014230788 6:118899559-118899581 CTGGAAGCTGGAAATAGAAATGG + Intronic
1014398236 6:120953285-120953307 CTGGAAGGAGGAAACGGAGTGGG + Intergenic
1014805857 6:125828548-125828570 TTTGAAGATGGAAGAGGAAGAGG + Intronic
1015061867 6:128976006-128976028 CTGCAATGTGGAAAATGAATTGG + Intronic
1015242734 6:131043940-131043962 CTGAATGGTGGGAAAGGAACGGG + Intronic
1015859890 6:137664740-137664762 CTGGAAGGTGTAGAAGTTAGAGG + Intergenic
1016199642 6:141393097-141393119 ATAGAAGGAAGAAAAGGAAGAGG + Intergenic
1016312750 6:142751899-142751921 GTGGAAGGGGGAAAAGGAGATGG - Exonic
1016381253 6:143483687-143483709 CTGGTTTGTGGAAAAGGAATTGG + Intronic
1016710349 6:147164333-147164355 CGGGAAGGTCAAAAAGGAAGTGG + Intergenic
1016862615 6:148736040-148736062 CTGGAATGTGGACATGGAAGGGG - Intergenic
1016934536 6:149439933-149439955 CTAGATGGGGGAAAAGCAAGGGG - Intergenic
1016997884 6:149973825-149973847 GTGGACAGTGGAAAAGGAGGTGG - Intergenic
1017000380 6:149992397-149992419 GTGGACAGTGGAAAAGGAGGAGG + Intergenic
1017010621 6:150060891-150060913 GTGGACGGTGGAAAAGGAGGGGG + Intergenic
1017547084 6:155464190-155464212 GTGGAAGGTGGAAGAGGATGAGG - Intergenic
1018116402 6:160590152-160590174 CTGGAAGATGGGGCAGGAAGTGG + Intronic
1018425394 6:163675535-163675557 CTGGAAAATGGAAAAGCAAGTGG + Intergenic
1018443244 6:163832819-163832841 CTAGAAGCTGGAAAAGGTAAGGG - Intergenic
1018469825 6:164085464-164085486 CTGGAAGGAGAGAAAGAAAGAGG + Intergenic
1018614763 6:165676543-165676565 CTGGAAGGTGGTGAGGGAAGGGG + Intronic
1018733158 6:166668527-166668549 CTGGAAGGCTGGAAAGGCAGAGG + Intronic
1018849771 6:167578522-167578544 CTGGTAGGTGGACAGGGCAGAGG + Intergenic
1019896528 7:3987736-3987758 CTGGAAGGTGAGTCAGGAAGAGG - Intronic
1019972344 7:4551090-4551112 CTGAAAGGTGGAGAAGGTGGAGG + Intergenic
1020036169 7:4964422-4964444 GAGAAAGGTGGAAAAGGGAGAGG + Intergenic
1020417401 7:7961643-7961665 CTAAAAGCTGGAAAAGGAAGAGG + Intronic
1020451703 7:8326908-8326930 TTGGAAGAAGGAAGAGGAAGTGG + Intergenic
1020923409 7:14294072-14294094 CTAGAAGCTGGAAAAGGCAAAGG - Intronic
1020931767 7:14405973-14405995 CTTGAAGGAGAAAAAGGAGGAGG + Intronic
1021107198 7:16651576-16651598 CTGGCTGGAGGAAAAGGATGCGG + Intronic
1021126508 7:16856337-16856359 TGGGAAGGAGGACAAGGAAGAGG + Intergenic
1021211987 7:17864811-17864833 AGGGAAGGAGGAAGAGGAAGAGG + Intronic
1021402229 7:20222560-20222582 CTAGAAGTTGGAAAAGGCAAGGG - Intergenic
1021406762 7:20276949-20276971 CTGAAATGTGGAAAAGAAACAGG - Intergenic
1021462258 7:20901616-20901638 CTGGAAAGTGGTAAAAGAATGGG + Intergenic
1021874087 7:25032359-25032381 CAGGATGGAGGAAGAGGAAGGGG - Intergenic
1022027673 7:26464064-26464086 CTGGAAGGAGGTCAGGGAAGAGG - Intergenic
1022495899 7:30853041-30853063 CAGGGAGGTGGATAAGGCAGGGG - Intronic
1022596881 7:31721156-31721178 ATTGAAAGGGGAAAAGGAAGAGG + Intergenic
1022601784 7:31767776-31767798 CTGCAACCTGGAAGAGGAAGAGG - Intronic
1023398489 7:39773679-39773701 CTAGAAGCTGGAAAAGGCAAAGG + Intergenic
1023421035 7:39979931-39979953 GTGGAAGCTGGAAAAGGCAAGGG + Intronic
1023757253 7:43431419-43431441 ATGGAATGTGGGAGAGGAAGAGG - Intronic
1024377945 7:48660175-48660197 TTGGAAAGTGAAAAAGAAAGAGG - Intergenic
1024392840 7:48835173-48835195 ATGGAAGCTGGAAAAGAAAATGG + Intergenic
1024503580 7:50140943-50140965 CTGGAGGCTGGGCAAGGAAGAGG - Intronic
1024505242 7:50157039-50157061 CTGGAAGGGGGACAAGAGAGAGG + Intronic
1024570381 7:50718149-50718171 CAGGAAGGAAGAAAGGGAAGGGG + Intronic
1024669736 7:51583619-51583641 GCAGAAGGTGGAAGAGGAAGAGG + Intergenic
1024919657 7:54544454-54544476 CAGGAAAGAGGCAAAGGAAGGGG + Intronic
1025134164 7:56396811-56396833 CTAGAAGCTGGAAAAGGCAAAGG - Intergenic
1025241235 7:57277814-57277836 CAGGAAGGTGGTAAAGGAGAAGG + Intergenic
1025613718 7:63100181-63100203 CTGGAATGTGGGAAAGAGAGTGG + Intergenic
1027157658 7:75780093-75780115 CAGGAAAGTGGAAAAGGGATGGG - Intronic
1027237150 7:76304831-76304853 CTGTAAGGTGGGGAAGGAGGAGG + Intergenic
1027499387 7:78929538-78929560 CTAGAAGCTGGAAAAGGCAAAGG - Intronic
1027628138 7:80569459-80569481 CTGGAAAGTGGTAAAGGGATAGG - Intronic
1028088229 7:86664170-86664192 CTGGAATGTGGAGAATGATGGGG + Intronic
1028617349 7:92783356-92783378 CTGAAAAGTGGAAAAGGACAGGG + Intronic
1028827996 7:95296425-95296447 GTTGAAGGTGAAAATGGAAGAGG - Intergenic
1029185229 7:98733566-98733588 CTGGAAGGGAGAAAAGAAATGGG + Intergenic
1029484857 7:100833992-100834014 CTGGAAGGTAGAAAATGACTTGG - Intronic
1030148784 7:106382262-106382284 CTGGGAGGAGGAGGAGGAAGAGG + Intergenic
1030398515 7:109018903-109018925 TTGGAAGAAGAAAAAGGAAGTGG + Intergenic
1030693029 7:112554196-112554218 CTAGAAGGTGAGAAAGAAAGAGG - Intergenic
1030974604 7:116105890-116105912 ATGGAAGGTGGAAAGAGATGGGG - Intronic
1031915450 7:127558809-127558831 CTGGATGCTGGAAAAGGCAAGGG + Intergenic
1032459218 7:132097185-132097207 CAGGAAGGAGGAAGAAGAAGAGG - Intergenic
1033038980 7:137901294-137901316 ATGGAAGATGGGGAAGGAAGAGG - Intronic
1033121260 7:138668740-138668762 CCGGAAGGTGGCAGGGGAAGGGG - Intronic
1033184186 7:139210864-139210886 GTGGAAGGTGAAGGAGGAAGGGG + Intergenic
1033431623 7:141294836-141294858 CTGAAAGGCGGAAAAGGCAGGGG - Intronic
1033466202 7:141592288-141592310 CTAGAAGCTGGAAAAGCAAAAGG - Intronic
1033578953 7:142714092-142714114 CTGGATGGTGGAATAGAAGGAGG - Intergenic
1033825757 7:145187116-145187138 CTGGAAGGAAGGAAGGGAAGGGG - Intergenic
1034228401 7:149500265-149500287 CAGGAAGGTGGAGATGGTAGGGG - Intergenic
1034696458 7:153058514-153058536 AAGGAAGGCGGAAGAGGAAGTGG - Intergenic
1035241489 7:157533508-157533530 CTGGGAGGTGGTAAAGGATGAGG - Intergenic
1035518223 8:254935-254957 GTGGAAGGGAGAAATGGAAGAGG + Intergenic
1035825894 8:2643838-2643860 TGGGAAGGTGGAGAAGGAGGAGG + Intergenic
1035901658 8:3463217-3463239 CTGTAAGGCAGAGAAGGAAGTGG - Intronic
1035935110 8:3828525-3828547 CAAGAAGGTGGAAAAAGGAGAGG - Intronic
1036564365 8:9925621-9925643 CTGGAAAATGGAAAAGAAACTGG - Intergenic
1036688874 8:10928774-10928796 CTGGAAGGTGGAGAAGGAGGGGG - Intronic
1036711166 8:11079550-11079572 CTGGAAGGGGAAAAAGGAAATGG + Intronic
1036919638 8:12839418-12839440 CAAGAAGGTAGAAAAAGAAGAGG - Intergenic
1037503208 8:19505438-19505460 CTCGCAGGTGGACAAGGCAGAGG - Exonic
1037550938 8:19970783-19970805 AAGGAAGGTGGAGATGGAAGTGG - Intergenic
1037651678 8:20844633-20844655 CTGGAAGATGGTAAAGGAGGAGG + Intergenic
1037723763 8:21466749-21466771 CTGGAAGGGAGGAAAGGAATGGG - Intergenic
1037890023 8:22619127-22619149 CTGCAAGGTGGAGAAGGAAACGG - Intronic
1037997383 8:23363103-23363125 CTGGAAGAAGGAAAGGGAAAGGG - Intronic
1038034296 8:23674138-23674160 TTGAAAGGAGGATAAGGAAGTGG + Intergenic
1038050861 8:23809880-23809902 CTGGGAGGTGGGATAGGAAAGGG - Intergenic
1038222406 8:25623290-25623312 CTAGAAGCTGGAAAAGGGAAGGG - Intergenic
1038276486 8:26125728-26125750 CTTGAAGGAGAAAAGGGAAGAGG + Intergenic
1038460217 8:27709819-27709841 CTGGAGGGAGGGAAAGGAAGTGG - Intergenic
1038494176 8:27990058-27990080 GAGGAAGGTGGAAATGGCAGTGG - Intronic
1038716267 8:29993985-29994007 CTGGAGGGAGGAGATGGAAGAGG - Intergenic
1038857248 8:31347496-31347518 CTGGCAGGTGGTGAAGGAAGGGG + Intergenic
1041153652 8:54961800-54961822 AAGGAGGGTGGAAAAAGAAGTGG + Intergenic
1041186794 8:55309045-55309067 CTGGAAGCTGGAAAGGGCAAGGG + Intronic
1041336090 8:56785993-56786015 CTGTAGGGTGGAAAAGTATGTGG + Intergenic
1041345328 8:56890926-56890948 CTGGATCCTGGAAAAGGAGGAGG + Intergenic
1042867024 8:73365437-73365459 ATGGAAGAGGGAAGAGGAAGCGG - Intergenic
1043185091 8:77138237-77138259 AGGGAAGGTGGAGAAGGAGGTGG - Intergenic
1044819793 8:96148138-96148160 CTGAAACGTGGAAAGGGTAGGGG - Intronic
1045000515 8:97874266-97874288 CTGGAAGTTGGAAAAGGCAGGGG - Intronic
1045291669 8:100838493-100838515 CTAGAAGCTGGAAAAGGCAGGGG + Intergenic
1045407975 8:101886252-101886274 CTTAATGGGGGAAAAGGAAGTGG + Intronic
1046516937 8:115274709-115274731 GTGGATGGTGGCAGAGGAAGGGG + Intergenic
1046750832 8:117924673-117924695 CTGGAGGGCAGAAAAGCAAGAGG + Intronic
1047086533 8:121523182-121523204 CTGGAAGCAGGAAAATGTAGTGG + Intergenic
1047254788 8:123207006-123207028 GTGGGAGGGGGAAGAGGAAGAGG - Intronic
1047372168 8:124265171-124265193 CTGGAAGGTGGAAGGAGATGAGG - Intergenic
1047487230 8:125342484-125342506 ATGGAAAGTGGACAAGGAGGGGG + Intronic
1047783162 8:128126359-128126381 ATAGGAGCTGGAAAAGGAAGTGG - Intergenic
1047843545 8:128780756-128780778 ATGAGAGTTGGAAAAGGAAGGGG + Intergenic
1047938956 8:129808768-129808790 GTGGAAGGTGGAAAGGGAGCAGG - Intergenic
1048120749 8:131578856-131578878 CAGGATGGTGGAAGTGGAAGTGG + Intergenic
1048123177 8:131604698-131604720 CTGGAAGGTGGGAGAGGATCAGG - Intergenic
1048149832 8:131883691-131883713 CTGGAAAGTGCAAAAGGTCGGGG - Intergenic
1048256913 8:132912069-132912091 CTGGATGGTGGAAGAGAAAATGG - Intronic
1048566417 8:135602885-135602907 CTGTATGGTGCAAATGGAAGAGG - Intronic
1048619076 8:136111674-136111696 CTGGAAGGTAGAAGATGAGGTGG + Intergenic
1048844458 8:138593956-138593978 CTGGAGGGCGGAGAAGGAACAGG - Intronic
1048954027 8:139519362-139519384 CTGGAGGCTGGAAAGGGTAGCGG - Intergenic
1049012343 8:139895478-139895500 CTGGGAGGTGGAGAAGGAAAAGG + Intronic
1049228064 8:141467139-141467161 CGGAATGGTGGGAAAGGAAGGGG - Intergenic
1049268569 8:141682370-141682392 ATGGAAGCTGGAAGAGGCAGAGG - Intergenic
1049478827 8:142810417-142810439 CTGGAGGGTGGGAAAGAGAGAGG - Intergenic
1049666444 8:143845673-143845695 CTGCAAGGTGGAAGAGGAGGAGG - Intergenic
1049840587 8:144768654-144768676 CAGGATGGTGGAATAGGTAGGGG - Intergenic
1049982271 9:915317-915339 CAGGAAAGTGGAAATGGAGGGGG + Intronic
1050029138 9:1366753-1366775 CTGGAAAATGCAAGAGGAAGAGG + Intergenic
1050299556 9:4243253-4243275 CAGGAAGGAGGAAGAGGAAGTGG + Intronic
1050365953 9:4873959-4873981 CCTCAAGGTGGAAAAGAAAGGGG - Intronic
1050398880 9:5229824-5229846 TTCTAAGGTGGCAAAGGAAGAGG - Intergenic
1050593128 9:7180344-7180366 CTAGAAGCTGGAAAGGCAAGGGG + Intergenic
1050987317 9:12100023-12100045 ATGGAAGGTAGAGAAGGCAGTGG + Intergenic
1051308454 9:15742428-15742450 CTAGCATGAGGAAAAGGAAGAGG - Intronic
1051357866 9:16255851-16255873 CAGGAAGAATGAAAAGGAAGAGG - Intronic
1051871479 9:21742577-21742599 CTGCAAGGAGGCAAAGGCAGAGG + Intergenic
1051954639 9:22677094-22677116 TTGGAAGGTGGAAAAGAATAAGG - Intergenic
1052415786 9:28175374-28175396 TTGGAAGGAGAAAAAGAAAGAGG - Intronic
1052674362 9:31600488-31600510 CTAGAAGGTGGAAAAATTAGAGG - Intergenic
1052733789 9:32319431-32319453 CTGGAAAGAGGAAAAGGGAGAGG - Intergenic
1052830038 9:33207601-33207623 ATGAAAGGTGGAAAGGCAAGAGG + Intergenic
1053150711 9:35741013-35741035 GTGGGATGTGGAAAATGAAGGGG - Exonic
1053370000 9:37552808-37552830 GTGGAAGGTAGAAAAGCAAGAGG + Intronic
1053381527 9:37652932-37652954 ATGGAAGGTGGAGGAAGAAGAGG + Intronic
1053723447 9:40972812-40972834 CTAAAAGTTGGAAAAGGAAATGG + Intergenic
1054342516 9:63879184-63879206 CTAAAAGTTGGAAAAGGAAATGG - Intergenic
1054353422 9:64040508-64040530 CTGGATGCTGGACAAGGAACTGG - Intergenic
1054771703 9:69089734-69089756 CTGAAAGGAGGAATAGGGAGGGG + Intronic
1055099053 9:72444370-72444392 CTGCAAAGTGGAGAAGAAAGTGG - Intergenic
1055415322 9:76076224-76076246 GGGCAAGGTGGAACAGGAAGAGG + Intronic
1055511036 9:76995792-76995814 CTGGAAGGAGCAGAAGGAAGGGG - Intergenic
1055637674 9:78294869-78294891 GTGGAATGGGAAAAAGGAAGTGG + Intergenic
1055705141 9:78991163-78991185 ATGGAAGATGGAAGTGGAAGGGG - Intergenic
1055726797 9:79238917-79238939 TTGGAAGGTGCACAAGGAAATGG + Intergenic
1055964239 9:81849971-81849993 CTGTAAGATGCAACAGGAAGAGG + Intergenic
1056139623 9:83663159-83663181 GAGGAAGGAGGAAAAGGAAAGGG + Intronic
1056144256 9:83713869-83713891 GGGGAAGGTGGAAAAGTCAGAGG + Intergenic
1056497815 9:87177508-87177530 CTATAAGGTGGAAAAGGAGGAGG + Intergenic
1056985917 9:91363662-91363684 GTGGAAGGGGGTCAAGGAAGGGG + Intergenic
1057197356 9:93122382-93122404 CTGGAAGGAGGAAGAGGAGAGGG + Intronic
1057280806 9:93710240-93710262 CTGCAGGGTGGAACAGGCAGTGG - Intergenic
1057421027 9:94912578-94912600 GTGGAAGATGGACAAGGAATTGG - Intronic
1057559076 9:96113291-96113313 CTGGAAGTGGGGACAGGAAGTGG - Intronic
1057993531 9:99798222-99798244 CTGGACCGTGAACAAGGAAGTGG - Intergenic
1059559073 9:115314320-115314342 TGGGAAGGTGGAAAGGGAGGTGG + Intronic
1059599085 9:115756457-115756479 CTGGAAGTTTCTAAAGGAAGTGG + Intergenic
1059623995 9:116041181-116041203 CTGGAATATGGAAAAGAAAAAGG + Intergenic
1059862344 9:118478730-118478752 CTGGAAGCTAGAAAATGAGGTGG + Intergenic
1060001023 9:119958706-119958728 CTGGGAAGTGGAAAAGGACTTGG + Intergenic
1060517853 9:124276969-124276991 CTTGAAGGTGGATAAGGAAGGGG + Intronic
1060960811 9:127679252-127679274 CTGGAAGGTGTATAAGGTGGTGG + Intronic
1061138920 9:128752683-128752705 CTCCAAGATGGAAGAGGAAGCGG - Exonic
1061321980 9:129836429-129836451 CTAGGAGGTGGAACAGGAATTGG + Intronic
1061524303 9:131145699-131145721 CTGGGGAGTGAAAAAGGAAGAGG - Intronic
1061750985 9:132776863-132776885 GTGGAAGCCGGATAAGGAAGTGG - Intronic
1061877735 9:133553343-133553365 CTGGAAGGCGGGAGAGGCAGAGG - Intronic
1062593602 9:137287195-137287217 CTGGAGGCTGGAAAGGGAACGGG + Intergenic
1062752416 9:138265368-138265390 CTAGAAGCTGGAAAAGGCAAAGG + Intergenic
1203695931 Un_GL000214v1:96822-96844 CTGGATGCTGGACAAGGAACTGG + Intergenic
1203741753 Un_GL000218v1:9618-9640 CTGGATGCTGGACAAGGAACTGG - Intergenic
1203701942 Un_KI270742v1:4208-4230 CTGGATGCTGGACAAGGAACTGG - Intergenic
1203553926 Un_KI270743v1:190263-190285 CTGGATGCTGGACAAGGAACTGG - Intergenic
1203574927 Un_KI270745v1:150-172 CTAGAAGCTGGAAAAGGCAAAGG + Intergenic
1203640342 Un_KI270751v1:7241-7263 CTGGATGCTGGACAAGGAACTGG - Intergenic
1203673057 Un_KI270755v1:35201-35223 ATGTGAGGTGGAGAAGGAAGGGG + Intergenic
1186116013 X:6305994-6306016 CTATAAGGTCTAAAAGGAAGAGG - Intergenic
1186965715 X:14784358-14784380 CTGGAAGCTGGAAAAGGCAAGGG - Intergenic
1187274494 X:17805962-17805984 CTGGCAGGTTGAACAGCAAGAGG - Intronic
1187427215 X:19188977-19188999 AAAGAAGGTGGAAAAGGGAGGGG + Intergenic
1187737981 X:22323817-22323839 TTGGAAAGAGGAAAAGGAGGAGG - Intergenic
1187825098 X:23327252-23327274 ATGGAAGTTGGAAAGGGTAGGGG + Intergenic
1188116983 X:26256628-26256650 TTGGAAGGTGGAAAAAGAAAAGG - Intergenic
1188283314 X:28297561-28297583 CTAGAAGCTGGAAAAGGCAAGGG + Intergenic
1188299215 X:28487006-28487028 CTAGAAGCTGGAAAAGGCAAGGG - Intergenic
1188359818 X:29239588-29239610 CTAGAAGTTGGAAAAGGCAAAGG - Intronic
1188605178 X:32020001-32020023 CTGCAAGGTGGGCAAGGAAAGGG + Intronic
1188613981 X:32134656-32134678 CTGGAAGAAAGAAAAGGAAAGGG - Intronic
1188822486 X:34792605-34792627 CTTGAGGGAGGAAAAGGAAGAGG - Intergenic
1189069033 X:37845122-37845144 CTGGGAGGTGGAAGAGGGAGTGG - Intronic
1189336674 X:40174701-40174723 CTGGAAGGTGGAACGCAAAGGGG + Intronic
1189730131 X:44011563-44011585 CTACAAGGTGGAAAAGGCAAGGG - Intergenic
1190108026 X:47573027-47573049 GAGGAAGGGGGAAGAGGAAGGGG + Intronic
1190969533 X:55335221-55335243 CAGGAAGTTGGAAACGGATGGGG - Intergenic
1191736605 X:64394773-64394795 CTGGGCAATGGAAAAGGAAGAGG - Intronic
1192195824 X:69027442-69027464 CTGGGAGGAGGAACAGGAAAAGG + Intergenic
1192377393 X:70577523-70577545 CTGGAAGCAGCAAAAGGAAGTGG + Intronic
1192759349 X:74079328-74079350 CTGAAAGGTGAAGAAGGGAGTGG + Intergenic
1193086289 X:77449897-77449919 AGGGAAGGAGGAAAAGGAAAAGG - Intronic
1193117354 X:77788309-77788331 CTGCCAAGCGGAAAAGGAAGAGG + Intergenic
1193183763 X:78488111-78488133 CTGGGAAGGGGAAAAGGAAAGGG + Intergenic
1193816500 X:86110577-86110599 CTGGAGGCTGGGAAAGGTAGTGG + Intergenic
1195264184 X:103164143-103164165 CTGGAGGGTGGGAGGGGAAGTGG + Intergenic
1195486476 X:105413520-105413542 CTAGAAGCTGGAAAAGGCAAAGG + Intronic
1195491392 X:105474255-105474277 CTAGAAGGTAGAAAAGGAAAAGG + Intronic
1196424785 X:115559852-115559874 CAGGAAGGTGAAAAAGAAATGGG - Intergenic
1197291006 X:124657439-124657461 TTGGAAGGTGAAAAAAAAAGGGG + Intronic
1197485569 X:127045934-127045956 CTTGAAGGTGGAGGAGGAGGTGG + Intergenic
1198117243 X:133555987-133556009 CTGGAGGATGAAAAAGGAGGAGG - Intronic
1198935185 X:141896774-141896796 GTGGAAAGAGGAAGAGGAAGTGG - Intronic
1199323985 X:146476112-146476134 CTAGAAGGAGGCAAAGGGAGGGG + Intergenic
1199516898 X:148688202-148688224 CTGCAACGTGGAAAAGGCAGGGG - Intronic
1199573767 X:149293038-149293060 ATGGAAGATGGAGAAGGAAGGGG - Intergenic
1199600952 X:149540706-149540728 CCGGAAGGAGGAAAAGGAACGGG - Exonic
1199649436 X:149938729-149938751 CCGGAAGGAGGAAAAGGAACCGG + Exonic
1199672305 X:150157692-150157714 CTAGAAGCTGGAAAAGGAAAGGG - Intergenic
1199860927 X:151800004-151800026 AGTGAAGGTGGAAGAGGAAGGGG - Intergenic
1200073819 X:153541577-153541599 CTGGAAGGAGGAAGAGGAATGGG + Intronic
1200367738 X:155685551-155685573 GTGGAGGGTGGAAGAGGGAGAGG - Intergenic
1200775250 Y:7164710-7164732 ATGGAAAGGGGAAGAGGAAGAGG - Intergenic
1200936824 Y:8745627-8745649 ATGGAAGTTGGGAAAAGAAGAGG + Intergenic
1201155284 Y:11127072-11127094 CTGGATGCTGGACAAGGAACTGG - Intergenic
1201348851 Y:13016287-13016309 CAGGAAGGAGGGAAAGGAGGGGG - Intergenic