ID: 1001948628

View in Genome Browser
Species Human (GRCh38)
Location 5:175800393-175800415
Sequence AAAGTCCCCTTGAACCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1772
Summary {0: 1, 1: 0, 2: 10, 3: 106, 4: 1655}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001948623_1001948628 23 Left 1001948623 5:175800347-175800369 CCTTGGTGAAGGGAAGTCAGCCA 0: 1
1: 0
2: 5
3: 22
4: 171
Right 1001948628 5:175800393-175800415 AAAGTCCCCTTGAACCCAGGAGG 0: 1
1: 0
2: 10
3: 106
4: 1655
1001948624_1001948628 3 Left 1001948624 5:175800367-175800389 CCATTAAAAGCCAATAAGAGCCA 0: 1
1: 0
2: 1
3: 27
4: 167
Right 1001948628 5:175800393-175800415 AAAGTCCCCTTGAACCCAGGAGG 0: 1
1: 0
2: 10
3: 106
4: 1655
1001948625_1001948628 -7 Left 1001948625 5:175800377-175800399 CCAATAAGAGCCAATAAAAGTCC 0: 1
1: 0
2: 0
3: 13
4: 182
Right 1001948628 5:175800393-175800415 AAAGTCCCCTTGAACCCAGGAGG 0: 1
1: 0
2: 10
3: 106
4: 1655

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001948628 Original CRISPR AAAGTCCCCTTGAACCCAGG AGG Intronic
900176263 1:1292719-1292741 AAAGACCCCTGGACCCAAGGGGG + Exonic
900278367 1:1848287-1848309 GAAAACCGCTTGAACCCAGGAGG + Intronic
900307317 1:2017276-2017298 AAGGATCCCTTGAACCCGGGAGG + Intergenic
900326904 1:2112777-2112799 GAAAATCCCTTGAACCCAGGAGG - Intronic
900468108 1:2835578-2835600 GGAGGCCCCCTGAACCCAGGAGG + Intergenic
900696520 1:4015190-4015212 AAGGATCACTTGAACCCAGGAGG - Intergenic
900988797 1:6088319-6088341 GAAGGTCACTTGAACCCAGGAGG - Intronic
900995110 1:6118286-6118308 AAAGATCGCTTGCACCCAGGGGG + Intronic
901313406 1:8287674-8287696 GAAGATTCCTTGAACCCAGGAGG + Intergenic
901359900 1:8688469-8688491 AAGAATCCCTTGAACCCAGGAGG + Intronic
901382821 1:8886221-8886243 CAGGACCACTTGAACCCAGGTGG + Intergenic
901388625 1:8927790-8927812 GAGGATCCCTTGAACCCAGGAGG + Intergenic
901509492 1:9709480-9709502 GAAGATCCCTTGAACCCAGGAGG + Intronic
901559963 1:10062400-10062422 AAAAATCCCTTAAACCCAGGAGG - Intronic
901567595 1:10131393-10131415 AAGGATCACTTGAACCCAGGAGG + Intronic
901609680 1:10487868-10487890 AAGAATCCCTTGAACCCAGGAGG - Intronic
901687315 1:10950121-10950143 GAAGATCACTTGAACCCAGGAGG - Intronic
901812551 1:11776165-11776187 AAGGATCGCTTGAACCCAGGAGG + Intronic
901948617 1:12723871-12723893 AAGAATCCCTTGAACCCAGGAGG - Intronic
901976175 1:12945896-12945918 GAAGATCGCTTGAACCCAGGAGG + Intronic
901998322 1:13171962-13171984 GAGGATCCCTTGAACCCAGGAGG - Intergenic
902008997 1:13255869-13255891 GAAGATCGCTTGAACCCAGGAGG - Intronic
902252842 1:15166627-15166649 GAGAACCCCTTGAACCCAGGAGG + Intronic
902418773 1:16260787-16260809 AAAGATCCCTTGCACCCAGGAGG - Intronic
902579600 1:17399943-17399965 GAGGATCCCTTGAACCCAGGAGG + Intronic
902648476 1:17820655-17820677 GAGATTCCCTTGAACCCAGGAGG - Intronic
903078460 1:20789587-20789609 GAGAACCCCTTGAACCCAGGAGG + Intergenic
903111694 1:21140401-21140423 GAGGCCCACTTGAACCCAGGAGG - Intronic
903359763 1:22769494-22769516 AGAATCAACTTGAACCCAGGAGG - Intronic
903443862 1:23408289-23408311 AAGGTCCGATTGAACCCAGTGGG - Intronic
903560234 1:24221642-24221664 AAGAACACCTTGAACCCAGGAGG - Intergenic
903566273 1:24268084-24268106 AAGAATCCCTTGAACCCAGGAGG - Intergenic
903684252 1:25119491-25119513 AGAATCCCTTAGAACCCAGGAGG - Intergenic
903785768 1:25860247-25860269 AAGAACCGCTTGAACCCAGGAGG - Intergenic
903838038 1:26218661-26218683 GAGAACCCCTTGAACCCAGGAGG - Intergenic
903908827 1:26707121-26707143 GAGAACCCCTTGAACCCAGGAGG - Intronic
903909747 1:26714501-26714523 AAAAATCACTTGAACCCAGGAGG - Intronic
903917928 1:26777977-26777999 AGAATCACTTTGAACCCAGGAGG + Intronic
903917953 1:26778172-26778194 AAAAATCGCTTGAACCCAGGAGG + Intronic
903937469 1:26906364-26906386 AAGAACCGCTTGAACCCAGGAGG + Intronic
903982361 1:27198547-27198569 AAAAATCGCTTGAACCCAGGAGG - Intergenic
903992991 1:27287474-27287496 GAAAATCCCTTGAACCCAGGAGG - Intronic
904100726 1:28024565-28024587 AAGAATCCCTTGAACCCAGGAGG + Intronic
904141214 1:28355054-28355076 AAAATCCCCTTGAGCCTGGGAGG - Intergenic
904173444 1:28608353-28608375 AAGGATCCCTTGAACTCAGGTGG + Intronic
904226697 1:29027000-29027022 AAAAATCACTTGAACCCAGGAGG + Intronic
904720200 1:32501769-32501791 GAGAACCCCTTGAACCCAGGAGG - Intronic
904765769 1:32845351-32845373 GAGGAACCCTTGAACCCAGGAGG + Intronic
905129208 1:35740329-35740351 AAAGTCACCTTGGTCCCATGTGG + Intronic
905374087 1:37506459-37506481 AAGGATCACTTGAACCCAGGAGG - Intronic
905701636 1:40020631-40020653 GAAGACCACTTGAGCCCAGGAGG + Intergenic
906313359 1:44769603-44769625 AAGAACCGCTTGAACCCAGGAGG + Intergenic
906351188 1:45061458-45061480 AAAAATCACTTGAACCCAGGAGG - Intronic
906414875 1:45613569-45613591 AAGGATTCCTTGAACCCAGGAGG - Intronic
906502825 1:46354194-46354216 GAGGACCCCTTGAGCCCAGGAGG - Intronic
906696390 1:47826121-47826143 ACAGTCCCCTTCAAGCCAGTTGG - Intronic
907072730 1:51551674-51551696 GAGGACCCCTTGAGCCCAGGAGG - Intergenic
907183966 1:52594910-52594932 AAAAATCACTTGAACCCAGGAGG + Intergenic
907186725 1:52615232-52615254 AGAATCCGCTTGAACCCAGGAGG - Intergenic
907250757 1:53137195-53137217 AAGATTCGCTTGAACCCAGGAGG + Intronic
907252626 1:53151804-53151826 AAGAATCCCTTGAACCCAGGAGG - Intergenic
907362179 1:53926810-53926832 AAGGACCACTTGAGCCCAGGAGG - Intronic
907432114 1:54418663-54418685 GAAGATCACTTGAACCCAGGAGG + Intergenic
907458412 1:54590842-54590864 AAGAACCGCTTGAACCCAGGAGG - Intronic
907566471 1:55439543-55439565 GAAGATCACTTGAACCCAGGAGG - Intergenic
908369964 1:63471872-63471894 AAGAATCCCTTGAACCCAGGAGG - Intronic
908482436 1:64555507-64555529 AAGAATCCCTTGAACCCAGGAGG - Intronic
908515866 1:64892368-64892390 GAGGTTCACTTGAACCCAGGAGG - Intronic
908552183 1:65220563-65220585 AAAAATCACTTGAACCCAGGAGG - Intronic
908557900 1:65275976-65275998 GAAGATCGCTTGAACCCAGGAGG - Intronic
908724727 1:67163377-67163399 GAAGATCACTTGAACCCAGGAGG + Intronic
908752960 1:67442381-67442403 GAAAATCCCTTGAACCCAGGAGG - Intergenic
908824347 1:68118785-68118807 AGAATCACTTTGAACCCAGGAGG + Intronic
909409951 1:75338471-75338493 AAAGTTCCCTTGAAGCCAACAGG + Intronic
909708891 1:78621359-78621381 AAGAATCCCTTGAACCCAGGAGG - Intronic
909912022 1:81272149-81272171 AAGGATCACTTGAACCCAGGAGG + Intergenic
910459281 1:87431478-87431500 AAAGATCACTTGAGCCCAGGAGG - Intergenic
910754212 1:90669475-90669497 AAGGATCACTTGAACCCAGGAGG + Intergenic
910806038 1:91190592-91190614 AAGGATCCCTTGAGCCCAGGAGG + Intergenic
910870128 1:91825889-91825911 AACAATCCCTTGAACCCAGGAGG + Intronic
910885527 1:91959568-91959590 AAGGACCACTTGAACCCGGGAGG - Intronic
910923630 1:92375908-92375930 AAAAACCGCTTGAACCCAGGAGG + Intronic
910994173 1:93086407-93086429 GAGGTTCACTTGAACCCAGGAGG + Intronic
911003467 1:93192519-93192541 AATGATCACTTGAACCCAGGAGG - Intronic
911065424 1:93783845-93783867 CTCCTCCCCTTGAACCCAGGTGG + Intronic
911165966 1:94724524-94724546 GAGGATCCCTTGAACCCAGGAGG - Intergenic
911301761 1:96183373-96183395 GAAGATCCCTTGAACCCGGGAGG + Intergenic
911383804 1:97149339-97149361 AGAATCCACTTGAACCCAGGAGG - Intronic
911731455 1:101296239-101296261 AAGGATCACTTGAACCCAGGAGG - Intergenic
911973357 1:104463726-104463748 AAAGGCCTGTTGAACTCAGGGGG - Intergenic
912006522 1:104908818-104908840 AAAGTACCATTGAACACATGAGG - Intergenic
912146206 1:106797244-106797266 AAAAACTGCTTGAACCCAGGAGG - Intergenic
912373541 1:109191895-109191917 AGAGACCCTCTGAACCCAGGAGG + Intronic
912554439 1:110506075-110506097 AAGAATCCCTTGAACCCAGGAGG - Intergenic
912915029 1:113806243-113806265 AAGATTCCCATGAACCCAGGAGG + Intronic
913005472 1:114626599-114626621 GAAGATCACTTGAACCCAGGAGG - Intronic
913265754 1:117042180-117042202 AATCCTCCCTTGAACCCAGGAGG - Intergenic
913298562 1:117345961-117345983 AAGGATCGCTTGAACCCAGGAGG + Intergenic
913357944 1:117944789-117944811 GAAAACCACTTGAACCCAGGAGG - Intronic
913458188 1:119055550-119055572 AAGATTCACTTGAACCCAGGAGG + Intronic
913679290 1:121173272-121173294 AAACCCCCCTTGAACCTAGGAGG - Intronic
914031121 1:143960921-143960943 AAACCCCCCTTGAACCTAGGAGG - Intronic
914158326 1:145107042-145107064 AAACCCCCCTTGAACCTAGGAGG + Intronic
914333084 1:146690533-146690555 GAAGATCACTTGAACCCAGGAGG - Intergenic
914439192 1:147688585-147688607 AAGAATCCCTTGAACCCAGGAGG + Intergenic
914692572 1:150044026-150044048 GAGGACCTCTTGAACCCAGGAGG + Intergenic
914707750 1:150184866-150184888 GAAAACCGCTTGAACCCAGGAGG + Intergenic
914709280 1:150197991-150198013 AAGAATCCCTTGAACCCAGGAGG + Intergenic
914918966 1:151834828-151834850 GAGGACCTCTTGAACCCAGGAGG - Intergenic
915425864 1:155826119-155826141 AAAGATCACTTTAACCCAGGAGG + Intronic
915434829 1:155896377-155896399 AAAGATCACTTGAACCCGGGAGG + Intergenic
915583394 1:156829739-156829761 AGAATCCCTTAGAACCCAGGAGG - Intronic
915602056 1:156928658-156928680 AAAAATCGCTTGAACCCAGGAGG - Intronic
917097223 1:171411137-171411159 GAGGATCCCTTGAACCCAGGAGG + Intergenic
917365172 1:174223351-174223373 AAAAGTCACTTGAACCCAGGAGG + Intronic
917913912 1:179681165-179681187 GAAGATCACTTGAACCCAGGCGG - Intronic
918205724 1:182307452-182307474 AAGGAACACTTGAACCCAGGAGG + Intergenic
918213395 1:182371602-182371624 GAGGACCACTTGAACCCAGGAGG - Intergenic
918495783 1:185134270-185134292 AATCACCACTTGAACCCAGGAGG - Intronic
918813809 1:189156545-189156567 AAGAATCCCTTGAACCCAGGAGG + Intergenic
919076793 1:192823049-192823071 AAGAATCCCTTGAACCCAGGCGG + Intergenic
919132639 1:193470742-193470764 GAAGAACACTTGAACCCAGGAGG - Intergenic
919237386 1:194863082-194863104 AAGAATCCCTTGAACCCAGGAGG + Intergenic
919412573 1:197264709-197264731 AAGAATCCCTTGAACCCAGGAGG - Intergenic
919513791 1:198496759-198496781 AAGGATCACTTGAACCCAGGAGG - Intergenic
919561308 1:199123334-199123356 AAGGATCACTTGAACCCAGGAGG + Intergenic
919630767 1:199958400-199958422 GAAGATCGCTTGAACCCAGGAGG + Intergenic
919965910 1:202524965-202524987 AGAATCACTTTGAACCCAGGAGG - Intronic
920009355 1:202856625-202856647 GAGGACCACTTGAACCCAGGAGG + Intergenic
920056737 1:203198321-203198343 AAGAACCCCTTGAACCCAGGAGG + Intergenic
920133109 1:203747903-203747925 AAGAATCCCTTGAACCCAGGAGG + Intergenic
920133421 1:203750582-203750604 AAGGATCACTTGAACCCAGGAGG + Intergenic
920326857 1:205172043-205172065 AGAATTCACTTGAACCCAGGAGG - Intronic
920466589 1:206191815-206191837 AAACCCCCCTTGAACCTGGGAGG - Intronic
920520239 1:206619149-206619171 AAGAATCCCTTGAACCCAGGAGG + Intergenic
920542677 1:206791390-206791412 AAGAACCGCTTGAACCCAGGAGG - Intergenic
920645159 1:207797755-207797777 GAGGATCCCTTGAACCCAGGAGG - Intergenic
921337110 1:214099303-214099325 AAGAATCCCTTGAACCCAGGAGG + Intergenic
921398898 1:214698470-214698492 GAAGATCGCTTGAACCCAGGAGG + Intergenic
921784589 1:219214777-219214799 AAAAATCTCTTGAACCCAGGAGG - Intergenic
921805726 1:219452214-219452236 GAAAACCACTTGAACCCAGGAGG + Intergenic
921866254 1:220090588-220090610 AAGGATCGCTTGAACCCAGGAGG - Intergenic
922113424 1:222585535-222585557 AAGGATCACTTGAACCCAGGAGG - Intronic
922156450 1:223043537-223043559 GAGGATCCCTTGAACCCAGGAGG + Intergenic
922425684 1:225490482-225490504 AAAATCCCTTTGAACCCAGGGGG + Exonic
922600889 1:226852090-226852112 AAGAACCGCTTGAACCCAGGAGG - Intergenic
922736949 1:227990758-227990780 AAGAATCCCTTGAACCCAGGAGG + Intergenic
922897479 1:229111695-229111717 GAGGATCCCTTGAACCCAGGAGG - Intergenic
922928334 1:229369209-229369231 AAGGATCCCTTGAGCCCAGGAGG + Intergenic
923123571 1:231016188-231016210 AATGTCCACTTGAACCCAGGAGG + Intergenic
923395037 1:233553394-233553416 GAGGACCACTTGAACCCAGGAGG + Intergenic
923516108 1:234699168-234699190 AAAAATCGCTTGAACCCAGGAGG + Intergenic
923579270 1:235191986-235192008 AAAGGTCGCTTGAGCCCAGGAGG + Intronic
923590903 1:235318789-235318811 GAAGATCGCTTGAACCCAGGAGG + Intronic
924039980 1:239974863-239974885 GAAGACCTCTTGAGCCCAGGAGG + Intergenic
924131230 1:240910805-240910827 AGAATCCCCTTGAACCTGGGAGG - Intronic
924203687 1:241688292-241688314 AAAGTCCCCTTGTGCCCATGTGG - Intronic
924236616 1:242004279-242004301 AAGAATCCCTTGAACCCAGGAGG + Intergenic
924472760 1:244357617-244357639 AAAAATCGCTTGAACCCAGGAGG + Intronic
924620231 1:245653971-245653993 AAGGATCGCTTGAACCCAGGAGG + Intronic
924733468 1:246733174-246733196 GAAGATCCCTTGAGCCCAGGAGG - Intronic
924750137 1:246879737-246879759 AAAATCGGCTTGAACCCAGGAGG + Intronic
1062853409 10:763936-763958 GAAAACCACTTGAACCCAGGTGG + Intergenic
1063098146 10:2926384-2926406 AAAGTCACCTTGGAGCCAGCAGG + Intergenic
1063101866 10:2957165-2957187 GAAGACCCCTTGAGTCCAGGAGG + Intergenic
1063414352 10:5861346-5861368 AAAAATCACTTGAACCCAGGGGG + Intergenic
1063435368 10:6025262-6025284 AAGATTCACTTGAACCCAGGAGG + Intronic
1063469662 10:6274108-6274130 GAAGACCGCTTGAGCCCAGGAGG + Intergenic
1063672453 10:8110357-8110379 GAGAACCCCTTGAACCCAGGAGG + Intergenic
1064030174 10:11878609-11878631 AATGTACCTTTGAAACCAGGAGG - Intergenic
1064220377 10:13435777-13435799 AAGGATCCCTTGAGCCCAGGAGG - Intergenic
1064310759 10:14209796-14209818 GAGGACCACTTGAACCCAGGAGG + Intronic
1064407182 10:15074428-15074450 AAAGATCGCTTGAGCCCAGGAGG + Intergenic
1064422897 10:15205534-15205556 AAGAACCTCTTGAACCCAGGAGG + Intergenic
1064448889 10:15423708-15423730 AAAGATCGCTTGAGCCCAGGAGG + Intergenic
1064471703 10:15642036-15642058 GAGGACCGCTTGAACCCAGGAGG + Intronic
1064510274 10:16082470-16082492 GAGATTCCCTTGAACCCAGGAGG + Intergenic
1064549417 10:16483754-16483776 GAAAATCCCTTGAACCCAGGAGG + Intronic
1064730407 10:18325277-18325299 AAGGATCCCTTGAGCCCAGGAGG - Intronic
1064884400 10:20093761-20093783 GAAGATCCCTTGAGCCCAGGAGG - Intronic
1064993547 10:21277037-21277059 AAGGTTCACTTGAGCCCAGGAGG + Intergenic
1065019435 10:21492128-21492150 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1065105578 10:22380391-22380413 GAGGACCCCTTGAACCCAGGAGG - Intronic
1065351909 10:24803365-24803387 GAAGATCGCTTGAACCCAGGAGG + Intergenic
1065388281 10:25155920-25155942 AAGGGTCCCTTGAGCCCAGGAGG + Intergenic
1065466329 10:26027432-26027454 GAAGATCACTTGAACCCAGGAGG - Intronic
1065501845 10:26391050-26391072 AAAGATCACTTGAACCAAGGAGG + Intergenic
1066120438 10:32281122-32281144 GAAAACCACTTGAACCCAGGAGG - Intronic
1066358865 10:34711429-34711451 AAGAATCCCTTGAACCCAGGAGG + Intronic
1066374143 10:34842339-34842361 GAAGATCCCTTGAGCCCAGGAGG + Intergenic
1066688279 10:38001813-38001835 AAGGATCCCTTGAGCCCAGGAGG + Intergenic
1066981811 10:42423566-42423588 GAAGTTCACTTGAGCCCAGGAGG - Intergenic
1067073327 10:43154635-43154657 AAGGATCACTTGAACCCAGGAGG + Intronic
1067367125 10:45643005-45643027 AAAGGGCGCTTGAACCCGGGAGG - Intronic
1067386743 10:45823693-45823715 GAAGTTCACTTGAGCCCAGGAGG - Intergenic
1067448977 10:46369702-46369724 AGAATCACTTTGAACCCAGGAGG - Intronic
1067588392 10:47491063-47491085 AGAATCACTTTGAACCCAGGAGG + Intronic
1067635518 10:47999154-47999176 AGAATCACTTTGAACCCAGGAGG + Intergenic
1067855983 10:49793681-49793703 GAAGATCTCTTGAACCCAGGAGG + Intergenic
1067876510 10:50012382-50012404 GAAGTTCACTTGAGCCCAGGAGG + Intergenic
1068000266 10:51325348-51325370 AAAGATTGCTTGAACCCAGGAGG - Intronic
1068184798 10:53570979-53571001 AGAATCGGCTTGAACCCAGGAGG + Intergenic
1068247572 10:54392374-54392396 AAAAATCACTTGAACCCAGGAGG + Intronic
1068332010 10:55583521-55583543 GAAGTTCCCTTGAACCTGGGAGG - Intronic
1069025226 10:63532813-63532835 AAGGATCCCTTGAGCCCAGGAGG + Intronic
1069219431 10:65864981-65865003 AAGGATCTCTTGAACCCAGGAGG - Intergenic
1069258283 10:66361625-66361647 GAAGATCCCTTGAGCCCAGGAGG - Intronic
1069383196 10:67861245-67861267 AGAATCGCTTTGAACCCAGGAGG + Intergenic
1069428822 10:68314877-68314899 AAAAATCGCTTGAACCCAGGAGG - Intronic
1069485518 10:68820235-68820257 GAGAACCCCTTGAACCCAGGAGG - Intergenic
1069647715 10:70015918-70015940 AAAAATCGCTTGAACCCAGGAGG + Intergenic
1069688179 10:70332552-70332574 AAAGATCACTTGAGCCCAGGAGG + Intronic
1069697934 10:70400968-70400990 ATAATCGCTTTGAACCCAGGAGG + Intergenic
1070102888 10:73405151-73405173 GAGAACCCCTTGAACCCAGGAGG + Intronic
1070104654 10:73420094-73420116 AAAGATCGCTTGAGCCCAGGAGG - Intergenic
1070155299 10:73830359-73830381 GAAGATCCCTTGAGCCCAGGAGG - Intronic
1070266908 10:74912028-74912050 GAAGATCCCTTGAGCCCAGGAGG - Intronic
1070373756 10:75809552-75809574 AGAATCGCCTTGAACCCAGGAGG + Intronic
1070475455 10:76824908-76824930 GAAGTCCCCTAGAGCACAGGGGG - Intergenic
1070621843 10:78018670-78018692 AAAAATCACTTGAACCCAGGAGG - Intronic
1070663871 10:78329663-78329685 AAGATACCCTTGAACCCAGGAGG - Intergenic
1071334812 10:84591717-84591739 GAAGACCACTTGAGCCCAGGAGG - Intergenic
1071609607 10:87020914-87020936 AGAATCACTTTGAACCCAGGAGG - Intronic
1071680395 10:87699370-87699392 AAGGACCCCTCGAGCCCAGGAGG - Intronic
1072078566 10:92004555-92004577 AAAGATCACTTGAGCCCAGGAGG - Intronic
1072115254 10:92364642-92364664 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1072135129 10:92537953-92537975 GAGGTCCACTTGAGCCCAGGAGG - Intronic
1072210273 10:93239969-93239991 AAGGATCACTTGAACCCAGGAGG - Intergenic
1072233422 10:93432296-93432318 GAAGCTCACTTGAACCCAGGAGG + Intronic
1072526915 10:96280098-96280120 GAAGATCACTTGAACCCAGGAGG - Intergenic
1072598697 10:96901857-96901879 TAAGATCACTTGAACCCAGGAGG - Intronic
1072698564 10:97622603-97622625 AAGGATCGCTTGAACCCAGGAGG + Intronic
1073222157 10:101883901-101883923 AAGGATCACTTGAACCCAGGAGG + Intronic
1073359053 10:102882677-102882699 AGAATCGGCTTGAACCCAGGAGG - Intronic
1073359190 10:102883622-102883644 AGAATCGGCTTGAACCCAGGAGG + Intronic
1073367900 10:102959035-102959057 AAGGACCACTTGAGCCCAGGAGG - Intronic
1073393564 10:103199441-103199463 GATGACCACTTGAACCCAGGAGG + Intergenic
1073506315 10:103995514-103995536 AAGAATCCCTTGAACCCAGGAGG - Intronic
1073749212 10:106504984-106505006 CAAGATCCCTTGAGCCCAGGAGG - Intergenic
1074070182 10:110059677-110059699 AAGGATCGCTTGAACCCAGGAGG + Intronic
1074266729 10:111911573-111911595 AAGATCCCCTTGAACCTGGGAGG + Intergenic
1074491959 10:113946400-113946422 AAGAACCCCTTGAACCCAGGAGG + Intergenic
1074518720 10:114197745-114197767 AAGGATCGCTTGAACCCAGGAGG - Intronic
1074980599 10:118616778-118616800 GAAGATCACTTGAACCCAGGAGG + Intergenic
1075127824 10:119714937-119714959 GAAGATCACTTGAACCCAGGAGG - Intergenic
1075156715 10:119983632-119983654 GAAGATCCCTTGAGCCCAGGAGG - Intergenic
1075332180 10:121581660-121581682 GAAGACCGCTTGAGCCCAGGAGG + Intronic
1075434438 10:122423333-122423355 AGAATTGCCTTGAACCCAGGAGG + Intronic
1075570678 10:123540022-123540044 AAAATTCCCATGAACCAAGGTGG + Intergenic
1076102172 10:127791641-127791663 AAAAATCGCTTGAACCCAGGAGG - Intergenic
1076121186 10:127937767-127937789 AAGGATCGCTTGAACCCAGGAGG + Intronic
1076430739 10:130400261-130400283 GAGGATCCCTTGAACCCAGGAGG - Intergenic
1077069861 11:664121-664143 AAGAATCCCTTGAACCCAGGAGG + Intronic
1077083772 11:737195-737217 GAAGATCCCTTGAACCCAGGAGG - Intergenic
1077161969 11:1117797-1117819 AAGGATCACTTGAACCCAGGAGG + Intergenic
1077618879 11:3701347-3701369 GAATCGCCCTTGAACCCAGGAGG - Intronic
1077625453 11:3767418-3767440 AGAATAGCCTTGAACCCAGGGGG - Intronic
1077656893 11:4028170-4028192 AAAGAAGCCTTGAATCCAGGAGG - Intronic
1077808344 11:5611541-5611563 GAGGTTCGCTTGAACCCAGGAGG - Exonic
1077904735 11:6521804-6521826 AAAGATCACTTGAGCCCAGGAGG - Intronic
1077927452 11:6695953-6695975 AAGGATCCCTTGAGCCCAGGAGG - Intergenic
1077947340 11:6915139-6915161 AAAAATCACTTGAACCCAGGAGG - Intergenic
1077998428 11:7473902-7473924 AAAGTCCTCTTAAGCCCAGAAGG - Intergenic
1078175770 11:8968582-8968604 TAAGAATCCTTGAACCCAGGAGG + Intergenic
1078218794 11:9334422-9334444 AAGATTCACTTGAACCCAGGAGG + Intergenic
1079064057 11:17274464-17274486 AAGAACCACTTGAACCCAGGAGG + Intronic
1079185444 11:18231970-18231992 GGAGATCCCTTGAACCCAGGAGG - Intronic
1079646694 11:22871870-22871892 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1080108792 11:28542089-28542111 AAATTCCACTTAAACCCAAGAGG + Intergenic
1080474392 11:32576019-32576041 GGAGACCGCTTGAACCCAGGAGG + Intergenic
1080555768 11:33415921-33415943 TAAGTCCGCTTGAATCCAGGAGG - Intergenic
1081086566 11:38809512-38809534 AAAGTCCCTTTGTACTGAGGGGG + Intergenic
1081131363 11:39384041-39384063 AAAAATCACTTGAACCCAGGAGG + Intergenic
1081210078 11:40322333-40322355 GAGGATCCCTTGAACCCAGGAGG - Intronic
1081211648 11:40342377-40342399 GAGGATCCCTTGAACCCAGGAGG + Intronic
1081519243 11:43865582-43865604 GAGGTTCACTTGAACCCAGGAGG + Intergenic
1081725517 11:45324857-45324879 AAAAATCCCTTGAACCCAGGAGG + Intergenic
1081896342 11:46590248-46590270 GTAGTCCACTTGAACCCAGGAGG + Intronic
1081922366 11:46790730-46790752 GAAGATCCCTTGAGCCCAGGAGG - Intronic
1081982295 11:47275379-47275401 AAGGATCACTTGAACCCAGGAGG - Intronic
1082026266 11:47574762-47574784 AAAAATCGCTTGAACCCAGGAGG + Intronic
1082050275 11:47765721-47765743 AAGGATCGCTTGAACCCAGGAGG + Intronic
1082063713 11:47881881-47881903 GAGGATCCCTTGAACCCAGGAGG + Intergenic
1082106365 11:48226100-48226122 AAAAATCGCTTGAACCCAGGAGG - Intergenic
1082259238 11:50064805-50064827 CAGGATCCCTTGAACCCAGGAGG - Intergenic
1082264533 11:50105044-50105066 AAAAATCCCTTGAGCCCAGGAGG + Intergenic
1082851687 11:57770561-57770583 AAGAATCCCTTGAACCCAGGAGG + Intronic
1082859041 11:57836116-57836138 GAGGATCCCTTGAACCCAGGAGG + Intergenic
1083240755 11:61386499-61386521 AGAATTCCTTTGAACCCAGGAGG + Intergenic
1083425071 11:62579752-62579774 AGAGACAGCTTGAACCCAGGAGG - Intronic
1083676539 11:64328829-64328851 GAAGATCACTTGAACCCAGGAGG - Intergenic
1083925320 11:65802577-65802599 AGAGATCGCTTGAACCCAGGAGG + Intergenic
1084184873 11:67466256-67466278 GAAAATCCCTTGAACCCAGGAGG + Intronic
1084203180 11:67575975-67575997 AGAATCGCTTTGAACCCAGGAGG + Intergenic
1084538272 11:69770980-69771002 AAAGACCCCTGGAAGACAGGGGG + Intergenic
1084604795 11:70166226-70166248 GAGAACCCCTTGAACCCAGGAGG + Intronic
1084635427 11:70389160-70389182 AAAGATCGCTTGAGCCCAGGAGG + Intergenic
1084883155 11:72186536-72186558 GAAGATCACTTGAACCCAGGAGG - Intergenic
1084898164 11:72290853-72290875 AGAATCACTTTGAACCCAGGAGG + Intergenic
1084922369 11:72481430-72481452 GAAGACTCCTTGAGCCCAGGAGG - Intergenic
1085647068 11:78231436-78231458 AGAATCGCTTTGAACCCAGGAGG - Intronic
1085652650 11:78282394-78282416 TAAATCCGCTTGAACCCAGGAGG - Intronic
1086369698 11:86144126-86144148 AAAAATCACTTGAACCCAGGAGG - Intergenic
1086694973 11:89832823-89832845 AAAAATCGCTTGAACCCAGGAGG + Intergenic
1086711175 11:90011673-90011695 AAAAATCGCTTGAACCCAGGAGG - Intergenic
1087111701 11:94476808-94476830 AAGAATCCCTTGAACCCAGGAGG - Intronic
1087717878 11:101629874-101629896 GAAGATCGCTTGAACCCAGGAGG + Intronic
1088055369 11:105569702-105569724 GAGGATCCCTTGAACCCAGGAGG + Intergenic
1088474548 11:110221506-110221528 AAGGATCGCTTGAACCCAGGAGG + Intronic
1088488746 11:110366490-110366512 AAAGTCTCCTTGTCCCCAGAAGG - Intergenic
1088635483 11:111816347-111816369 GAAGATCACTTGAACCCAGGAGG - Intronic
1088643478 11:111896581-111896603 AAGGACCCCTTGCATCCAGGAGG - Intergenic
1088871490 11:113894003-113894025 AAGGACCATTTGAACCCAGGGGG - Intergenic
1089423717 11:118352124-118352146 GAGGACCACTTGAACCCAGGAGG + Intronic
1089509099 11:118984622-118984644 GAAGATCACTTGAACCCAGGAGG + Intergenic
1089715764 11:120357657-120357679 AAGAATCCCTTGAACCCAGGAGG - Intronic
1089724169 11:120459796-120459818 GAGGATCCCTTGAACCCAGGGGG - Intronic
1089948705 11:122505616-122505638 AAAGTCGCCTTGACCCAAAGGGG + Intergenic
1089994791 11:122896251-122896273 AAATTTGGCTTGAACCCAGGTGG + Intronic
1091226315 11:133958320-133958342 AAAGTGGCCTTGAACACCGGAGG + Intergenic
1091251432 11:134147362-134147384 AAGGATCCCTTGAACCCGGGAGG + Intronic
1091265096 11:134264253-134264275 GAAGATCGCTTGAACCCAGGAGG + Intronic
1091484095 12:867031-867053 AAGAATCCCTTGAACCCAGGAGG + Intronic
1091610396 12:2002939-2002961 AAATTCCCCTGGAAACTAGGGGG + Intronic
1091909667 12:4219398-4219420 AAGGATCACTTGAACCCAGGAGG - Intergenic
1092133310 12:6127622-6127644 GAGGACCCCTTGAGCCCAGGAGG + Intergenic
1092247408 12:6871430-6871452 AAATTCCCCTTTCAGCCAGGTGG - Intronic
1092248812 12:6880018-6880040 AAGAACCACTTGAACCCAGGAGG + Intronic
1092250652 12:6893835-6893857 AAAAATCGCTTGAACCCAGGAGG + Intronic
1092344187 12:7701917-7701939 GAAAATCCCTTGAACCCAGGAGG + Intergenic
1092537176 12:9401010-9401032 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1092557499 12:9572302-9572324 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1092595824 12:10003824-10003846 AAGGTTCACTTGAGCCCAGGAGG + Intronic
1092661995 12:10748434-10748456 AAAGACTGCTTGAGCCCAGGAGG - Intergenic
1092878521 12:12869674-12869696 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1092882370 12:12897696-12897718 AAAAACCGCTTGAACCCAGGAGG - Intronic
1092931962 12:13324367-13324389 GAAGATCACTTGAACCCAGGAGG - Intergenic
1092968878 12:13672429-13672451 AAAGTCCCCTTGGTCCAGGGAGG - Intronic
1093317360 12:17667512-17667534 AAGGATCGCTTGAACCCAGGAGG - Intergenic
1093460995 12:19406589-19406611 AGAATTCGCTTGAACCCAGGAGG + Intronic
1093470227 12:19493309-19493331 AAAAATCACTTGAACCCAGGAGG + Intronic
1093616054 12:21226322-21226344 AAGAATCCCTTGAACCCAGGAGG + Intronic
1093834304 12:23807728-23807750 AGAATTCACTTGAACCCAGGAGG - Intronic
1093894050 12:24557296-24557318 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1094001393 12:25698495-25698517 AAAGATCACTTGAGCCCAGGAGG + Intergenic
1094165840 12:27442708-27442730 AAAGATCACTTGAGCCCAGGAGG - Intergenic
1094562141 12:31565302-31565324 AAAGATCGCTTGAGCCCAGGAGG + Intronic
1094563034 12:31573863-31573885 GAAGATCCCTTGAGCCCAGGAGG + Intronic
1094611379 12:31998598-31998620 AAGGATCACTTGAACCCAGGAGG + Intergenic
1094653261 12:32398336-32398358 TAAGATCCCTTGAGCCCAGGAGG + Intergenic
1094673045 12:32589785-32589807 TAACTCTCCTTGAACCCAGGAGG + Intronic
1094687680 12:32734717-32734739 AGAATCAACTTGAACCCAGGAGG + Intronic
1095093995 12:38135102-38135124 AGGATCCACTTGAACCCAGGAGG + Intergenic
1095767845 12:45916371-45916393 AAAGATCACTTGAGCCCAGGAGG + Intergenic
1095892091 12:47244385-47244407 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1096011521 12:48220627-48220649 AAGGACCACTTGAGCCCAGGAGG + Intergenic
1096059453 12:48684394-48684416 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1096076611 12:48809788-48809810 GAGGATCCCTTGAACCCAGGAGG + Intergenic
1096079814 12:48825916-48825938 GAAGATCGCTTGAACCCAGGAGG - Intronic
1096298468 12:50404664-50404686 AAAAACTGCTTGAACCCAGGAGG - Intronic
1096322907 12:50631216-50631238 AAAAATCGCTTGAACCCAGGAGG - Intronic
1096646914 12:53043786-53043808 AAGGATCACTTGAACCCAGGAGG + Intergenic
1096689536 12:53311348-53311370 AGAATTCACTTGAACCCAGGAGG - Intronic
1096697580 12:53360109-53360131 AAAGATCACTTGAGCCCAGGAGG + Intergenic
1096910830 12:54982121-54982143 AAACTCCACCTCAACCCAGGTGG + Intronic
1096989214 12:55785684-55785706 AAAAATCACTTGAACCCAGGAGG + Intronic
1097005869 12:55917328-55917350 AGAGATCACTTGAACCCAGGAGG + Intronic
1097012057 12:55960119-55960141 AAGGATCACTTGAACCCAGGAGG + Intronic
1097094487 12:56535403-56535425 AAGGATCACTTGAACCCAGGAGG + Intronic
1097241332 12:57577504-57577526 AAGGATCCCTTGAGCCCAGGAGG + Intronic
1097419179 12:59352767-59352789 AAAGTCCCCTAGAAAGCAGGTGG - Intergenic
1097668393 12:62507856-62507878 AAGGAACACTTGAACCCAGGAGG - Intronic
1098227289 12:68337776-68337798 AAGAACCGCTTGAACCCAGGAGG + Intergenic
1098284332 12:68892767-68892789 AAGAATCCCTTGAACCCAGGAGG + Intronic
1098561281 12:71875885-71875907 AAAAATCGCTTGAACCCAGGAGG - Intronic
1099719172 12:86338867-86338889 AAGAACCGCTTGAACCCAGGTGG + Intronic
1099792235 12:87350398-87350420 CCAGTCCCCTTGATCCCAGATGG + Intergenic
1099883502 12:88498782-88498804 AAAACCCCCTTCAACCCAGGAGG + Intronic
1099962754 12:89412585-89412607 AGAATCCGCTTGAACCCGGGAGG + Intergenic
1100054720 12:90494937-90494959 AAAGATCACTTGAACCCAGGAGG + Intergenic
1100077385 12:90802390-90802412 AAAAATCACTTGAACCCAGGAGG - Intergenic
1100077431 12:90802707-90802729 GAAAACCGCTTGAACCCAGGAGG - Intergenic
1100166932 12:91926425-91926447 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1100254750 12:92871968-92871990 AAGAACCCCTTGAACCCCGGAGG - Intronic
1100307557 12:93364992-93365014 GAGGATCCCTTGAACCCAGGAGG - Intergenic
1100314780 12:93434993-93435015 GAAGATCCCTTGAATCCAGGAGG - Intronic
1100332771 12:93600876-93600898 AAGGACCCCTTGAGCCCAGGAGG - Intergenic
1100332822 12:93601362-93601384 GAAAATCCCTTGAACCCAGGAGG - Intergenic
1100360721 12:93877421-93877443 AAAGTCCCCCAGACACCAGGTGG + Intronic
1100490812 12:95076165-95076187 AAGAACCTCTTGAACCCAGGTGG - Intergenic
1100634128 12:96418653-96418675 AGAATCCGCTTGAACTCAGGAGG - Intergenic
1100810459 12:98332199-98332221 GAAAATCCCTTGAACCCAGGAGG + Intergenic
1100968480 12:100040594-100040616 AAGAATCCCTTGAACCCAGGAGG + Intronic
1101350071 12:103921500-103921522 AAAAACTGCTTGAACCCAGGAGG + Intergenic
1101528633 12:105554866-105554888 ACTGTCTCATTGAACCCAGGTGG + Intergenic
1101690592 12:107076523-107076545 AGAATCACCTTGAACCCAGGAGG + Intronic
1101872126 12:108574656-108574678 AAGAACCACTTGAACCCAGGAGG - Intergenic
1101951622 12:109180540-109180562 AGAGTTCCCTTTAACCCAAGAGG - Intronic
1102248963 12:111372842-111372864 AAGAACCGCTTGAACCCAGGAGG - Intergenic
1102258946 12:111431669-111431691 AAGATCACCTTGAGCCCAGGAGG - Intronic
1102502601 12:113362872-113362894 GAAGATCACTTGAACCCAGGAGG - Intronic
1102594642 12:113983058-113983080 GAGGACCCCTTGAGCCCAGGAGG + Intergenic
1102690396 12:114755993-114756015 GAAGATCCCTTGAGCCCAGGAGG + Intergenic
1102698145 12:114815997-114816019 AAGGATCACTTGAACCCAGGAGG - Intergenic
1102818692 12:115889402-115889424 AAAGATCACTTGAGCCCAGGAGG + Intergenic
1102818828 12:115890721-115890743 GAGGTTCACTTGAACCCAGGAGG + Intergenic
1103080616 12:118021299-118021321 GAAGATCGCTTGAACCCAGGAGG - Intronic
1103213953 12:119187442-119187464 ACGGACCGCTTGAACCCAGGAGG - Intronic
1103344238 12:120238617-120238639 AAAGTCCCCATGTACACACGTGG + Intronic
1103382834 12:120508083-120508105 GAAAATCCCTTGAACCCAGGAGG - Intronic
1103426610 12:120840854-120840876 AAACATCGCTTGAACCCAGGGGG + Intronic
1103525237 12:121563223-121563245 CAAGATCACTTGAACCCAGGAGG + Intronic
1103528772 12:121585238-121585260 AAGAACCGCTTGAACCCAGGAGG + Intergenic
1103635942 12:122305339-122305361 AAGGATCCCTTGAGCCCAGGAGG + Intronic
1104006194 12:124894320-124894342 GAGGTTCACTTGAACCCAGGAGG + Intergenic
1104205376 12:126633910-126633932 AAAAATCACTTGAACCCAGGAGG - Intergenic
1105015259 12:132782784-132782806 AAGGATCGCTTGAACCCAGGAGG + Intronic
1105067387 12:133212777-133212799 AAGGATCCCTTGAGCCCAGGAGG - Intergenic
1105304041 13:19156920-19156942 AAGGATCCCTTGAACCCAGGAGG - Intergenic
1105763975 13:23540140-23540162 AATTTCTCATTGAACCCAGGAGG + Intergenic
1105832521 13:24176851-24176873 AAGAAGCCCTTGAACCCAGGAGG - Intronic
1105894090 13:24703753-24703775 GAGGATCCCTTGAACCCAGGAGG - Intronic
1105894116 13:24703928-24703950 GAGGATCCCTTGAACCCAGGAGG - Intronic
1105999264 13:25704427-25704449 GAAGATCGCTTGAACCCAGGAGG - Intronic
1106079789 13:26490579-26490601 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1106601296 13:31189169-31189191 AAGAACCGCTTGAACCCAGGAGG + Intergenic
1106627944 13:31440591-31440613 AAGAACCACTTGAACCCAGGAGG - Intergenic
1106724063 13:32466475-32466497 AAGAATCCCTTGAACCCAGGAGG + Intronic
1107007362 13:35628826-35628848 GAAGATCACTTGAACCCAGGAGG + Intronic
1107298556 13:38940991-38941013 AAAAATCACTTGAACCCAGGAGG + Intergenic
1107571180 13:41660203-41660225 AAAGTTCACTTGAACCTGGGAGG - Intronic
1107897931 13:44984550-44984572 AAGGATCCCTTGAACCCAGGAGG + Intronic
1108010725 13:46006003-46006025 AAGAACCGCTTGAACCCAGGAGG + Intronic
1108037059 13:46301866-46301888 GAAGATCCCTTGAATCCAGGAGG - Intergenic
1108077138 13:46693059-46693081 GAGAACCCCTTGAACCCAGGAGG - Intronic
1108139094 13:47399407-47399429 AAAAATCACTTGAACCCAGGAGG + Intergenic
1108180919 13:47839145-47839167 AAGGATCACTTGAACCCAGGAGG - Intergenic
1108200495 13:48038367-48038389 AAAAATCGCTTGAACCCAGGAGG - Intronic
1108350651 13:49587887-49587909 AAAAATCACTTGAACCCAGGAGG + Intergenic
1108487260 13:50939428-50939450 AAAGATCACTTGAGCCCAGGAGG + Intronic
1108616528 13:52138839-52138861 GAAGATCCCTTGAGCCCAGGAGG + Intronic
1108903734 13:55445282-55445304 GAAGATCACTTGAACCCAGGAGG + Intergenic
1109029520 13:57175156-57175178 ATAGTCCCATTAAAGCCAGGAGG - Intergenic
1109059241 13:57592683-57592705 GAGGATCCCTTGAACCCAGGAGG - Intergenic
1109143391 13:58745506-58745528 AAAAATCACTTGAACCCAGGAGG - Intergenic
1109316818 13:60758987-60759009 AAAGTGCCCTTGAAATCAGTGGG - Intergenic
1109706117 13:66094708-66094730 GAAGATCGCTTGAACCCAGGAGG + Intergenic
1110097602 13:71548824-71548846 AAGGATCACTTGAACCCAGGAGG + Intronic
1110421526 13:75314888-75314910 AAGGTTCTCTTGAACCCGGGAGG + Intronic
1110538386 13:76679236-76679258 AGAATCACTTTGAACCCAGGAGG - Intergenic
1110762305 13:79244084-79244106 GAAATTCGCTTGAACCCAGGAGG + Intergenic
1110911506 13:80971603-80971625 GAAAATCCCTTGAACCCAGGAGG - Intergenic
1110985211 13:81957818-81957840 AAAAATCGCTTGAACCCAGGAGG + Intergenic
1111223483 13:85238206-85238228 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1111420396 13:88003581-88003603 AAGAACCACTTGAACCCAGGAGG - Intergenic
1111567515 13:90035114-90035136 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1111946141 13:94667846-94667868 GAAGATCGCTTGAACCCAGGAGG + Intergenic
1112172963 13:96993307-96993329 GAGGATCCCTTGAACCCAGGAGG - Intronic
1112226404 13:97544977-97544999 AAGGATCACTTGAACCCAGGAGG - Intergenic
1112407795 13:99136502-99136524 AAAGCCCCGTTGAACCCTGCCGG + Intergenic
1113061656 13:106328915-106328937 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1113329513 13:109314875-109314897 AGAATCACTTTGAACCCAGGAGG - Intergenic
1113985958 13:114315924-114315946 AAGAATCCCTTGAACCCAGGGGG - Intronic
1114050610 14:18917506-18917528 AATAATCCCTTGAACCCAGGAGG + Intergenic
1114111945 14:19484425-19484447 AATAATCCCTTGAACCCAGGAGG - Intergenic
1114286809 14:21252398-21252420 AAGGATCCCTTGAACTCAGGAGG - Intronic
1114302121 14:21387542-21387564 AAAAATCGCTTGAACCCAGGAGG + Intronic
1114380126 14:22194365-22194387 AAAATCCACTAGAACCCAGAGGG - Intergenic
1114713272 14:24799877-24799899 GAAGATCACTTGAACCCAGGAGG - Intergenic
1115084397 14:29496246-29496268 AAGATTCACTTGAACCCAGGAGG - Intergenic
1115209560 14:30952026-30952048 AAGGATCGCTTGAACCCAGGAGG + Intronic
1115215400 14:31008947-31008969 AAGGACCACTTGAGCCCAGGAGG + Intronic
1115269011 14:31531217-31531239 AGAATTCACTTGAACCCAGGAGG - Intronic
1115546770 14:34471235-34471257 GAGGATCCCTTGAACCCAGGAGG + Intergenic
1115548033 14:34480526-34480548 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1115554029 14:34529924-34529946 AAAAACTGCTTGAACCCAGGAGG + Intronic
1115565228 14:34619330-34619352 AAGGATCACTTGAACCCAGGAGG + Intronic
1115683950 14:35774001-35774023 GAGGATCCCTTGAACCCAGGAGG - Intronic
1115776013 14:36715999-36716021 AAGAATCCCTTGAACCCAGGAGG + Intronic
1115994630 14:39183775-39183797 GAGGATCCCTTGAACCCAGGAGG - Intergenic
1116258472 14:42588770-42588792 AAAAACCGCGTGAACCCAGGAGG - Intergenic
1116990682 14:51273149-51273171 GAAGATCACTTGAACCCAGGAGG - Intergenic
1116998943 14:51352634-51352656 AAGGACCGCTTGAACCCGGGAGG + Intergenic
1117157770 14:52957749-52957771 GAGATTCCCTTGAACCCAGGAGG + Intergenic
1117190426 14:53284890-53284912 AGAATCGGCTTGAACCCAGGAGG + Intergenic
1117220925 14:53604559-53604581 AGAGTCGTCTTGAACCCGGGAGG + Intergenic
1117365437 14:55022590-55022612 AAAAATCGCTTGAACCCAGGAGG + Intronic
1117595075 14:57319042-57319064 GAGGACCGCTTGAACCCAGGAGG + Intergenic
1118164910 14:63326605-63326627 AAGGATCCCTTGAGCCCAGGAGG + Intergenic
1118187758 14:63552624-63552646 AAAGGTCACTTGAACCCAGGAGG + Intergenic
1118197676 14:63642460-63642482 AGAGTTCCCTAGAGCCCAGGCGG - Intergenic
1118198418 14:63649486-63649508 AGAATCCGCTTGAACCAAGGAGG + Intergenic
1118300312 14:64609162-64609184 GAAGATCACTTGAACCCAGGAGG + Intergenic
1118564114 14:67120034-67120056 GAAGATCGCTTGAACCCAGGGGG + Intronic
1118633998 14:67731302-67731324 GAGGATCCCTTGAACCCAGGAGG - Intronic
1118758461 14:68862881-68862903 GGAGATCCCTTGAACCCAGGAGG - Intergenic
1118879090 14:69810986-69811008 GAGGATCCCTTGAACCCAGGAGG + Intergenic
1118939575 14:70320199-70320221 AAAAATCGCTTGAACCCAGGAGG - Intergenic
1119292785 14:73508933-73508955 AGAGTCAGCTTGAGCCCAGGGGG - Intronic
1119303010 14:73585598-73585620 AGAGTCACTTGGAACCCAGGAGG + Intergenic
1119340674 14:73874946-73874968 GAAGATCACTTGAACCCAGGAGG - Intronic
1119448840 14:74690168-74690190 AAGGATCCCTTGAGCCCAGGAGG + Intronic
1119665112 14:76479955-76479977 AAGGATCGCTTGAACCCAGGAGG - Intronic
1119873736 14:78038523-78038545 GAGGTTCACTTGAACCCAGGAGG - Intergenic
1120183895 14:81372463-81372485 AAGAACCGCTTGAACCCAGGAGG + Intronic
1120612946 14:86665063-86665085 GAGGACCCCTTGAGCCCAGGAGG + Intergenic
1120650674 14:87128993-87129015 GAAGATCACTTGAACCCAGGAGG + Intergenic
1120741711 14:88116058-88116080 AAAAATCGCTTGAACCCAGGAGG - Intergenic
1120872218 14:89347862-89347884 AAGAATCCCTTGAACCCAGGAGG + Intronic
1121074534 14:91056967-91056989 GAGGTTCTCTTGAACCCAGGAGG - Intronic
1121087674 14:91158917-91158939 AAGGACCACTTGATCCCAGGAGG - Intronic
1121116241 14:91344884-91344906 AAGGATCACTTGAACCCAGGAGG - Intronic
1121733147 14:96200381-96200403 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1122233604 14:100319805-100319827 CAATTCTCCTTGAACCAAGGAGG - Intergenic
1122423079 14:101589649-101589671 AGAGTCCCCTAGAACCAAGCTGG + Intergenic
1122538214 14:102481100-102481122 GAGGACCACTTGAACCCAGGAGG - Intronic
1123430859 15:20215183-20215205 AAGGATCCCTTGAGCCCAGGAGG - Intergenic
1123812021 15:23936780-23936802 AAAGATCGCTTGAGCCCAGGAGG + Intergenic
1124117392 15:26858720-26858742 AAGAATCCCTTGAACCCAGGAGG - Intronic
1124877576 15:33609561-33609583 AAGGATCACTTGAACCCAGGAGG + Intronic
1124944177 15:34247792-34247814 AAAGATCACTTGAACCCAGGAGG - Intronic
1124945215 15:34259249-34259271 AGAATCAGCTTGAACCCAGGAGG + Intronic
1125417793 15:39471370-39471392 GAGGACCCCTTGAATCCAGGAGG + Intergenic
1125779893 15:42255857-42255879 GAGGATCCCTTGAACCCAGGAGG - Intronic
1125876793 15:43155138-43155160 AGAATCCACTTGAGCCCAGGAGG + Intronic
1126040519 15:44586072-44586094 GAGGATCCCTTGAACCCAGGAGG - Intronic
1126601648 15:50434190-50434212 AAAAATCGCTTGAACCCAGGAGG - Intronic
1126601699 15:50434704-50434726 AAAAATCACTTGAACCCAGGAGG - Intronic
1127272325 15:57412947-57412969 AGAAATCCCTTGAACCCAGGAGG - Intronic
1127413160 15:58729870-58729892 AAGAACCGCTTGAACCCAGGAGG + Intronic
1127421004 15:58805982-58806004 ATGGAACCCTTGAACCCAGGAGG + Intronic
1127422743 15:58823573-58823595 AAAGATCACTTGAGCCCAGGAGG + Intronic
1127728747 15:61778472-61778494 GAAGATCCCTTGAGCCCAGGAGG + Intergenic
1128018910 15:64372875-64372897 AAAAATCGCTTGAACCCAGGAGG + Intronic
1128031960 15:64489012-64489034 GAGGATCCCTTGAACCCAGGAGG + Intronic
1128181385 15:65608265-65608287 GAAGATCCCTTGAACACAGGAGG + Intronic
1128430531 15:67588903-67588925 AAGGACCACTTGAGCCCAGGAGG - Intronic
1128918491 15:71589443-71589465 GAGGATCCCTTGAACCCAGGAGG - Intronic
1129066437 15:72908325-72908347 AGAATTCGCTTGAACCCAGGAGG - Intergenic
1129284009 15:74509205-74509227 GAAGACCACTTGAGCCCAGGAGG - Intergenic
1129356124 15:74993223-74993245 AAGAATCCCTTGAACCCAGGAGG - Intronic
1129508849 15:76105154-76105176 AAAAATCGCTTGAACCCAGGAGG + Intronic
1129856599 15:78829575-78829597 AAGGATCACTTGAACCCAGGAGG + Intronic
1129983028 15:79891876-79891898 AAGGATCACTTGAACCCAGGAGG + Intronic
1129989159 15:79947117-79947139 GAGGACCACTTGAACCCAGGAGG + Intergenic
1130178003 15:81594967-81594989 AGGGTTCACTTGAACCCAGGAGG + Intergenic
1130231085 15:82097495-82097517 AAGGTTCGCTTGAGCCCAGGAGG - Intergenic
1130455487 15:84102450-84102472 AAAAATCACTTGAACCCAGGAGG - Intergenic
1130553571 15:84907593-84907615 GAAGTTCCCTTGATTCCAGGAGG - Intronic
1130561294 15:84961419-84961441 GAAGATCCCTTGAGCCCAGGAGG - Intergenic
1130570071 15:85034773-85034795 GAGGTTCACTTGAACCCAGGAGG - Intronic
1130645140 15:85718808-85718830 AAAGATCGCTTGAGCCCAGGAGG + Intronic
1131031391 15:89188787-89188809 AAAGATCGCTTGAGCCCAGGAGG + Intronic
1131051421 15:89350653-89350675 AAGAACCACTTGAACCCAGGAGG - Intergenic
1131093423 15:89640911-89640933 AAGGATCACTTGAACCCAGGAGG + Intronic
1131183136 15:90254101-90254123 GGAGTTCACTTGAACCCAGGAGG + Intronic
1131197645 15:90368831-90368853 AAGAACCACTTGAACCCAGGAGG - Intronic
1131218348 15:90559102-90559124 AAAGCACCCTTGCTCCCAGGGGG - Intronic
1131230151 15:90653812-90653834 GAAGACCACTTGAGCCCAGGAGG - Intergenic
1131237051 15:90705803-90705825 AAGGATCACTTGAACCCAGGAGG + Intergenic
1131380174 15:91956877-91956899 AAGATTCGCTTGAACCCAGGAGG - Intronic
1131412249 15:92219413-92219435 AGAATTCGCTTGAACCCAGGAGG - Intergenic
1131516366 15:93080286-93080308 AAGGATCGCTTGAACCCAGGAGG - Intronic
1132253838 15:100356474-100356496 AAGAACCACTTGAACCCAGGAGG + Intergenic
1132497113 16:269138-269160 AGTGTCCCCTTGTGCCCAGGGGG - Exonic
1132520781 16:387360-387382 GAAGATCCCTTGAGCCCAGGAGG + Intergenic
1132538049 16:493159-493181 GAGGTTCACTTGAACCCAGGAGG + Intronic
1132711000 16:1267429-1267451 GAAGACCACTTGACCCCAGGAGG + Intergenic
1132735683 16:1384686-1384708 GAGGATCCCTTGAACCCAGGAGG - Intronic
1132874956 16:2132990-2133012 AAAAAGCGCTTGAACCCAGGAGG + Intronic
1133163135 16:3925590-3925612 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1133170826 16:3981680-3981702 AGAATCAACTTGAACCCAGGAGG - Intronic
1133252492 16:4492627-4492649 GAAAATCCCTTGAACCCAGGAGG + Intronic
1133308832 16:4829574-4829596 GAAGATCACTTGAACCCAGGAGG - Intronic
1133422983 16:5663298-5663320 AAAGACCTCTTGAACCCAGGAGG - Intergenic
1133605725 16:7385841-7385863 AAAAACTGCTTGAACCCAGGAGG - Intronic
1133795086 16:9039577-9039599 GAAGATCCCTTGAGCCCAGGAGG + Intergenic
1133988081 16:10683678-10683700 GAGAACCCCTTGAACCCAGGAGG - Intronic
1134033332 16:11010061-11010083 AAGGATCCCTTGAGCCCAGGAGG + Intronic
1134067789 16:11240411-11240433 AAGAACCACTTGAACCCAGGAGG - Intergenic
1134104192 16:11473943-11473965 GAAGTCCGCTTGAGCCCAGGAGG - Intronic
1134127486 16:11626431-11626453 AAGAATCCCTTGAACCCAGGAGG - Intronic
1134143409 16:11741940-11741962 AAGAACCCCTTGAACCCGGGAGG + Intronic
1134174869 16:11997565-11997587 AAGGATCACTTGAACCCAGGAGG - Intronic
1134206347 16:12241547-12241569 GAAGATCACTTGAACCCAGGAGG - Intronic
1134319064 16:13146098-13146120 GAATTTCCCTTGAACCCGGGAGG + Intronic
1134398006 16:13882963-13882985 AAAGATCACTTGAGCCCAGGAGG + Intergenic
1134528902 16:14966904-14966926 AAGGATCACTTGAACCCAGGAGG + Intergenic
1134664483 16:16008751-16008773 GAGGATCCCTTGAACCCAGGAGG + Intronic
1134697892 16:16239238-16239260 AAAGATCACTTGAGCCCAGGAGG - Intronic
1134792483 16:17001861-17001883 AAAAATCACTTGAACCCAGGAGG - Intergenic
1134852945 16:17496618-17496640 GAAGATCACTTGAACCCAGGAGG - Intergenic
1135092555 16:19530554-19530576 GAGGATCCCTTGAACCCAGGAGG + Intronic
1135143669 16:19943004-19943026 GAAAACCGCTTGAACCCAGGAGG - Intergenic
1135167069 16:20148402-20148424 AAAAACCGCTTGAACCCAGGAGG + Intergenic
1135238307 16:20779332-20779354 GAAGATCGCTTGAACCCAGGAGG + Intronic
1135242259 16:20818556-20818578 AAAAATCGCTTGAACCCAGGTGG - Intronic
1135277853 16:21128767-21128789 GAAGATCGCTTGAACCCAGGAGG + Intronic
1135285219 16:21187448-21187470 AGGGTTCGCTTGAACCCAGGAGG + Intergenic
1135376214 16:21949594-21949616 AAAATCTGCTTGAAACCAGGAGG + Intergenic
1135410287 16:22229047-22229069 AAGAATCCCTTGAACCCAGGAGG + Intronic
1135598933 16:23765150-23765172 GAGGTTCCCTTGAACCCGGGAGG - Intergenic
1135693632 16:24566650-24566672 AGAATTCGCTTGAACCCAGGAGG + Intronic
1135694785 16:24576044-24576066 AGAATCCACTTGAACCCAGGAGG - Intergenic
1135702816 16:24647699-24647721 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1135723938 16:24840139-24840161 AAAAATCACTTGAACCCAGGAGG - Intergenic
1135726032 16:24854517-24854539 AAAGATCGCTTGAACCCGGGAGG - Intronic
1135862432 16:26069039-26069061 AAGGATCACTTGAACCCAGGAGG - Intronic
1135978927 16:27131433-27131455 AAAAGCCGCTTGAACCAAGGAGG - Intergenic
1136097669 16:27969017-27969039 GAGGACCACTTGAACCCAGGAGG + Intronic
1136168820 16:28475158-28475180 GAGGACCCCTTGAGCCCAGGAGG + Intergenic
1136181016 16:28552275-28552297 AAGAACCACTTGAACCCAGGAGG - Intergenic
1136252781 16:29017282-29017304 AAGGATCACTTGAACCCAGGAGG - Intergenic
1136421333 16:30135456-30135478 AAGAACCACTTGAACCCAGGAGG - Intergenic
1136607218 16:31344386-31344408 AAGAACCGCTTGAACCCAGGAGG + Intergenic
1136726930 16:32365386-32365408 GAGGTTCCCTAGAACCCAGGAGG + Intergenic
1136790073 16:32962280-32962302 GAAGTCTGCTTGAATCCAGGAGG + Intergenic
1136846263 16:33578769-33578791 AAGATTCGCTTGAACCCAGGAGG - Intergenic
1136853789 16:33636047-33636069 AAGGACCCCTTGAGCCCAGGAGG + Intergenic
1136879740 16:33891656-33891678 GAAGTCTGCTTGAATCCAGGAGG - Intergenic
1136985947 16:35104958-35104980 AAGATTCACTTGAACCCAGGAGG + Intergenic
1137272383 16:46910463-46910485 AAGGATCGCTTGAACCCAGGAGG + Intronic
1137277771 16:46948137-46948159 GAGGTTCGCTTGAACCCAGGAGG - Intergenic
1137340139 16:47593348-47593370 AAGGATCCCTTGAGCCCAGGAGG + Intronic
1137342879 16:47627291-47627313 AATGGCCACATGAACCCAGGTGG - Intronic
1137424770 16:48368647-48368669 AAGATCGACTTGAACCCAGGAGG + Intronic
1137689197 16:50408971-50408993 AAAGACCACTTGAGCCCAAGAGG - Intergenic
1137992949 16:53178520-53178542 GAAGATCACTTGAACCCAGGAGG - Intronic
1138413425 16:56857505-56857527 GAAGACCACTTGAGCCCAGGAGG - Intergenic
1138569460 16:57859930-57859952 AAAGATGGCTTGAACCCAGGAGG + Intronic
1138671453 16:58618491-58618513 AGAATCAGCTTGAACCCAGGAGG + Intronic
1138873907 16:60926519-60926541 AAAGGCCACTAGAGCCCAGGAGG - Intergenic
1138907344 16:61353289-61353311 AAGAACCACTTGAACCCAGGAGG + Intergenic
1139523913 16:67501461-67501483 AAAAATCGCTTGAACCCAGGAGG + Intergenic
1139617982 16:68112365-68112387 AAGGATCGCTTGAACCCAGGAGG - Intronic
1139665949 16:68456388-68456410 AAGAACCGCTTGAACCCAGGGGG - Intergenic
1139820869 16:69720169-69720191 AAGGATCACTTGAACCCAGGAGG + Intronic
1140000536 16:71020717-71020739 GAAGATCACTTGAACCCAGGAGG + Intronic
1140273840 16:73490745-73490767 AAGGATCACTTGAACCCAGGAGG + Intergenic
1140392642 16:74600640-74600662 AAAAATCACTTGAACCCAGGAGG + Intronic
1140674163 16:77310715-77310737 GAGGATCCCTTGAACCCAGGAGG - Intronic
1140836739 16:78801417-78801439 GAAGGTCACTTGAACCCAGGAGG + Intronic
1141458189 16:84158817-84158839 AAAAATCACTTGAACCCAGGAGG - Intronic
1141942882 16:87290145-87290167 GAAGATCTCTTGAACCCAGGAGG - Intronic
1141994869 16:87630005-87630027 AAAGACCACATGAACCCATGTGG + Intronic
1142313290 16:89326650-89326672 GAAGACCCCTTGGGCCCAGGAGG + Intronic
1142428670 16:90014214-90014236 GAGGATCCCTTGAACCCAGGAGG - Intronic
1202999504 16_KI270728v1_random:152373-152395 GAGGTTCCCTAGAACCCAGGAGG - Intergenic
1203107971 16_KI270728v1_random:1427424-1427446 AAGATTCGCTTGAACCCAGGAGG - Intergenic
1203115375 16_KI270728v1_random:1484487-1484509 AAGGATCCCTTGAGCCCAGGAGG + Intergenic
1203131102 16_KI270728v1_random:1688772-1688794 GAGGTTCCCTAGAACCCAGGAGG - Intergenic
1142633616 17:1242720-1242742 GAGGGTCCCTTGAACCCAGGAGG - Intergenic
1142823946 17:2495603-2495625 AAGAATCCCTTGAACCCAGGAGG + Intronic
1142953261 17:3501861-3501883 AAGGATCACTTGAACCCAGGAGG + Exonic
1143041330 17:4039378-4039400 AAGGATCGCTTGAACCCAGGAGG + Intronic
1143241416 17:5446062-5446084 AAAAATCGCTTGAACCCAGGAGG - Intronic
1143505312 17:7361296-7361318 GAAGATCGCTTGAACCCAGGAGG + Intergenic
1143664941 17:8352095-8352117 AAAAATCACTTGAACCCAGGAGG + Intergenic
1143666753 17:8366809-8366831 GAAGATCCCTTGAACCTAGGAGG - Intergenic
1143699703 17:8649046-8649068 AAAAATCCCTTGAACCCAGGAGG + Intergenic
1143814050 17:9497042-9497064 AAAATCCCCTTGAAACCATTAGG + Intronic
1144124647 17:12191070-12191092 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1144462349 17:15468271-15468293 AAAGTCCCCAAGATGCCAGGAGG + Intronic
1144561173 17:16321328-16321350 AAAAATCACTTGAACCCAGGAGG - Intronic
1144589573 17:16512889-16512911 AAGGACCCCTTGAATCCATGAGG - Intergenic
1144867157 17:18343828-18343850 AAAGATCGCTTGAGCCCAGGAGG + Intronic
1145181383 17:20755815-20755837 AAAGATCGCTTGAGCCCAGGAGG + Intergenic
1145224783 17:21118976-21118998 AAAAACCACTTGAACCCGGGAGG + Intergenic
1145283480 17:21486192-21486214 AAGGATCCCTTGAACCCAGGAGG - Intergenic
1145373676 17:22328062-22328084 AAAAATCACTTGAACCCAGGAGG + Intergenic
1145393980 17:22479308-22479330 GAGGATCCCTTGAACCCAGGAGG + Intergenic
1145873726 17:28299430-28299452 AAGAGTCCCTTGAACCCAGGAGG - Intergenic
1145932139 17:28693370-28693392 AGAATCGGCTTGAACCCAGGAGG + Intronic
1146020907 17:29277920-29277942 AGAGATCGCTTGAACCCAGGAGG + Intronic
1146045267 17:29500222-29500244 TAGGTTCACTTGAACCCAGGAGG + Intronic
1146048567 17:29531366-29531388 AGAATCCCCTTGAACCCGGGAGG - Intronic
1146082338 17:29792010-29792032 AAAAATCACTTGAACCCAGGAGG - Intronic
1146148465 17:30444611-30444633 AAGCATCCCTTGAACCCAGGAGG - Intronic
1146250841 17:31342502-31342524 GAAGATCTCTTGAACCCAGGAGG + Intronic
1146358777 17:32157715-32157737 AGAATCAGCTTGAACCCAGGAGG + Intronic
1146381513 17:32332674-32332696 GAAGACTGCTTGAACCCAGGAGG + Intronic
1146621962 17:34405661-34405683 AAGGATCACTTGAACCCAGGAGG + Intergenic
1146767404 17:35535743-35535765 AAAGATCACTTGAACCCAGGAGG - Intronic
1146900549 17:36583546-36583568 AAAAATCGCTTGAACCCAGGAGG - Intronic
1146979866 17:37150450-37150472 GAAAACCACTTGAACCCAGGAGG + Intronic
1147002899 17:37377568-37377590 AAGAATCCCTTGAACCCAGGAGG + Intronic
1147019889 17:37522728-37522750 AAGCATCCCTTGAACCCAGGAGG - Intronic
1147035263 17:37675226-37675248 AACGATCCCTTGAACCCAGGAGG - Intergenic
1147035336 17:37675713-37675735 AGAATCCACTTGAACTCAGGAGG - Intergenic
1147247221 17:39130361-39130383 GAAGATCCCTTGAGCCCAGGAGG + Intronic
1147361818 17:39935561-39935583 GAAGACGGCTTGAACCCAGGAGG + Intergenic
1147437181 17:40423878-40423900 AAAAATCACTTGAACCCAGGAGG - Intergenic
1147641470 17:42004043-42004065 AGAGAACACTTGAACCCAGGAGG - Intronic
1147678573 17:42224427-42224449 GAAGATCCCTTGAGCCCAGGAGG - Intronic
1147735957 17:42638445-42638467 AAGGACCCCTTAAACCTAGGAGG - Intergenic
1147969672 17:44212611-44212633 CCAGTCCCCTTGCACCCAGGCGG - Intronic
1148054278 17:44784609-44784631 AAAGATCCCTGGAACCCTGGAGG - Intergenic
1148121530 17:45215224-45215246 AAGAACCACTTGAACCCAGGAGG - Intergenic
1148274603 17:46292240-46292262 GAAAACCACTTGAACCCAGGAGG + Intronic
1148411869 17:47474355-47474377 AAGAACCTCTTGAACCCAGGAGG + Intergenic
1148428883 17:47625698-47625720 AGAATCTACTTGAACCCAGGAGG + Intergenic
1148682113 17:49480215-49480237 GAGGATCCCTTGAACCCAGGAGG - Intergenic
1148886945 17:50780831-50780853 AGAATCGCTTTGAACCCAGGAGG - Intergenic
1148946398 17:51265651-51265673 AAGAACCACTTGAACCCAGGAGG - Intronic
1149066040 17:52480205-52480227 AAAGACCCCTTGAGCCCGGGAGG + Intergenic
1149527560 17:57368463-57368485 GGAGAACCCTTGAACCCAGGAGG + Intronic
1149570411 17:57668107-57668129 GAAAACCACTTGAACCCAGGAGG + Intronic
1149675891 17:58461122-58461144 AAGGATTCCTTGAACCCAGGAGG + Intronic
1150067842 17:62126197-62126219 CATGCTCCCTTGAACCCAGGAGG + Intergenic
1150119790 17:62591157-62591179 AAGAATCCCTTGAACCCAGGAGG + Intronic
1150139528 17:62716509-62716531 GAGGATCCCTTGAACCCAGGAGG + Intronic
1150351746 17:64450567-64450589 GAGGATCCCTTGAACCCAGGAGG - Intronic
1150368748 17:64616563-64616585 AAAATCCACTTGAACCCAGGAGG + Intronic
1150405880 17:64900123-64900145 GAAAACCACTTGAACCCAGGAGG - Intronic
1150416602 17:64993722-64993744 GAGAACCCCTTGAACCCAGGAGG + Intergenic
1150582762 17:66490431-66490453 AAAAATCGCTTGAACCCAGGAGG - Intronic
1150812819 17:68370102-68370124 AAAAAACGCTTGAACCCAGGAGG - Intronic
1151329935 17:73400741-73400763 GAAGATCGCTTGAACCCAGGAGG - Intronic
1151546933 17:74799031-74799053 GCAGTGCCCTTGATCCCAGGGGG - Intronic
1151585861 17:75008055-75008077 CAACTTCCCTTGAACTCAGGAGG + Intergenic
1151634486 17:75335987-75336009 AAAGTGCGCTTGAACCCTGCCGG + Intronic
1151639871 17:75383750-75383772 AAGATTCGCTTGAACCCAGGAGG + Intronic
1151675351 17:75594741-75594763 AAAGTGCCTTTGATGCCAGGTGG + Intergenic
1151845677 17:76653210-76653232 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1151914962 17:77111101-77111123 AAGGATCGCTTGAACCCAGGAGG + Intronic
1152097889 17:78282576-78282598 AAAAATCGCTTGAACCCAGGAGG + Intergenic
1152104349 17:78320069-78320091 GAGGACCCCTTGAGCCCAGGAGG + Intergenic
1152478270 17:80532653-80532675 AAAAATCGCTTGAACCCAGGAGG + Intergenic
1152669693 17:81595342-81595364 AAAAATCGCTTGAACCCAGGAGG + Intronic
1153061267 18:997409-997431 GAGGTTCACTTGAACCCAGGCGG + Intergenic
1153215738 18:2819351-2819373 GCAGGCACCTTGAACCCAGGAGG - Intergenic
1153224568 18:2889225-2889247 AAAAATCGCTTGAACCCAGGAGG - Intronic
1153286506 18:3460401-3460423 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1153833864 18:8947177-8947199 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1154060217 18:11053504-11053526 GAAGATCCCTTGATCCCAGGAGG - Intronic
1154988842 18:21580898-21580920 AAAAATCTCTTGAACCCAGGAGG + Intronic
1155007148 18:21739823-21739845 GCGGACCCCTTGAACCCAGGAGG + Intronic
1155027689 18:21957403-21957425 GAAGATCACTTGAACCCAGGAGG - Intergenic
1155188925 18:23412227-23412249 GAGGATCCCTTGAACCCAGGAGG + Intronic
1155207825 18:23576330-23576352 AAGATCAGCTTGAACCCAGGAGG + Intronic
1155384580 18:25263445-25263467 GAAAATCCCTTGAACCCAGGAGG - Intronic
1155421801 18:25664508-25664530 AGAGTGTGCTTGAACCCAGGAGG + Intergenic
1155768546 18:29669089-29669111 AAAAATCTCTTGAACCCAGGAGG + Intergenic
1155951869 18:31922499-31922521 GAAGATCGCTTGAACCCAGGAGG + Intronic
1156049362 18:32913448-32913470 AACCTCCACTTGAACCCAGGAGG + Intergenic
1156059576 18:33057579-33057601 AAGAACCACTTGAACCCAGGAGG - Intronic
1157069247 18:44386702-44386724 AATTTTCCCTGGAACCCAGGGGG + Intergenic
1157346636 18:46842134-46842156 GAAGATCACTTGAACCCAGGAGG + Intronic
1157667098 18:49496975-49496997 GAATTTCACTTGAACCCAGGAGG - Intergenic
1157822979 18:50787488-50787510 GAGATCCACTTGAACCCAGGAGG + Intergenic
1158214143 18:55081587-55081609 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1158555006 18:58467841-58467863 AAGGATCACTTGAACCCAGGAGG - Intergenic
1158643380 18:59221254-59221276 CATGGCCCCTAGAACCCAGGCGG + Intronic
1159175533 18:64829003-64829025 GAAAATCCCTTGAACCCAGGGGG - Intergenic
1159448568 18:68570910-68570932 GAGGTTCCCTTGAGCCCAGGAGG + Intergenic
1159860096 18:73637934-73637956 GAAGTCACCTTCAACACAGGGGG - Intergenic
1159884873 18:73894375-73894397 AAAGATCGCTTGAGCCCAGGAGG + Intergenic
1159961240 18:74557309-74557331 AAGGATCACTTGAACCCAGGAGG - Intronic
1160616491 18:80133920-80133942 AAAGACACCTCGAACCCAGGAGG - Intronic
1160688574 19:449266-449288 AAGGATCGCTTGAACCCAGGAGG + Intronic
1160823840 19:1070418-1070440 AAGAACCACTTGAACCCAGGAGG - Intronic
1160923263 19:1530384-1530406 AGAATCGCTTTGAACCCAGGAGG - Intronic
1161058614 19:2202887-2202909 TCAGTCCCCTTGGAGCCAGGTGG + Intronic
1161175182 19:2837897-2837919 AAGGACCGCTTGAGCCCAGGAGG + Intergenic
1161223456 19:3130549-3130571 GAAGATCGCTTGAACCCAGGAGG + Intergenic
1161245367 19:3248991-3249013 AAAGCCCCCTGGAACCCTGGGGG - Intronic
1161292938 19:3505589-3505611 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1161311609 19:3597539-3597561 GAGGATCCCTTGAACCCAGGAGG + Intronic
1161335599 19:3711285-3711307 AGAATCGCTTTGAACCCAGGAGG - Intronic
1161410905 19:4116837-4116859 AGAGAATCCTTGAACCCAGGAGG + Intronic
1161417227 19:4154159-4154181 GAAGATCTCTTGAACCCAGGAGG - Intronic
1161417279 19:4154457-4154479 GAGGATCCCTTGAACCCAGGAGG - Intronic
1161429131 19:4220984-4221006 GAAGATCGCTTGAACCCAGGAGG - Intronic
1161491449 19:4564239-4564261 GAAGATCGCTTGAACCCAGGAGG - Intergenic
1161564114 19:4990198-4990220 AAGGATCGCTTGAACCCAGGAGG + Intronic
1161617275 19:5278564-5278586 AGAGTCCACTTGAACCCAGGAGG - Intronic
1161858784 19:6782238-6782260 AAGAATCCCTTGAACCCAGGAGG + Intronic
1162025704 19:7892912-7892934 GAAAACCCCTTGAACCCGGGAGG - Intronic
1162089752 19:8271375-8271397 AAGGATCGCTTGAACCCAGGAGG + Intronic
1162177970 19:8846018-8846040 GAAGATCCCTTGAGCCCAGGAGG - Intergenic
1162275877 19:9654549-9654571 AAGAACCGCTTGAACCCAGGAGG - Intronic
1162355068 19:10178165-10178187 AAAAATCACTTGAACCCAGGAGG + Intronic
1162400253 19:10441777-10441799 AAGAATCCCTTGAACCCAGGAGG - Intronic
1162449598 19:10746824-10746846 GAAAACCGCTTGAACCCAGGAGG - Intronic
1162476961 19:10906036-10906058 AGAATCGCCTTGAACCCGGGAGG - Intronic
1162477700 19:10910978-10911000 AAAAATCGCTTGAACCCAGGAGG - Intronic
1162738862 19:12762391-12762413 GAAAATCCCTTGAACCCAGGAGG + Intergenic
1162746082 19:12799447-12799469 GGAGTTCGCTTGAACCCAGGAGG - Intronic
1162881023 19:13659472-13659494 GAAGACCGCTTGAACCCAGGAGG + Intergenic
1162922972 19:13914261-13914283 GAAGATCCCTTGAGCCCAGGAGG - Intronic
1162999960 19:14360871-14360893 AAGGATCACTTGAACCCAGGAGG + Intergenic
1163085330 19:14975661-14975683 AGAATCGCTTTGAACCCAGGAGG + Intronic
1163239338 19:16050589-16050611 GAAGATCGCTTGAACCCAGGAGG + Intergenic
1163293000 19:16392950-16392972 AAAGGCTGCTTGAGCCCAGGAGG + Intronic
1163339108 19:16692915-16692937 AAGGATCGCTTGAACCCAGGAGG - Intergenic
1163413533 19:17171842-17171864 GAAGATCCCTTGAGCCCAGGAGG + Intronic
1163540280 19:17904871-17904893 AGAATCACTTTGAACCCAGGAGG - Intergenic
1163600226 19:18244600-18244622 AAGGATCGCTTGAACCCAGGAGG - Intronic
1163615398 19:18324384-18324406 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1163656296 19:18547150-18547172 AGGGATCCCTTGAACCCAGGAGG + Intergenic
1163724489 19:18914844-18914866 AAAAATCTCTTGAACCCAGGCGG - Intronic
1163750259 19:19072766-19072788 GAAGATCACTTGAACCCAGGAGG - Intronic
1163754547 19:19098832-19098854 AACAACCACTTGAACCCAGGAGG + Intronic
1163908622 19:20169202-20169224 GAAAATCCCTTGAACCCAGGAGG - Intronic
1163926325 19:20347561-20347583 AAAGATCACTTGAGCCCAGGAGG + Intergenic
1163964667 19:20734068-20734090 AAGATTCGCTTGAACCCAGGAGG - Intronic
1164521397 19:28982795-28982817 GAAGACCACTTGAACCCCGGAGG + Intergenic
1164565300 19:29321687-29321709 GAAGACCTCTTGAACCCCGGAGG - Intergenic
1164644750 19:29850270-29850292 GAAGATCGCTTGAACCCAGGAGG - Intergenic
1164785724 19:30928879-30928901 AAAGTCCACTAAAACCCATGTGG - Intergenic
1164911955 19:32020168-32020190 AAGGATCACTTGAACCCAGGAGG - Intergenic
1164973519 19:32552564-32552586 GAAGATCACTTGAACCCAGGAGG - Intergenic
1165280900 19:34796398-34796420 GAGGACCACTTGAACCCAGGAGG - Intergenic
1165293913 19:34910617-34910639 GAAAATCCCTTGAACCCAGGAGG + Intergenic
1165338097 19:35187340-35187362 ATAATCCCCTTGAACCTGGGAGG + Intergenic
1165367204 19:35375309-35375331 GAAGATCGCTTGAACCCAGGAGG + Intergenic
1165398655 19:35583259-35583281 AAAATCACTTAGAACCCAGGAGG + Intergenic
1165415648 19:35691827-35691849 GAAGATCGCTTGAACCCAGGAGG + Intergenic
1165489845 19:36116716-36116738 AAGGATCACTTGAACCCAGGAGG - Intronic
1165763961 19:38338610-38338632 AAGGTTCACTTGAGCCCAGGAGG - Intronic
1165799774 19:38541977-38541999 GAGGACCACTTGAACCCAGGAGG + Intronic
1165802832 19:38563352-38563374 GAAAACCGCTTGAACCCAGGAGG - Intronic
1165872006 19:38979678-38979700 GAAGATCACTTGAACCCAGGAGG + Intergenic
1165932900 19:39371725-39371747 GAAGGTCGCTTGAACCCAGGAGG + Intronic
1166119614 19:40677756-40677778 GAGGTTCCCTTGAGCCCAGGAGG + Intronic
1166154521 19:40900905-40900927 GAAAATCCCTTGAACCCAGGAGG - Intergenic
1166189446 19:41166215-41166237 AAGGATCCCCTGAACCCAGGAGG + Intergenic
1166314694 19:41982534-41982556 GAGAACCCCTTGAACCCAGGAGG + Intronic
1166337881 19:42119672-42119694 AAAAATCGCTTGAACCCAGGAGG + Intronic
1166397308 19:42451008-42451030 AGGATTCCCTTGAACCCAGGAGG + Intergenic
1166498231 19:43321192-43321214 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1166530424 19:43539848-43539870 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1166693433 19:44838421-44838443 AAGGATCACTTGAACCCAGGAGG + Intergenic
1166883415 19:45942878-45942900 CATGTCCCCTTAAACCCTGGGGG + Intronic
1167163601 19:47783126-47783148 AAGAATCCCTTGAACCCAGGAGG - Intronic
1167277376 19:48546470-48546492 AAGGACCACTTGAGCCCAGGAGG - Intergenic
1167345618 19:48943903-48943925 AAAAATCACTTGAACCCAGGAGG + Intronic
1167414939 19:49365074-49365096 AAGGATCCCTTGAGCCCAGGAGG + Intronic
1167540621 19:50084962-50084984 AAGGGTCACTTGAACCCAGGAGG + Intergenic
1167590184 19:50400308-50400330 AAGGATCACTTGAACCCAGGAGG - Intronic
1167629096 19:50612853-50612875 AAGGGTCACTTGAACCCAGGAGG - Intergenic
1167658575 19:50782344-50782366 GAGGATCCCTTGAACCCAGGAGG + Intergenic
1167783559 19:51616819-51616841 AAGATTCACTTGAACCCAGGAGG + Intronic
1167846531 19:52169701-52169723 AAAGACTGCTTGAGCCCAGGAGG + Exonic
1167860613 19:52280670-52280692 AAGAACCGCTTGAACCCAGGAGG - Intronic
1167903064 19:52636743-52636765 AAGGATCACTTGAACCCAGGAGG - Exonic
1167922806 19:52796083-52796105 GAGGATCCCTTGAACCCAGGAGG + Intronic
1168011437 19:53536811-53536833 GAGAACCCCTTGAACCCAGGAGG + Intronic
1168077060 19:53986646-53986668 AAGGATCACTTGAACCCAGGAGG + Exonic
1168223640 19:54979072-54979094 GAAGACCCCTTGAACCCAGGAGG - Intronic
1168312245 19:55466282-55466304 AAAGACCCCTTGAGCCCAAGAGG - Intergenic
1168534512 19:57157902-57157924 AAAAACCGCTTGAACCTAGGAGG + Intronic
1168652624 19:58101607-58101629 AAGAACCACTTGAACCCAGGAGG - Intronic
1168715372 19:58523982-58524004 AAGAATCCCTTGAACCCAGGAGG + Intronic
925565437 2:5248762-5248784 GAAGATCCCTTGAACCCAGGAGG + Intergenic
926020110 2:9487150-9487172 AAAGATCGCTTGAGCCCAGGAGG + Intronic
926031059 2:9589030-9589052 GAGGACCCCTTGAGCCCAGGAGG + Intronic
926032989 2:9608848-9608870 GAAGATCACTTGAACCCAGGAGG + Intronic
926277885 2:11419121-11419143 AAAAATCGCTTGAACCCAGGAGG - Intergenic
926323330 2:11764234-11764256 GAAGATCACTTGAACCCAGGAGG - Intronic
926561210 2:14419367-14419389 AAGGATCGCTTGAACCCAGGAGG + Intergenic
927571140 2:24161360-24161382 AGAGATCCCTTGAACCCAGGAGG + Intronic
927637139 2:24824798-24824820 AGAATCAACTTGAACCCAGGAGG + Intronic
927662552 2:25005129-25005151 AAAGATCCCTTGAGCCCAGGAGG + Intergenic
927792326 2:26020056-26020078 AGAATCAGCTTGAACCCAGGAGG + Intergenic
927984916 2:27402979-27403001 GAAGACCCCTTGAGCCCAGAAGG + Intronic
927995548 2:27483091-27483113 AAAGATCACTTGAGCCCAGGAGG - Intronic
928173563 2:29019268-29019290 CAAGATCACTTGAACCCAGGAGG - Intronic
928418275 2:31115159-31115181 AAAGATCACTTGAGCCCAGGAGG + Intronic
928533518 2:32216976-32216998 AAAAATCACTTGAACCCAGGAGG - Intronic
928568954 2:32583818-32583840 AAAAATCACTTGAACCCAGGAGG - Intronic
928737306 2:34307027-34307049 AAAGTCCCCATGACTTCAGGTGG - Intergenic
928970548 2:37023686-37023708 TAAGATCGCTTGAACCCAGGAGG + Intronic
929010730 2:37441543-37441565 AAGGATCGCTTGAACCCAGGAGG - Intergenic
929132828 2:38595188-38595210 AAGGACTGCTTGAACCCAGGAGG + Intronic
929496794 2:42451634-42451656 AGAATCTGCTTGAACCCAGGAGG + Intronic
929550581 2:42888340-42888362 AAAATTGCTTTGAACCCAGGAGG + Intergenic
929599471 2:43196103-43196125 GAAGACCACTTGAGCCCAGGAGG - Intergenic
929644358 2:43612123-43612145 AGAATCTGCTTGAACCCAGGAGG - Intergenic
929645352 2:43620649-43620671 AGAATCTGCTTGAACCCAGGAGG - Intergenic
929645878 2:43626875-43626897 GAGGACCACTTGAACCCAGGAGG + Intergenic
929764329 2:44831679-44831701 AAGGATCACTTGAACCCAGGAGG + Intergenic
929899817 2:45991094-45991116 GAAGATCACTTGAACCCAGGAGG - Intronic
929954963 2:46450525-46450547 GAAGACCACTTGAGCCCAGGAGG + Intronic
929991011 2:46786810-46786832 GATCACCCCTTGAACCCAGGAGG + Intergenic
930062191 2:47299383-47299405 AGAATCACTTTGAACCCAGGAGG + Intergenic
930093998 2:47552676-47552698 AAGAACCACTTGAACCCAGGAGG + Intronic
930138076 2:47922792-47922814 GAGGACCCCTTGAGCCCAGGAGG - Intergenic
930169431 2:48235940-48235962 AAGAATCCCTTGAACCCAGGAGG - Intergenic
930181332 2:48361375-48361397 AGAATCATCTTGAACCCAGGAGG + Intronic
930199490 2:48539589-48539611 GAAGATCGCTTGAACCCAGGAGG - Intronic
930647410 2:53926589-53926611 AAGAACCACTTGAACCCAGGAGG + Intronic
931296367 2:60929909-60929931 GAGGATCCCTTGAACCCAGGAGG + Exonic
931579047 2:63753337-63753359 AAGGATCACTTGAACCCAGGAGG + Intronic
931698380 2:64889215-64889237 AAAGTCCTGTTGAACTCTGGGGG - Intergenic
931878454 2:66540396-66540418 AGAATCCACTTGAACCCAGGAGG - Intronic
932235021 2:70114035-70114057 GAAGATCGCTTGAACCCAGGAGG + Intergenic
932298157 2:70643686-70643708 GAAGATCACTTGAACCCAGGAGG - Intronic
932305549 2:70699688-70699710 AAAGATCACTTGAGCCCAGGAGG + Intronic
932506844 2:72242100-72242122 GAAGACCACTTGAGCCCAGGAGG + Intronic
932636528 2:73393908-73393930 GAGGTCCACTTGAGCCCAGGAGG - Intronic
933149315 2:78894854-78894876 AGAATCTGCTTGAACCCAGGAGG + Intergenic
933862594 2:86484711-86484733 AAAATCCATTTGTACCCAGGAGG - Intronic
934687227 2:96330152-96330174 AAAGACTGCTTGAGCCCAGGAGG + Exonic
934963445 2:98698325-98698347 AAAAATCACTTGAACCCAGGTGG + Intronic
935074787 2:99730601-99730623 AGAATCGCTTTGAACCCAGGAGG - Intronic
935137277 2:100318741-100318763 GAATCACCCTTGAACCCAGGAGG + Intronic
935485707 2:103650854-103650876 AAAAATCACTTGAACCCAGGAGG + Intergenic
935743252 2:106169597-106169619 AAAGATCGCTTGAGCCCAGGAGG + Intronic
935838975 2:107087752-107087774 AAGGACCGCTTGAACCCAGGAGG + Intergenic
936532486 2:113286170-113286192 AGTTTCCCCATGAACCCAGGAGG + Intergenic
937760911 2:125602772-125602794 AAAGATCACTTGAGCCCAGGAGG + Intergenic
937972282 2:127560114-127560136 GAAGATCGCTTGAACCCAGGAGG - Intronic
938017331 2:127877967-127877989 AGGATCCCCTTGAGCCCAGGAGG + Intronic
938256431 2:129863156-129863178 AAGGATCACTTGAACCCAGGAGG + Intergenic
938725236 2:134102921-134102943 AAAGATCACTTGAACCCAAGAGG + Intergenic
938807040 2:134815639-134815661 AAGGATCGCTTGAACCCAGGAGG + Intergenic
938856274 2:135314836-135314858 AGAATCAGCTTGAACCCAGGAGG - Intronic
938940504 2:136165327-136165349 AAGAATCCCTTGAACCCAGGAGG + Intergenic
939109113 2:137985877-137985899 AAAGTATCCTTGAACCCAGGAGG + Intronic
939330990 2:140760797-140760819 AAATGCCTCTTGAACCCGGGAGG + Intronic
939854678 2:147344196-147344218 GAGGATCCCTTGAACCCAGGAGG - Intergenic
940199758 2:151137493-151137515 AGAAATCCCTTGAACCCAGGAGG + Intergenic
940231411 2:151457209-151457231 AGAATCACCTTGAGCCCAGGAGG - Intronic
940264050 2:151817913-151817935 AAAAATCGCTTGAACCCAGGAGG + Intronic
940274231 2:151922290-151922312 GAAGATCCCTTGAGCCCAGGAGG - Intronic
940563616 2:155333004-155333026 AGAATCTCTTTGAACCCAGGAGG - Intergenic
940881647 2:158953005-158953027 AGAATCCGCTTGAACCCGGGAGG - Intergenic
940915429 2:159249997-159250019 GAACTTCACTTGAACCCAGGAGG + Intronic
941102664 2:161313437-161313459 GAGGACCACTTGAACCCAGGAGG - Intronic
941817664 2:169813774-169813796 AAGAATCCCTTGAACCCAGGAGG + Intronic
941888703 2:170555780-170555802 AAAGATCACTTGAGCCCAGGAGG + Intronic
941962347 2:171266179-171266201 GAGGACCCCTTGAACCCAAGAGG + Intergenic
942122175 2:172788802-172788824 AAGGATCACTTGAACCCAGGGGG + Intronic
943363794 2:186950468-186950490 AAGGATCACTTGAACCCAGGAGG - Intergenic
943625860 2:190198540-190198562 AAGGATCACTTGAACCCAGGAGG + Intronic
943761739 2:191617330-191617352 AGAATTCCCTTGAACCCGGGAGG + Intergenic
944047375 2:195428591-195428613 AATGTCCCCTTGAGCCCACACGG + Intergenic
944140609 2:196451807-196451829 GAGGATCCCTTGAACCCAGGAGG + Intronic
944288999 2:197983317-197983339 GAAGACCACTTGAGCCCAGGAGG - Intronic
944402747 2:199346950-199346972 AAGAATCCCTTGAACCCAGGAGG - Intronic
944417159 2:199490454-199490476 AAGGATCGCTTGAACCCAGGAGG - Intergenic
944539927 2:200745245-200745267 AAAATCACTTTGAACCCAGGAGG - Intergenic
944569107 2:201025021-201025043 GAAGATCCCTTGAGCCCAGGAGG + Intronic
944640856 2:201724026-201724048 GAGGATCCCTTGAACCCAGGAGG + Intronic
944730365 2:202510325-202510347 AAAAATCACTTGAACCCAGGTGG + Intronic
944734162 2:202546691-202546713 AAAAATCGCTTGAACCCAGGAGG - Intronic
944745709 2:202653176-202653198 AAAGATCCCTTGAGCCCAGAAGG + Intronic
945079113 2:206071045-206071067 AGAATTCGCTTGAACCCAGGAGG - Intronic
945697123 2:213120828-213120850 GAGGATCCCTTGAACCCAGGAGG - Intronic
945871501 2:215231670-215231692 AGAATCGCCTTGAACCCAGAAGG + Intergenic
945965853 2:216185763-216185785 AGAAACCACTTGAACCCAGGAGG - Intronic
946023024 2:216654815-216654837 AACATACCCTTGAATCCAGGTGG + Intronic
946196797 2:218037228-218037250 AAGAATCCCTTGAACCCAGGAGG + Intronic
946504604 2:220285229-220285251 AAAATCGGCTTGAACCCAGGAGG + Intergenic
946561288 2:220916714-220916736 GAAGAATCCTTGAACCCAGGAGG - Intergenic
946667924 2:222070542-222070564 AAGAATCCCTTGAACCCAGGAGG - Intergenic
946770714 2:223085818-223085840 AATTCTCCCTTGAACCCAGGAGG - Intronic
946887188 2:224233270-224233292 AAGAATCCCTTGAACCCAGGAGG + Intergenic
947189250 2:227484791-227484813 GAAGATCACTTGAACCCAGGAGG - Intronic
947579417 2:231304484-231304506 AAGAACCACTTGAACCCAGGAGG - Intronic
947652792 2:231801529-231801551 AAAGACTGCTTGAGCCCAGGAGG - Intronic
947780013 2:232751302-232751324 AAGAATCCCTTGAACCCAGGAGG - Intronic
947799282 2:232918041-232918063 GAAAATCCCTTGAACCCAGGAGG - Intronic
947977245 2:234377581-234377603 AAAGGATCCTTGAACTCAGGGGG + Intergenic
948011603 2:234653461-234653483 AAAAATCACTTGAACCCAGGAGG - Intergenic
948016119 2:234692177-234692199 GAGGTTCGCTTGAACCCAGGAGG + Intergenic
948049513 2:234969031-234969053 AAAGTCGCCTGGAACCAGGGTGG - Intronic
948108708 2:235436606-235436628 AGAATCGGCTTGAACCCAGGAGG - Intergenic
948136087 2:235637360-235637382 AAGGATCACTTGAACCCAGGAGG - Intronic
948139596 2:235662594-235662616 AAAAATCGCTTGAACCCAGGAGG - Intronic
948363194 2:237437091-237437113 AAGATTCACTTGAACCCAGGAGG + Intergenic
948414263 2:237790813-237790835 AAGGGTCACTTGAACCCAGGAGG + Intronic
948968548 2:241405320-241405342 GAAGACAGCTTGAACCCAGGAGG - Intronic
949013612 2:241696692-241696714 ACAGGTCCTTTGAACCCAGGAGG + Intergenic
1169131826 20:3169787-3169809 AGAACCCCCTTGAACCCAGGAGG + Intronic
1169219060 20:3810750-3810772 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1169241558 20:3985792-3985814 AGAATTCGCTTGAACCCAGGAGG - Intronic
1169241565 20:3985825-3985847 AGAATTCGCTTGAACCCAGGAGG - Intronic
1169281183 20:4268242-4268264 AAGGACCACTTGAGCCCAGGAGG - Intergenic
1169314691 20:4580367-4580389 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1169385266 20:5143852-5143874 AAAAATCGCTTGAACCCAGGAGG - Intronic
1169436719 20:5599375-5599397 AGAATTCACTTGAACCCAGGAGG + Intronic
1169602125 20:7273643-7273665 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1169728542 20:8762118-8762140 GAAATTCGCTTGAACCCAGGAGG + Intronic
1169846527 20:9998972-9998994 GAAGATCACTTGAACCCAGGAGG + Intronic
1170215701 20:13889046-13889068 AAAAATCACTTGAACCCAGGAGG - Intronic
1170290418 20:14762838-14762860 AAAAACTGCTTGAACCCAGGAGG + Intronic
1170461994 20:16586153-16586175 AAAAATCGCTTGAACCCAGGAGG + Intergenic
1171047581 20:21825454-21825476 AAAAGTCGCTTGAACCCAGGAGG - Intergenic
1171293946 20:24000341-24000363 GAGGTCCCCTTGAACCTAGGAGG - Intergenic
1171348470 20:24484536-24484558 TCCCTCCCCTTGAACCCAGGTGG - Intronic
1171496514 20:25560020-25560042 GAAGATCGCTTGAACCCAGGAGG - Intronic
1171529124 20:25840346-25840368 AAAAAACACTTGAACCCAGGAGG - Intronic
1171547702 20:26015539-26015561 AAAAAACACTTGAACCCAGGAGG + Intergenic
1171990536 20:31692979-31693001 AAGAACCGCTTGAACCCAGGAGG + Intronic
1172008591 20:31833620-31833642 TAAGTCCCCTTCAGTCCAGGAGG - Intronic
1172110773 20:32543698-32543720 AATAACCACTTGAACCCAGGAGG + Intronic
1172164072 20:32888151-32888173 AAAGATCCCTTGACCCCAGGAGG - Intronic
1172260126 20:33557102-33557124 AAGAATCCCTTGAACCCAGGAGG - Intronic
1172320467 20:33992354-33992376 AGAATCGCTTTGAACCCAGGAGG + Intergenic
1172321309 20:33997203-33997225 AGAGATCCCTTGAACCCAGGAGG - Intronic
1172442394 20:34975292-34975314 GAGGACCGCTTGAACCCAGGAGG - Intergenic
1172503247 20:35442234-35442256 GAAAACCCCTTGAACCCAGGAGG - Intronic
1172548868 20:35783504-35783526 GAGGATCCCTTGAACCCAGGAGG - Intronic
1172812607 20:37659916-37659938 AAGATTCGCTTGAACCCAGGAGG - Intergenic
1172917826 20:38457011-38457033 AAGGATCACTTGAACCCAGGAGG - Intergenic
1173516796 20:43670013-43670035 AGAATTCACTTGAACCCAGGAGG + Intronic
1173516938 20:43671243-43671265 AAAAACTGCTTGAACCCAGGAGG - Intronic
1173531641 20:43774107-43774129 AAGGAGCACTTGAACCCAGGAGG + Intergenic
1173535148 20:43804149-43804171 AAGGATCACTTGAACCCAGGAGG - Intergenic
1173622682 20:44448679-44448701 GAGGATCCCTTGAACCCAGGAGG + Intergenic
1173657761 20:44712162-44712184 GAGGATCCCTTGAACCCAGGAGG + Intergenic
1173680167 20:44873511-44873533 GAAAACCGCTTGAACCCAGGAGG - Intergenic
1173748690 20:45458608-45458630 GAAGATCCCTTGAGCCCAGGAGG + Intergenic
1173780730 20:45754742-45754764 AAGGATCGCTTGAACCCAGGAGG + Intronic
1173986596 20:47266367-47266389 AGAATCCGCTTGAACCCGGGAGG - Intronic
1174022767 20:47544411-47544433 AAGGACCGCTTAAACCCAGGAGG - Intronic
1174305508 20:49611782-49611804 AAGGATCACTTGAACCCAGGAGG - Intergenic
1174322615 20:49753933-49753955 AGAATCTCCTTGAACCCAGGAGG - Intergenic
1175073572 20:56355179-56355201 TGAGGCCCCTTGAACCCAAGAGG - Intergenic
1175110667 20:56645810-56645832 AAGGATCCCTTGAGCCCAGGAGG + Intergenic
1175406316 20:58732884-58732906 AAAAATCACTTGAACCCAGGGGG - Intergenic
1175410505 20:58764652-58764674 GAGGTACCCTTGAACCCGGGAGG - Intergenic
1175952969 20:62593305-62593327 GAAGTCTCCCTGAGCCCAGGAGG - Intergenic
1176066558 20:63199962-63199984 GAAGACCGCTTGAGCCCAGGAGG + Intronic
1177137544 21:17321920-17321942 GAAGACTCCTTGAACCCAGGAGG + Intergenic
1177259217 21:18707080-18707102 AAAAATCGCTTGAACCCAGGAGG - Intergenic
1177326688 21:19599923-19599945 GAAAACCTCTTGAACCCAGGAGG - Intergenic
1177494440 21:21871428-21871450 GAGGATCCCTTGAACCCAGGAGG - Intergenic
1178080956 21:29064323-29064345 AGAGATCACTTGAACCCAGGAGG + Intronic
1178255619 21:31049732-31049754 AAGGATCACTTGAACCCAGGAGG + Intergenic
1178398498 21:32263509-32263531 AAGAACCGCTTGAACCCAGGAGG + Intergenic
1178459268 21:32787203-32787225 AAGGACCGCTTGAGCCCAGGAGG + Intergenic
1178549059 21:33519736-33519758 GAGGATCCCTTGAACCCAGGAGG + Intronic
1178825940 21:36016950-36016972 AGAATCACTTTGAACCCAGGAGG + Intergenic
1178840953 21:36136936-36136958 AAGAACCGCTTGAACCCAGGAGG + Intronic
1178867671 21:36343183-36343205 AAGAATCCCTTGAACCCAGGAGG - Intronic
1178944065 21:36931657-36931679 GAGGATCCCTTGAACCCAGGAGG + Intronic
1179169070 21:38958594-38958616 CAAGCCCCCTTGCTCCCAGGTGG + Intergenic
1179208343 21:39304522-39304544 GAGGATCCCTTGAACCCAGGAGG + Intronic
1179677641 21:42995009-42995031 AAAAATCGCTTGAACCCAGGAGG - Intronic
1180212967 21:46306675-46306697 AAGGATCACTTGAACCCAGGAGG - Intronic
1180469087 22:15639882-15639904 AATAATCCCTTGAACCCAGGAGG + Intergenic
1180623747 22:17180039-17180061 AGAATCCGCTTGAACCCGGGAGG + Exonic
1180624251 22:17183548-17183570 AGAATCCGCTTGAACCCGGGAGG - Intronic
1180627079 22:17200790-17200812 GAGGTTCCCTTGAACCCAGGAGG + Intronic
1180933511 22:19609205-19609227 AAGAACCACTTGAACCCAGGAGG + Intergenic
1181020345 22:20098035-20098057 AAGAACCACTTGAACCCAGGAGG + Intronic
1181261171 22:21598928-21598950 AAAGATTGCTTGAACCCAGGAGG - Intronic
1181302096 22:21887925-21887947 AGGATTCCCTTGAACCCAGGAGG - Intergenic
1181327980 22:22065911-22065933 AAAAATCGCTTGAACCCAGGAGG - Intergenic
1181680022 22:24488457-24488479 AAGGACCGCATGAACCCAGGAGG + Intergenic
1181692594 22:24572669-24572691 AAGATTCGCTTGAACCCAGGAGG + Exonic
1181966527 22:26659923-26659945 AAGGATCACTTGAACCCAGGAGG - Intergenic
1182106231 22:27691709-27691731 ATGGTCTCCTTGAACCCAGGAGG + Intergenic
1182128333 22:27832747-27832769 AAAGACCCCTTGCACCCACCAGG + Intergenic
1182185878 22:28401523-28401545 AAAAATCACTTGAACCCAGGAGG + Intronic
1182334412 22:29573847-29573869 GAAGATCGCTTGAACCCAGGAGG + Intronic
1182340094 22:29613439-29613461 AAGAATCCCTTGAACCCAGGAGG + Intronic
1182364448 22:29768714-29768736 GAAGATCACTTGAACCCAGGAGG - Intronic
1182392072 22:30006645-30006667 AAGGATCCCTTGAACCCAGAAGG - Intronic
1182560316 22:31154258-31154280 AAAAATCGCTTGAACCCAGGAGG + Intergenic
1182581246 22:31313135-31313157 AAAAACCACTTGAACCCTGGAGG - Intergenic
1183139004 22:35918357-35918379 AAAGTCACCTGGCACCCAGAAGG + Intronic
1183216419 22:36483071-36483093 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1183397948 22:37583774-37583796 GAGGTTCGCTTGAACCCAGGAGG + Intergenic
1183501802 22:38184504-38184526 AAAAATCTCTTGAACCCAGGAGG + Intronic
1183656443 22:39188107-39188129 GAGGACCCCTTGAGCCCAGGAGG - Intergenic
1183702859 22:39459551-39459573 AAGGATCCCTTGAGCCCAGGAGG - Intronic
1183721689 22:39566450-39566472 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1183812132 22:40266298-40266320 AAAGACCCCAAGAACACAGGAGG + Exonic
1183970295 22:41472261-41472283 AAGAATCCCTTGAACCCAGGAGG + Intronic
1183996319 22:41635628-41635650 AAAGATCGCTTGACCCCAGGAGG - Intronic
1184125011 22:42480824-42480846 AAGATTCGCTTGAACCCAGGAGG + Intergenic
1184166199 22:42729759-42729781 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1184323248 22:43760112-43760134 AAGAACCGCTTGAACCCAGGAGG + Intronic
1184485071 22:44772906-44772928 GAGGACCGCTTGAACCCAGGAGG - Intronic
1184957335 22:47898846-47898868 GAAAACCACTTGAACCCAGGAGG + Intergenic
1185356328 22:50373821-50373843 GAAATTCGCTTGAACCCAGGAGG - Intronic
949215141 3:1558399-1558421 AGAATTCACTTGAACCCAGGAGG + Intergenic
949322287 3:2824749-2824771 AGAATCAGCTTGAACCCAGGAGG - Intronic
949536995 3:5004008-5004030 AGAATCGCTTTGAACCCAGGAGG + Intergenic
949553964 3:5136192-5136214 CAAGTTCACTTGAACCCAGGAGG - Intronic
949588411 3:5466631-5466653 AAAGTGCCTTTTAACCCAGTGGG - Intergenic
949758902 3:7446548-7446570 AGAATTGCCTTGAACCCAGGAGG - Intronic
950036055 3:9886549-9886571 GAAGTTCACTTGAGCCCAGGAGG + Intergenic
950511124 3:13427866-13427888 AGAGATCGCTTGAACCCAGGAGG + Intergenic
950515829 3:13464563-13464585 AAGGATCCCTTGAGCCCAGGAGG - Intergenic
950805155 3:15595697-15595719 AGAATCGGCTTGAACCCAGGAGG - Intronic
950830261 3:15867117-15867139 AAGGATCACTTGAACCCAGGAGG + Intergenic
951210473 3:19969132-19969154 GAAAACCGCTTGAACCCAGGAGG - Intronic
951362050 3:21737027-21737049 AAGATTCACTTGAACCCAGGAGG - Intronic
951529919 3:23688557-23688579 AAAAATCGCTTGAACCCAGGAGG + Intergenic
951673622 3:25212526-25212548 AAGGATCGCTTGAACCCAGGAGG + Intronic
951877420 3:27442519-27442541 AAGAATCCCTTGAACCCAGGAGG - Intronic
951914190 3:27782130-27782152 GAGGATCCCTTGAACCCAGGAGG + Intergenic
951915444 3:27796441-27796463 AAGGACTGCTTGAACCCAGGAGG - Intergenic
951958990 3:28293669-28293691 AAAAACCACTTGAATCCAGGAGG - Intronic
952189158 3:31003972-31003994 AATGTCCTCTTGCACTCAGGAGG + Intergenic
952289015 3:31997352-31997374 GAGGATCCCTTGAACCCAGGAGG - Intronic
952329564 3:32351620-32351642 AAAGATCTCTTGAGCCCAGGAGG + Intronic
953050820 3:39341319-39341341 GGAATCCGCTTGAACCCAGGAGG + Intergenic
953301394 3:41780216-41780238 AAAGACAGCTTGAGCCCAGGAGG + Intronic
953402133 3:42633127-42633149 AAAGATCTCTTGAGCCCAGGAGG - Intronic
953648904 3:44782137-44782159 AGAATAGCCTTGAACCCAGGAGG - Intronic
953702583 3:45208173-45208195 GAGGATCCCTTGAACCCAGGAGG + Intergenic
953824813 3:46242041-46242063 GAAAATCCCTTGAACCCAGGAGG + Intronic
954170767 3:48800421-48800443 AAAAATCGCTTGAACCCAGGAGG + Intronic
954174704 3:48835059-48835081 GAAGACCACTTGAACCCGGGAGG - Intronic
954247235 3:49341263-49341285 GAAGATCCCTTGAGCCCAGGAGG + Intergenic
954321537 3:49835116-49835138 GAGGATCCCTTGAACCCAGGGGG + Intronic
954328103 3:49874642-49874664 CAACTCCCCTAGGACCCAGGAGG - Intergenic
954503034 3:51039083-51039105 GATAACCCCTTGAACCCAGGAGG - Intronic
954522260 3:51239297-51239319 AAGGATCGCTTGAACCCAGGAGG - Intronic
955166890 3:56523713-56523735 ACAGTCCCCTTCTTCCCAGGAGG - Intergenic
955195821 3:56803972-56803994 AAAGATCACTTGAGCCCAGGAGG - Intronic
955234466 3:57127493-57127515 AAAAATCTCTTGAACCCAGGAGG - Intronic
955274162 3:57531671-57531693 AAGAATCCCTTGAACCCAGGAGG + Intronic
955292809 3:57708080-57708102 AATGATCGCTTGAACCCAGGAGG - Intergenic
955332133 3:58056189-58056211 AAGAATCCCTTGAACCCAGGAGG - Intronic
955378338 3:58416708-58416730 AAAAATCGCTTGAACCCAGGAGG - Intronic
955459885 3:59170229-59170251 GAAGATCACTTGAACCCAGGAGG + Intergenic
955603801 3:60676962-60676984 GAGGATCCCTTGAACCCAGGAGG - Intronic
955749912 3:62177194-62177216 AAAGATCACTTGAGCCCAGGGGG + Intronic
955760228 3:62272003-62272025 AAGGATCCCTTGAACCCAGTAGG + Intronic
956039509 3:65131449-65131471 GAGGATCCCTTGAACCCAGGAGG + Intergenic
956106319 3:65822436-65822458 AAAAATCACTTGAACCCAGGAGG + Intronic
956117456 3:65932798-65932820 AAAGTCTCATGGAACCCAAGGGG - Intronic
956209554 3:66788888-66788910 AGAATCAGCTTGAACCCAGGAGG + Intergenic
956226660 3:66967581-66967603 AAAAATCACTTGAACCCAGGAGG - Intergenic
956755422 3:72381186-72381208 AAAGTCACCTTTCACCTAGGGGG - Intronic
956770909 3:72525214-72525236 GAAGATCTCTTGAACCCAGGAGG + Intergenic
956818847 3:72934172-72934194 AAGGATCACTTGAACCCAGGAGG - Intronic
956826686 3:73003786-73003808 AAAAATCGCTTGAACCCAGGAGG - Intronic
956837287 3:73105968-73105990 AAACATCACTTGAACCCAGGAGG - Intergenic
957430318 3:80096444-80096466 CAAGATCACTTGAACCCAGGAGG + Intergenic
957489358 3:80904549-80904571 AAAGTCACCTTGAACATTGGAGG + Intergenic
957652382 3:83024348-83024370 GCAGATCCCTTGAACCCAGGAGG + Intergenic
958046993 3:88297106-88297128 AAGGTTCCCTTGAGCCCAGGAGG - Intergenic
958420759 3:93927775-93927797 GAGGTCCACCTGAACCCAGGTGG + Intronic
958731551 3:97965420-97965442 AAGGATCACTTGAACCCAGGAGG + Intronic
959066528 3:101662849-101662871 AAAGATGGCTTGAACCCAGGAGG - Intronic
959535522 3:107480973-107480995 GAGGACCCCTTGAGCCCAGGAGG - Intergenic
959622262 3:108411121-108411143 AAAGACCCCATGCACACAGGAGG - Intronic
959705455 3:109335240-109335262 AAAGATCACTTGAACCCGGGAGG - Intronic
959731510 3:109608834-109608856 AGAATTCACTTGAACCCAGGAGG - Intergenic
960321429 3:116241475-116241497 AGAATCCGCTTGAACCCAGGAGG + Intronic
960656573 3:120010976-120010998 AAGAATCCCTTGAACCCAGGAGG + Intronic
960667085 3:120119846-120119868 AAGAATCCCTTGAACCCAGGAGG + Intergenic
960791393 3:121435072-121435094 GAAAATCCCTTGAACCCAGGAGG + Intronic
960882298 3:122357180-122357202 GAAGATCTCTTGAACCCAGGAGG - Intergenic
961130180 3:124458842-124458864 GAAAATCCCTTGAACCCAGGAGG + Intronic
961255452 3:125546798-125546820 AAAAATCGCTTGAACCCAGGAGG + Intronic
961538743 3:127586446-127586468 GAAGACTCCTTGAACCCAGAAGG - Intronic
961595106 3:128009646-128009668 AAGAACCACTTGAACCCAGGCGG - Intergenic
961691317 3:128671915-128671937 GAAAATCCCTTGAACCCAGGTGG - Intronic
961790341 3:129371394-129371416 AAAGATCTCTTGAACCCAGGAGG - Intergenic
962518911 3:136179973-136179995 AGAGAACACTTGAACCCAGGAGG + Intronic
962525688 3:136235538-136235560 GAGGACCACTTGAACCCAGGAGG + Intergenic
962556301 3:136555592-136555614 AGAATCCGCTTGAACCCAGGAGG + Intronic
962571075 3:136714086-136714108 AAGAACCACTTGAACCCAGGAGG + Intronic
962724846 3:138214060-138214082 AAGGATCCCTTGAGCCCAGGAGG + Intronic
962789446 3:138797861-138797883 AAAGATCACTTGAATCCAGGAGG + Intronic
962792371 3:138823008-138823030 AATATCGGCTTGAACCCAGGAGG - Intronic
963720003 3:148851243-148851265 AGAATCCATTTGAACCCAGGAGG + Intronic
964039116 3:152237507-152237529 GAAGATCGCTTGAACCCAGGAGG + Intergenic
964055954 3:152457840-152457862 AGTGTCCCCTACAACCCAGGTGG - Intronic
964363622 3:155925492-155925514 AAAGAGTGCTTGAACCCAGGAGG - Intronic
964449250 3:156794701-156794723 AAGGATCCCTTGAGCCCAGGAGG + Intergenic
964785792 3:160394658-160394680 AGAGATCACTTGAACCCAGGAGG + Intronic
964870236 3:161306011-161306033 AAGATTCACTTGAACCCAGGAGG - Intergenic
965573344 3:170192989-170193011 GAAGCCCACTTGAGCCCAGGAGG - Intergenic
965780306 3:172278835-172278857 AAAAATCGCTTGAACCCAGGAGG + Intronic
965804258 3:172526116-172526138 GAGGACCACTTGAACCCAGGAGG - Intergenic
966107123 3:176349617-176349639 ATATTCTGCTTGAACCCAGGAGG - Intergenic
966131795 3:176649385-176649407 AAGGATCGCTTGAACCCAGGAGG + Intergenic
966164676 3:177004152-177004174 AAAAATCACTTGAACCCAGGAGG + Intergenic
966841949 3:184096843-184096865 AAAGATCCCTTGAGCCCAGGAGG + Intergenic
967042970 3:185710641-185710663 AAGAATCCCTTGAACCCAGGAGG + Intronic
967047489 3:185751121-185751143 AAGAACCACTTGAACCCAGGAGG + Intronic
967059269 3:185857675-185857697 CAAGTTCACTTGAACCCGGGAGG + Intergenic
967122494 3:186395441-186395463 AAAATCAGCTTGAACTCAGGAGG + Intergenic
967217498 3:187222970-187222992 AAAGTCCCATTGAACTTTGGAGG + Intronic
967265939 3:187692392-187692414 AAGGATCCCTTGAACCCAAGGGG - Intergenic
967495374 3:190138390-190138412 GAAAACCACTTGAACCCAGGAGG - Intergenic
967601050 3:191389948-191389970 AAGGATCACTTGAACCCAGGTGG - Intronic
968000715 3:195204251-195204273 AAAACTCGCTTGAACCCAGGAGG + Intronic
968158644 3:196405379-196405401 AGAATCCACTTGAACCCAGGAGG + Intronic
968166265 3:196467642-196467664 AAAAATCACTTGAACCCAGGAGG - Intergenic
968241365 3:197089435-197089457 AAGGATCCCTTGAACCCGGGAGG + Intronic
968247464 3:197166800-197166822 AGAATCGCTTTGAACCCAGGAGG + Intronic
968347770 3:198025459-198025481 GAAGGTCGCTTGAACCCAGGAGG - Intronic
968853900 4:3104185-3104207 AAAGTTCGGTTGAACCCGGGAGG - Intronic
969809484 4:9636980-9637002 GAAGATCGCTTGAACCCAGGAGG + Intergenic
969971564 4:11053456-11053478 AAAGATCCCTTGAGCCCAGGAGG - Intergenic
970293436 4:14601818-14601840 GAGGATCCCTTGAACCCAGGAGG + Intergenic
970497761 4:16644515-16644537 GAAAATCCCTTGAACCCAGGAGG - Intronic
970608366 4:17703406-17703428 AAGGATCCCTTGAGCCCAGGAGG + Intronic
970811416 4:20098906-20098928 AAGAACCGCTTGAACCCAGGAGG + Intergenic
970873542 4:20843638-20843660 AAGAGTCCCTTGAACCCAGGAGG + Intronic
971023369 4:22562475-22562497 GTAATCTCCTTGAACCCAGGAGG - Intergenic
971066982 4:23044039-23044061 AAGGACCACTTGAGCCCAGGAGG + Intergenic
971085284 4:23267802-23267824 AAAATTTGCTTGAACCCAGGAGG - Intergenic
971233037 4:24816175-24816197 AAGGATCCCTTGAACCCAGGAGG - Intronic
971298942 4:25426083-25426105 AAGAATCCCTTGAACCCAGGAGG - Intergenic
971320744 4:25603926-25603948 GAAGACAGCTTGAACCCAGGTGG - Intergenic
971391328 4:26188117-26188139 GAAAATCCCTTGAACCCAGGAGG + Intronic
971461102 4:26897853-26897875 AAAGATCCCTTGACCCCAGAAGG - Intronic
971560405 4:28073112-28073134 AAGGATCCCTTGAACCCAGGAGG - Intergenic
971642943 4:29158690-29158712 AGAATCAGCTTGAACCCAGGAGG - Intergenic
971741959 4:30532884-30532906 GAGGACCACTTGAACCCAGGAGG - Intergenic
971869651 4:32218447-32218469 AAAAATCACTTGAACCCAGGAGG - Intergenic
971870158 4:32225066-32225088 CAGGGCCGCTTGAACCCAGGAGG - Intergenic
972107541 4:35509227-35509249 AAGGACTGCTTGAACCCAGGAGG - Intergenic
972135769 4:35891302-35891324 AAAAATCACTTGAACCCAGGAGG - Intergenic
972398350 4:38676349-38676371 AAGAATCCCTTGAACCCAGGAGG + Intronic
972433122 4:39003422-39003444 AAAAATCACTTGAACCCAGGAGG - Intronic
972477189 4:39461782-39461804 AAGAATCCCTTGAACCCAGGAGG - Intronic
972542195 4:40048820-40048842 GAAAATCCCTTGAACCCAGGAGG + Intergenic
972613436 4:40676092-40676114 GAGGATCCCTTGAACCCAGGAGG - Intergenic
972647397 4:40982093-40982115 AAAAATCGCTTGAACCCAGGAGG + Intronic
972729693 4:41782132-41782154 AAGAATCCCTTGAACCCAGGAGG + Intergenic
972778393 4:42264611-42264633 AAAAATCACTTGAACCCAGGAGG + Intergenic
972792252 4:42384261-42384283 AAGGATCCCTTGAGCCCAGGAGG - Intergenic
973163799 4:47052038-47052060 AGAATCTGCTTGAACCCAGGAGG + Intronic
973763402 4:54141086-54141108 GAAGATCACTTGAACCCAGGAGG - Intronic
974001024 4:56510859-56510881 AAAAATCACTTGAACCCAGGAGG - Intronic
974145400 4:57941285-57941307 GAAAATCCCTTGAACCCAGGAGG + Intergenic
974213475 4:58813511-58813533 GAAGATTCCTTGAACCCAGGAGG + Intergenic
974484131 4:62485019-62485041 AAATATCGCTTGAACCCAGGAGG - Intergenic
974542593 4:63257525-63257547 AAAAATCTCTTGAACCCAGGAGG - Intergenic
974802162 4:66831556-66831578 AACAACCACTTGAACCCAGGAGG + Intergenic
974881136 4:67758880-67758902 AAGAACCACTTGAACCCAGGAGG - Intergenic
974881252 4:67759992-67760014 GAGGATCCCTTGAACCCAGGAGG + Intergenic
974940635 4:68463389-68463411 AAAAATCACTTGAACCCAGGAGG - Intronic
974961739 4:68710850-68710872 AAAAATCGCTTGAACCCAGGAGG - Intergenic
975067792 4:70089576-70089598 GAGGATCCCTTGAACCCAGGAGG + Intergenic
975099218 4:70493134-70493156 GAAGATCCCTTGAGCCCAGGAGG + Intergenic
975194053 4:71502049-71502071 AAGAATCCCTTGAACCCAGGAGG - Intronic
975651499 4:76598113-76598135 AGAATGCCCATGAACCCAGGAGG - Intronic
975704336 4:77097119-77097141 AAGAATCCCTTGAACCCAGGAGG + Intergenic
975785805 4:77886880-77886902 GAAGAATCCTTGAACCCAGGAGG - Intronic
975947492 4:79725211-79725233 AGAATCAACTTGAACCCAGGAGG - Intergenic
975966042 4:79973515-79973537 AAGAACCACTTGAACCCAGGAGG - Intronic
976270679 4:83227640-83227662 GAGGACCACTTGAACCCAGGAGG - Intergenic
976410934 4:84712630-84712652 AGAATCGCCATGAACCCAGGAGG + Intronic
976606260 4:86986160-86986182 CAAGATCGCTTGAACCCAGGAGG - Intronic
977589494 4:98810417-98810439 GAGGATCCCTTGAACCCAGGAGG + Intergenic
977600795 4:98931573-98931595 GAGGACCCCTTGAACCCAGAAGG - Intergenic
977620827 4:99135337-99135359 GAAGTTCACTTGAGCCCAGGAGG + Intronic
978413458 4:108450804-108450826 AAGAATCCCTTGAACCCAGGAGG - Intergenic
978501741 4:109417387-109417409 GAAGACTGCTTGAACCCAGGAGG + Intergenic
978573790 4:110168427-110168449 AAAAATCACTTGAACCCAGGAGG + Intronic
978834872 4:113136844-113136866 AGAATCCACTTGAACCCGGGAGG - Intronic
979299314 4:119068318-119068340 AAAAATCACTTGAACCCAGGAGG + Intergenic
979655334 4:123185953-123185975 AAAGTCCCCTTGAAACATAGTGG - Intronic
979882630 4:125980971-125980993 GAAAATCCCTTGAACCCAGGAGG + Intergenic
979958055 4:126980195-126980217 AAAAATCGCTTGAACCCAGGAGG - Intergenic
980042329 4:127953641-127953663 AAAATACACTTGAACCCAGGAGG - Intronic
980160510 4:129156613-129156635 AAGGATCTCTTGAACCCAGGAGG - Intergenic
980424704 4:132612855-132612877 ACAGGCTCTTTGAACCCAGGAGG + Intergenic
980546534 4:134270854-134270876 AAGAATCCCTTGAACCCAGGAGG - Intergenic
981017807 4:139992613-139992635 AAGGATCACTTGAACCCAGGAGG - Intronic
981705139 4:147651011-147651033 AGAATCCCCTTGAACCCAGGAGG + Intronic
981967959 4:150629547-150629569 GAAGATCACTTGAACCCAGGAGG + Intronic
982008962 4:151088557-151088579 GAGGATCCCTTGAACCCAGGAGG + Intergenic
982290002 4:153770702-153770724 AAGAATCCCTTGAACCCAGGAGG - Intergenic
982742663 4:159073913-159073935 AGAACCACCTTGAACCCAGGAGG + Intergenic
982802386 4:159721420-159721442 AAAGATGGCTTGAACCCAGGAGG - Intergenic
982865941 4:160512014-160512036 AAGAATCCCTTGAACCCAGGAGG - Intergenic
982923861 4:161310233-161310255 AAGAATCCCTTGAACCCAGGAGG - Intergenic
982985441 4:162200706-162200728 GAGAACCCCTTGAACCCAGGAGG - Intergenic
983058117 4:163123469-163123491 GAAGATCACTTGAACCCAGGAGG - Intronic
983593828 4:169443224-169443246 GAGGATCCCTTGAACCCAGGAGG + Intronic
983642609 4:169957092-169957114 AAAGATCGCTTGAGCCCAGGAGG - Intergenic
984284891 4:177716641-177716663 GAAAATCCCTTGAACCCAGGAGG - Intergenic
984371639 4:178874399-178874421 GAAGACCACTTGCACCCAGGGGG - Intergenic
984653793 4:182296039-182296061 GAATTCTCCTTGAACCCAGGAGG - Intronic
984794512 4:183645990-183646012 AGAATTCGCTTGAACCCAGGAGG - Intronic
984915027 4:184715399-184715421 AGAATCACCTTGAACCCGGGAGG - Intronic
985043013 4:185911315-185911337 GAAGATCACTTGAACCCAGGAGG - Intronic
985081812 4:186273540-186273562 GAAGATCACTTGAACCCAGGAGG - Intronic
985141654 4:186846078-186846100 TAAGTTCACTTGAATCCAGGAGG - Intergenic
985319617 4:188695400-188695422 AAAGTCTCCATGAGCCAAGGTGG + Intergenic
985901034 5:2792745-2792767 GAGGATCCCTTGAACCCAGGAGG + Intergenic
986463071 5:7993136-7993158 AAAGACCACTTGATCCCGGGAGG + Intergenic
986509636 5:8490784-8490806 GAAGAACCCTTGAGCCCAGGAGG - Intergenic
986925362 5:12741940-12741962 AAGAATCCCTTGAACCCAGGAGG + Intergenic
986979602 5:13431912-13431934 AAGAACCACTTGAACCCAGGAGG + Intergenic
987165007 5:15188534-15188556 AAATTCCCCTTGAATTCAGATGG - Intergenic
987252976 5:16119270-16119292 AGAGAGCACTTGAACCCAGGAGG + Intronic
987435993 5:17894826-17894848 GAAGAATCCTTGAACCCAGGAGG - Intergenic
987855708 5:23417436-23417458 GAGGATCCCTTGAACCCAGGAGG - Intergenic
988511572 5:31868859-31868881 AAAATCTGCTTGAACCCGGGAGG - Intronic
989040784 5:37225761-37225783 AGAATCTACTTGAACCCAGGAGG + Intronic
990199727 5:53357811-53357833 AAGATTCACTTGAACCCAGGAGG + Intergenic
990219533 5:53572731-53572753 AGAATCCACTTGAACCCAGGAGG - Intronic
990497427 5:56362520-56362542 AAAAATCCCTTGAACCCAGGAGG - Intergenic
990599934 5:57348053-57348075 GAGGACCGCTTGAACCCAGGAGG - Intergenic
991048092 5:62244137-62244159 AAGGATCCCTTGAGCCCAGGAGG - Intergenic
991068609 5:62452153-62452175 AACGATCACTTGAACCCAGGAGG + Intronic
991712201 5:69419015-69419037 ATAGACCGCTTGAACCCGGGAGG - Intronic
991722641 5:69508123-69508145 AAGAATCCCTTGAACCCAGGAGG - Intronic
992004320 5:72462638-72462660 AAGGGTCACTTGAACCCAGGAGG - Intronic
992186090 5:74246057-74246079 ATAGTCCCCCTGAGACCAGGAGG - Intergenic
992223854 5:74599415-74599437 AAGGACCCCTTGAGTCCAGGAGG + Intergenic
992435634 5:76753140-76753162 AAGAACCACTTGAACCCAGGAGG + Intergenic
992926101 5:81588973-81588995 AAAAACTCCTTGAGCCCAGGAGG + Intronic
992958719 5:81937798-81937820 GAGGTTCACTTGAACCCAGGAGG - Intergenic
993118308 5:83744146-83744168 AAGGATCACTTGAACCCAGGAGG - Intergenic
993392314 5:87334971-87334993 AAGAATCCCTTGAACCCAGGAGG - Intronic
993510829 5:88769732-88769754 GAAGATCACTTGAACCCAGGAGG - Intronic
993889294 5:93454189-93454211 AAGGATCCCTTGAACCCAGGAGG + Intergenic
993991702 5:94665661-94665683 AAAAATCGCTTGAACCCAGGAGG + Intronic
994296600 5:98096844-98096866 AATGATTCCTTGAACCCAGGAGG - Intergenic
994343882 5:98662952-98662974 AAAAATCACTTGAACCCAGGAGG + Intergenic
994383307 5:99097433-99097455 GAGGATCCCTTGAACCCAGGAGG + Intergenic
994471938 5:100218062-100218084 GAACTGCTCTTGAACCCAGGAGG + Intergenic
994713176 5:103290952-103290974 AAAGACCCATTTAACCAAGGAGG + Intergenic
994945235 5:106379330-106379352 AAAAATCTCTTGAACCCAGGAGG - Intergenic
994982295 5:106891169-106891191 AAGAATCCCTTGAACCCAGGAGG + Intergenic
995366661 5:111369153-111369175 AAAGATCACTTGAACCCAGGAGG - Intronic
995497883 5:112767718-112767740 AAGAACCGCTTGAACCCAGGAGG - Intronic
995885602 5:116890926-116890948 GAAGATCGCTTGAACCCAGGAGG - Intergenic
996372518 5:122768336-122768358 AGAATCAGCTTGAACCCAGGAGG + Intergenic
996446041 5:123552232-123552254 AGAATTCGCTTGAACCCAGGAGG - Intronic
996588975 5:125124205-125124227 AATAACCGCTTGAACCCAGGAGG + Intergenic
997206287 5:132052126-132052148 AAAAATCGCTTGAACCCAGGAGG + Intergenic
997344632 5:133178813-133178835 AAGATTCACTTGAACCCAGGAGG - Intergenic
997594690 5:135099028-135099050 AAGAATCCCTTGAACCCAGGTGG - Intronic
997753021 5:136367122-136367144 AAGGATCACTTGAACCCAGGAGG + Intronic
997753911 5:136376524-136376546 CAGGTTCCCTTGAACCCTGGAGG + Intronic
998113901 5:139522292-139522314 ATAGACCCCTTGAACCTAGATGG + Intergenic
998119515 5:139564241-139564263 AAAAATCACTTGAACCCAGGAGG - Intronic
998666663 5:144305722-144305744 AAGAACCACTTGAACCCAGGAGG + Intronic
999035238 5:148341557-148341579 GAAGTCCACTTGAGCCCGGGAGG + Intergenic
999073838 5:148776470-148776492 AGAATCCACTTGAGCCCAGGAGG - Intergenic
999765370 5:154736653-154736675 AAAAATCACTTGAACCCAGGAGG - Intronic
999838643 5:155401079-155401101 GAAGATCGCTTGAACCCAGGAGG + Intergenic
1000062550 5:157670012-157670034 AAAAGCCTCCTGAACCCAGGTGG + Intronic
1000302153 5:159965911-159965933 AATGCTCGCTTGAACCCAGGAGG - Intronic
1000387382 5:160687673-160687695 GAGATTCCCTTGAACCCAGGAGG + Intronic
1000891103 5:166803687-166803709 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1000892265 5:166814314-166814336 AAAAATCGCTTGAACCCAGGAGG - Intergenic
1001040835 5:168333989-168334011 AAGGATCCCTTGAGCCCAGGAGG + Intronic
1001519764 5:172382816-172382838 AAAAATCGCTTGAACCCAGGAGG - Intronic
1001555152 5:172632031-172632053 AGAATCAGCTTGAACCCAGGAGG + Intergenic
1001616906 5:173049922-173049944 GAAGACCGCTTGAGCCCAGGAGG - Intergenic
1001625298 5:173127250-173127272 AAGAACCACTTGAACCCAGGAGG - Intronic
1001948628 5:175800393-175800415 AAAGTCCCCTTGAACCCAGGAGG + Intronic
1002022070 5:176369867-176369889 AAAGATCACTTGAACCCAGGAGG + Intronic
1002578654 5:180193842-180193864 AAAGTCCCCATCAGTCCAGGAGG + Intronic
1002622246 5:180496000-180496022 AAGGATCGCTTGAACCCAGGAGG - Intronic
1002767447 6:254660-254682 GAAGATCGCTTGAACCCAGGAGG - Intergenic
1003209716 6:4050997-4051019 CAAAATCCCTTGAACCCAGGAGG - Intronic
1003333692 6:5151171-5151193 GAGGATCCCTTGAACCCAGGAGG - Intronic
1003744827 6:8988808-8988830 GAAGGTCCCTTGAACCCGGGAGG - Intergenic
1003895467 6:10603603-10603625 AACGATCACTTGAACCCAGGAGG - Intronic
1003944545 6:11062034-11062056 AGAGTCGTTTTGAACCCAGGAGG + Intergenic
1003948829 6:11099262-11099284 AAGAATCCCTTGAACCCAGGAGG - Intronic
1004113006 6:12738773-12738795 AGAATCCCCTTGAACCTGGGAGG + Intronic
1004353947 6:14915355-14915377 AAGGATCGCTTGAACCCAGGAGG + Intergenic
1004355789 6:14928895-14928917 AAGGATCCCTTGAGCCCAGGAGG + Intergenic
1004449595 6:15732766-15732788 GAAGATCACTTGAACCCAGGAGG + Intergenic
1004551108 6:16647983-16648005 GAAGATCTCTTGAACCCAGGAGG + Intronic
1004659066 6:17693794-17693816 AAAAAACGCTTGAACCCAGGAGG + Intronic
1004671363 6:17800688-17800710 AAGAACCGCTTGAACCCAGGAGG - Intronic
1004710526 6:18165730-18165752 AAGAATCCCTTGAACCCAGGAGG + Intronic
1004751763 6:18568994-18569016 GAGGACCACTTGAACCCAGGAGG + Intergenic
1004765590 6:18722807-18722829 AAAGAACCACTGAACCCAGGAGG + Intergenic
1004770699 6:18777862-18777884 GAAGATCCCTTGAGCCCAGGAGG + Intergenic
1004783748 6:18942311-18942333 GAAAATCCCTTGAACCCAGGAGG - Intergenic
1004939435 6:20540543-20540565 AAGAACCGCTTGAACCCAGGAGG - Intronic
1004981466 6:21029282-21029304 AAAGATCACTTGAGCCCAGGAGG - Intronic
1005258041 6:24025291-24025313 GAAGATCGCTTGAACCCAGGAGG + Intergenic
1005327454 6:24716811-24716833 GAGATCCCCTCGAACCCAGGAGG - Intronic
1005802073 6:29436625-29436647 AAAGTTGCCTTGAACCCTGTAGG - Intronic
1005946580 6:30600284-30600306 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1006032696 6:31188932-31188954 AAAAATCACTTGAACCCAGGAGG - Intergenic
1006084565 6:31586918-31586940 AAAGTCCCCTCCAAACCACGTGG + Intronic
1006209058 6:32376966-32376988 GAAGACCCTTTGATCCCAGGAGG + Intergenic
1006324626 6:33344371-33344393 AAGGATCACTTGAACCCAGGAGG - Intergenic
1006531977 6:34663331-34663353 AAAGATCACTTGAGCCCAGGAGG + Intronic
1006590136 6:35148889-35148911 ATAGTCACCTTGAAGGCAGGAGG + Intergenic
1006762968 6:36479879-36479901 GAAAATCCCTTGAACCCAGGAGG - Intronic
1006933960 6:37704733-37704755 GAGGTTCCCTTGAGCCCAGGAGG + Intergenic
1007034974 6:38665059-38665081 AAAAATCGCTTGAACCCAGGAGG - Intergenic
1007142299 6:39588301-39588323 AAGGCTCACTTGAACCCAGGAGG - Intronic
1007175752 6:39896290-39896312 AAGAGTCCCTTGAACCCAGGAGG - Intronic
1007556818 6:42773166-42773188 AAGAATCCCTTGAACCCAGGAGG - Intronic
1007560247 6:42801791-42801813 AGAATCTGCTTGAACCCAGGAGG + Intronic
1007586820 6:42995803-42995825 AAAGATCCCTTGAGCCCAGGAGG - Intronic
1007779026 6:44241333-44241355 GGAGGACCCTTGAACCCAGGAGG - Intergenic
1007804389 6:44429109-44429131 AAGAATCCCTTGAACCCAGGAGG - Intronic
1008056770 6:46953530-46953552 AAAGATCACTTGAACCCAAGAGG + Intronic
1008147506 6:47909535-47909557 AAGGACCGCTTGAGCCCAGGAGG - Intronic
1008632546 6:53377011-53377033 AAGAACCTCTTGAACCCAGGAGG - Intergenic
1008872038 6:56284135-56284157 GAGGATCCCTTGAACCCAGGAGG - Intronic
1009400785 6:63253260-63253282 AGAATCGCCTTGAACCCGGGAGG + Intergenic
1009473940 6:64063815-64063837 GAATCCCCTTTGAACCCAGGAGG - Intronic
1009589002 6:65641877-65641899 AAAGACCACTAGAGCCCAGGAGG - Intronic
1009853120 6:69223744-69223766 AAAGATCGCTTGAATCCAGGAGG - Intronic
1009963704 6:70555353-70555375 GAGGACCCCTTGAGCCCAGGAGG - Intronic
1010483926 6:76386694-76386716 AAAAATCGCTTGAACCCAGGAGG + Intergenic
1010748341 6:79589859-79589881 AAAGATCACTTGAGCCCAGGAGG - Intergenic
1010930213 6:81792333-81792355 AAAGTGTACTTGAACCCAAGGGG - Intergenic
1011035495 6:82969516-82969538 GAGGATCCCTTGAACCCAGGTGG + Intronic
1011036158 6:82977746-82977768 AAAAATCGCTTGAACCCAGGAGG + Intronic
1011273116 6:85600088-85600110 GAAGATCGCTTGAACCCAGGAGG + Intronic
1011383836 6:86772121-86772143 AAAAATCCCTTGAACCCCGGAGG + Intergenic
1011485485 6:87836748-87836770 AAAAATCGCTTGAACCCAGGGGG - Intergenic
1011494935 6:87928272-87928294 GAGAACCCCTTGAACCCAGGAGG + Intergenic
1011565351 6:88666944-88666966 AAAGGCCTATTGAACTCAGGGGG + Intronic
1011595700 6:89013898-89013920 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1011597178 6:89027189-89027211 AAAGATCCCTTGAACCCAAGAGG - Intergenic
1011635967 6:89373526-89373548 AAGAATCCCTTGAACCCAGGAGG + Intronic
1011637942 6:89391865-89391887 AAGGATCCCTTGAGCCCAGGAGG + Intronic
1011674690 6:89721046-89721068 GAAGATCCCTTGAGCCCAGGAGG + Intronic
1011692006 6:89878934-89878956 AAGGACCACTTGAACCCAAGAGG - Intergenic
1011694831 6:89902725-89902747 GAAGACCACTTGAGCCCAGGAGG - Intergenic
1011779360 6:90769853-90769875 GAGGTTCACTTGAACCCAGGAGG - Intergenic
1012202808 6:96426873-96426895 GAAAACCACTTGAACCCAGGAGG - Intergenic
1012629333 6:101443972-101443994 TAACACCCCTTGAGCCCAGGAGG - Intronic
1013463283 6:110395941-110395963 GAAGATCCCTTGAACCGAGGAGG + Intronic
1013521406 6:110937050-110937072 AAAAATCACTTGAACCCAGGAGG + Intergenic
1013554331 6:111240975-111240997 AAAAATCGCTTGAACCCAGGAGG - Intergenic
1014469700 6:121799241-121799263 GAAGATCCCTTGAGCCCAGGAGG + Intergenic
1014677442 6:124384714-124384736 AAGGATCGCTTGAACCCAGGAGG - Intronic
1014882900 6:126745250-126745272 AGAATCGGCTTGAACCCAGGAGG + Intergenic
1015122759 6:129718800-129718822 AAAGATCCCTTGAGCCCAGGGGG + Intergenic
1015147361 6:130002391-130002413 AAGGACTGCTTGAACCCAGGAGG - Intergenic
1015283994 6:131464222-131464244 AAAAATCACTTGAACCCAGGAGG - Intergenic
1015556254 6:134464373-134464395 GAGGATCCCTTGAACCCAGGAGG + Intergenic
1015731696 6:136355083-136355105 TGTGTCTCCTTGAACCCAGGAGG + Intronic
1015947833 6:138521374-138521396 GAAGACCCCTTGAGCCCAGAAGG + Intronic
1016066217 6:139686164-139686186 AAGAACCGCTTGAACCCAGGAGG - Intergenic
1016583023 6:145650460-145650482 AAGGATCACTTGAACCCAGGAGG + Intronic
1016935622 6:149447338-149447360 AGAATCACCTTGAACCCAGGAGG - Intergenic
1017064641 6:150517968-150517990 GAGGACCCCTTGAGCCCAGGAGG - Intergenic
1017108928 6:150914038-150914060 AAGAGTCCCTTGAACCCAGGAGG + Intronic
1017496060 6:154984582-154984604 AGAATCCGCTTGAACCCTGGAGG - Intronic
1017496131 6:154985023-154985045 AGAATCCACTTGAACCCAGGAGG + Intronic
1017767454 6:157618409-157618431 AAAAATCACTTGAACCCAGGAGG - Intronic
1017871376 6:158489257-158489279 AAAGTCCGCATGAACCCAGGTGG + Intronic
1017943709 6:159076586-159076608 AAAGATCACTTGAACGCAGGAGG - Intergenic
1018014313 6:159698309-159698331 AAAAAACACTTGAACCCAGGAGG + Intronic
1018396551 6:163382343-163382365 AAGAACCACTTGAACCCAGGAGG - Intergenic
1018450811 6:163905676-163905698 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1018522175 6:164662615-164662637 AGATGCCCCTTGAACCCAAGAGG + Intergenic
1019403632 7:870494-870516 GAAGATCACTTGAACCCAGGAGG + Intronic
1019694044 7:2434675-2434697 AAAGATTGCTTGAACCCAGGAGG + Intergenic
1019963056 7:4477254-4477276 GAGAACCCCTTGAACCCAGGAGG + Intergenic
1019988263 7:4674156-4674178 GAGGACCCCTTGAGCCCAGGAGG - Intergenic
1020044921 7:5033581-5033603 GAGAACCCCTTGAACCCAGGAGG - Intronic
1020180523 7:5919072-5919094 GAAGATCACTTGAACCCAGGAGG - Intronic
1020201419 7:6083011-6083033 ACAATCAGCTTGAACCCAGGAGG - Intergenic
1020213869 7:6174201-6174223 AGAGTCGCTTCGAACCCAGGAGG - Intronic
1020217524 7:6205482-6205504 GAGAACCCCTTGAACCCAGGAGG + Intronic
1020249282 7:6454400-6454422 GAAAATCCCTTGAACCCAGGAGG + Intronic
1020290323 7:6717958-6717980 GAGAACCCCTTGAACCCAGGAGG - Intergenic
1020302407 7:6805810-6805832 GAAGATCACTTGAACCCAGGAGG + Intronic
1020424109 7:8044456-8044478 AAGGATCACTTGAACCCAGGAGG - Intronic
1020669343 7:11087279-11087301 AAAAATCGCTTGAACCCAGGAGG - Intronic
1021145679 7:17085720-17085742 AGAACCCACTTGAACCCAGGAGG - Intergenic
1021168612 7:17370801-17370823 AAAGATCCCTTGGGCCCAGGAGG + Intergenic
1021364527 7:19760448-19760470 AAAAATCGCTTGAACCCAGGAGG - Intronic
1021411466 7:20333002-20333024 AAACTCTCCTTGAGCCCAAGAGG - Intronic
1021890954 7:25185935-25185957 AAAAATCGCTTGAACCCAGGAGG - Intergenic
1021892800 7:25203414-25203436 TAAGATCCCTTGAGCCCAGGAGG - Intergenic
1021982145 7:26065390-26065412 AAGGATCACTTGAACCCAGGAGG + Intergenic
1022013195 7:26327038-26327060 AAGAACCGCTTGAACCCAGGAGG - Intronic
1022014401 7:26336613-26336635 GAAAATCCCTTGAACCCAGGAGG + Intronic
1022375073 7:29805647-29805669 AAGGATCTCTTGAACCCAGGAGG - Intergenic
1022916650 7:34962605-34962627 AAGGATCCCTTGAGCCCAGGAGG + Intronic
1023101828 7:36725921-36725943 GAAGATCACTTGAACCCAGGAGG - Intergenic
1023134838 7:37040988-37041010 AAGGATCGCTTGAACCCAGGAGG + Intronic
1023625038 7:42107239-42107261 AAGGACCCCTTGAGCCCGGGAGG + Intronic
1023770624 7:43553577-43553599 AAGGATCCCTTGAACCCGGGAGG + Intronic
1023949672 7:44833135-44833157 AAAAATCACTTGAACCCAGGAGG - Intronic
1024502432 7:50125007-50125029 AAAAATCACTTGAACCCAGGAGG + Intronic
1024520109 7:50298174-50298196 AAGGATCCCTTGAGCCCAGGAGG + Intergenic
1024630466 7:51242977-51242999 AAAGTCACCAGGCACCCAGGAGG + Intronic
1025124504 7:56334040-56334062 GAGGATCCCTTGAACCCAGGAGG - Intergenic
1025137647 7:56433382-56433404 AAGGATCACTTGAACCCAGGAGG + Intergenic
1025140705 7:56461107-56461129 GAAGATCGCTTGAACCCAGGAGG + Intergenic
1025264989 7:57449503-57449525 AAAAATCACTTGAACCCAGGAGG - Intergenic
1025822822 7:64985860-64985882 TGAGTACACTTGAACCCAGGAGG + Intronic
1025826302 7:65013648-65013670 CAGGATCCCTTGAACCCAGGAGG + Intergenic
1025955674 7:66181047-66181069 AAGGATCACTTGAACCCAGGAGG - Intergenic
1025975702 7:66367935-66367957 CAGGATCCCTTGAACCCAGGAGG - Intronic
1026693721 7:72572407-72572429 AAGAATCCCTTGAACCCAGGAGG + Intronic
1026798670 7:73382945-73382967 GAGGACCTCTTGAACCCAGGAGG + Intergenic
1026860899 7:73787861-73787883 AGAATCCCCTTGAACCTGGGAGG + Intergenic
1026911233 7:74093078-74093100 CAAGTCCCCTGGCACCCACGCGG + Intronic
1027033584 7:74909141-74909163 GAGAACCCCTTGAACCCAGGAGG - Intergenic
1027140070 7:75650540-75650562 GAAAATCCCTTGAACCCAGGAGG - Intronic
1027191436 7:75998385-75998407 AAGGATCACTTGAACCCAGGAGG - Intronic
1027248406 7:76382895-76382917 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1027260004 7:76458015-76458037 GAAGATCACTTGAACCCAGGAGG + Intergenic
1027264052 7:76484252-76484274 AAGAATCCCTTGAACCCAGGAGG + Intronic
1027282470 7:76618875-76618897 GAAGATCACTTGAACCCAGGAGG - Intronic
1027311377 7:76956119-76956141 GAAGATCACTTGAACCCAGGAGG + Intergenic
1027315421 7:76982366-76982388 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1027404182 7:77842291-77842313 GAGGTTCACTTGAACCCAGGAGG - Intronic
1028008434 7:85609469-85609491 GAAGATCCCTTGAGCCCAGGAGG - Intergenic
1028989333 7:97033346-97033368 GAAGTTCACTTGAGCCCAGGAGG + Intergenic
1029184378 7:98728044-98728066 GAAGATCGCTTGAACCCAGGAGG + Intergenic
1029191540 7:98775689-98775711 AAGGATCCCTTGAGCCCAGGAGG + Intergenic
1029397370 7:100317513-100317535 GAGAACCCCTTGAACCCAGGAGG + Intronic
1029463272 7:100708859-100708881 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1029785826 7:102789617-102789639 AAGAATCCCTTGAACCCAGGAGG + Intronic
1029874844 7:103739520-103739542 AATGTGCCATTGAACCCAAGAGG - Intronic
1030398333 7:109016654-109016676 GAGGACCACTTGAACCCAGGAGG - Intergenic
1030628542 7:111870409-111870431 AGAATCTGCTTGAACCCAGGAGG - Intronic
1031279449 7:119778845-119778867 AAGGATCCCTTGAGCCCAGGAGG - Intergenic
1031520708 7:122761906-122761928 AAGATTCTCTTGAACCCAGGAGG + Intronic
1031693198 7:124816451-124816473 TAAAACCGCTTGAACCCAGGAGG - Intergenic
1031730272 7:125291836-125291858 GAAGATCACTTGAACCCAGGAGG - Intergenic
1031746813 7:125509289-125509311 GAAGATCCCTTGAGCCCAGGAGG + Intergenic
1032041373 7:128565367-128565389 AAGGATCACTTGAACCCAGGAGG - Intergenic
1032123723 7:129175615-129175637 AAGGACCACTTGAGCCCAGGAGG + Intergenic
1032401137 7:131625197-131625219 AAGAACCACTTGAACCCAGGAGG + Intergenic
1032875291 7:136031975-136031997 AAGGACCGCTTGAACCCAGGAGG + Intergenic
1032890758 7:136192484-136192506 GAAGACCACTTGAGCCCAGGAGG - Intergenic
1032936858 7:136742808-136742830 AAAGTCCACATGTACCCAGATGG + Intergenic
1033004020 7:137540594-137540616 GAAGATCACTTGAACCCAGGAGG + Intronic
1033112038 7:138588609-138588631 AGAATCGGCTTGAACCCAGGAGG + Exonic
1033169047 7:139067236-139067258 AGAATTCGCTTGAACCCAGGAGG - Intronic
1033196766 7:139334213-139334235 AAAAATCGCTTGAACCCAGGAGG - Intergenic
1033212371 7:139469533-139469555 GAAGAACACTTGAACCCAGGAGG - Intronic
1033314354 7:140285336-140285358 GAAGATCACTTGAACCCAGGAGG + Intergenic
1033318749 7:140320494-140320516 AAAAATCACTTGAACCCAGGAGG + Intronic
1033339961 7:140484393-140484415 AAGAACCACTTGAACCCAGGAGG - Intergenic
1033394766 7:140963098-140963120 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1033442766 7:141395349-141395371 GAAGACCACTTGAGCCCAGGAGG + Intronic
1033797925 7:144869953-144869975 GAAGATCACTTGAACCCAGGAGG + Intergenic
1033813792 7:145048656-145048678 AAGGACTGCTTGAACCCAGGAGG - Intergenic
1033943623 7:146686204-146686226 GAAGATCCCTTGAACCCAGGAGG + Intronic
1033974801 7:147087885-147087907 GAGATCCCCTTGAACCCGGGAGG + Intronic
1034141472 7:148822418-148822440 AAGAATCCCTTGAACCCAGGAGG + Intronic
1034214278 7:149392728-149392750 AAGGTTCACTTGAGCCCAGGAGG + Intergenic
1034550309 7:151816167-151816189 AAAGTCACTTTCAGCCCAGGAGG + Intronic
1034575111 7:151990130-151990152 AAAAATCACTTGAACCCAGGAGG - Intronic
1034594703 7:152179078-152179100 AAGGATCACTTGAACCCAGGAGG - Intronic
1034650993 7:152690139-152690161 AAAGACCCCTGGAACCTGGGAGG - Intergenic
1034748278 7:153543830-153543852 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1034818603 7:154196398-154196420 AAGAATCCCTTGAACCCAGGAGG + Intronic
1035022938 7:155809559-155809581 AAGGTCCCCTAAAACCGAGGGGG - Intronic
1035073574 7:156162236-156162258 GAAAATCCCTTGAACCCAGGAGG + Intergenic
1035194132 7:157201232-157201254 GAGAACCCCTTGAACCCAGGAGG + Intronic
1035425667 7:158770922-158770944 GAAGATCCCTTGAGCCCAGGGGG + Intronic
1036015085 8:4774108-4774130 AGGGTTCACTTGAACCCAGGAGG + Intronic
1036046375 8:5145760-5145782 AAAGTCTCCTTGAAAACAGGAGG + Intergenic
1036062407 8:5338571-5338593 TAGGATCCCTTGAACCCAGGAGG + Intergenic
1036181088 8:6586048-6586070 AAGGATCACTTGAACCCAGGAGG - Intronic
1036470886 8:9051565-9051587 AAGGATCACTTGAACCCAGGAGG + Intronic
1036741090 8:11362253-11362275 GAGGATCCCTTGAACCCAGGAGG - Intergenic
1036822668 8:11952889-11952911 AAGAACCCCTTGAACCCAGGAGG + Intergenic
1037213057 8:16415575-16415597 AAGAACCACTTGAACCCAGGAGG + Intronic
1037317279 8:17610819-17610841 GAGATTCCCTTGAACCCAGGAGG + Intronic
1037668160 8:20989935-20989957 AAAGACCCCTTGTACACAGCTGG - Intergenic
1038070568 8:24008303-24008325 AGAATTCACTTGAACCCAGGAGG + Intergenic
1038130351 8:24723583-24723605 GAGGCTCCCTTGAACCCAGGAGG + Intergenic
1038286217 8:26208565-26208587 AAAGGTCACTTGAACCCAGGAGG - Intergenic
1038289008 8:26231994-26232016 GAAGATCGCTTGAACCCAGGAGG + Intergenic
1038302629 8:26368709-26368731 AAGGACTGCTTGAACCCAGGAGG + Intronic
1038312984 8:26459473-26459495 AAGAATCCCTTGAACCCAGGAGG - Intronic
1038594767 8:28878400-28878422 GAGGTCCACTTGAGCCCAGGAGG - Intronic
1038654010 8:29431931-29431953 GAAGATCCCTTGAACCCAGGAGG + Intergenic
1038776871 8:30539300-30539322 CAAGTCCCCTGGAAAGCAGGTGG - Intronic
1038803866 8:30773148-30773170 GAAAACCACTTGAACCCAGGAGG - Intergenic
1038921378 8:32088605-32088627 AAAAATCGCTTGAACCCAGGAGG - Intronic
1039059402 8:33561630-33561652 AAGGATCACTTGAACCCAGGAGG - Intronic
1039263916 8:35803947-35803969 GAAGATCGCTTGAACCCAGGAGG + Intergenic
1039508799 8:38072351-38072373 AAAAATCACTTGAACCCAGGAGG + Intergenic
1039567803 8:38563916-38563938 GAAGTCTCCTTGGACACAGGAGG - Intergenic
1039963701 8:42269228-42269250 GAGGACCCCTTGAACCCAGGAGG + Intergenic
1039993253 8:42508072-42508094 AGAATCTGCTTGAACCCAGGAGG + Intronic
1040430524 8:47337215-47337237 AAGGTCAGGTTGAACCCAGGAGG - Intronic
1040848044 8:51866087-51866109 AAAGTAAACTTTAACCCAGGAGG + Intronic
1041180801 8:55246010-55246032 AAGAACCGCTTGAACCCAGGAGG + Intronic
1041234266 8:55783327-55783349 GAAAATCCCTTGAACCCAGGAGG + Intronic
1041445744 8:57949238-57949260 AAAAATCACTTGAACCCAGGAGG + Intergenic
1041478623 8:58294062-58294084 AGAATCCACTTGAACCCAGGCGG - Intergenic
1041664168 8:60426301-60426323 GAAAATCCCTTGAACCCAGGAGG + Intergenic
1041693980 8:60716157-60716179 AAAGGCCACTTGGACCCGGGTGG - Intronic
1042215479 8:66426669-66426691 GAGGTCCACTTGAACCCAGGAGG + Intergenic
1042895064 8:73657922-73657944 AAGGATCGCTTGAACCCAGGAGG + Intronic
1043457576 8:80427701-80427723 AAGGATCACTTGAACCCAGGAGG + Intergenic
1043464879 8:80494833-80494855 GAGGATCCCTTGAACCCAGGAGG + Intronic
1043474273 8:80591119-80591141 GAGGATCCCTTGAACCCAGGAGG - Intergenic
1043606970 8:82012928-82012950 AGAGTCGGCTTGAACCCAGGGGG - Intergenic
1043855614 8:85261933-85261955 GAGGATCCCTTGAACCCAGGAGG - Intronic
1044007302 8:86953775-86953797 AAAAATCACTTGAACCCAGGAGG + Intronic
1044567676 8:93682576-93682598 GAAGACCGCTTGAGCCCAGGAGG + Intergenic
1044640631 8:94377444-94377466 GAAGACTGCTTGAACCCAGGAGG + Intronic
1044641960 8:94392349-94392371 GAGGTTCCCTTGAACCCGGGAGG - Intronic
1044963645 8:97555093-97555115 AAGGACCACTTGAGCCCAGGAGG + Intergenic
1045292604 8:100846743-100846765 GAGGATCCCTTGAACCCAGGAGG - Intergenic
1045810371 8:106214325-106214347 AAGGATCCCTTGAACCCAGGAGG + Intergenic
1045894653 8:107200179-107200201 AATATCCCCTTGAACTAAGGTGG - Intergenic
1046412445 8:113864019-113864041 AAATTCCGCTTGAACCTGGGAGG - Intergenic
1046593086 8:116228990-116229012 GAAGGCCACCTGAACCCAGGAGG - Intergenic
1047668585 8:127119889-127119911 GAGGACCACTTGAACCCAGGAGG - Intergenic
1047758580 8:127937335-127937357 AAAAATCACTTGAACCCAGGAGG - Intergenic
1048001199 8:130380806-130380828 AAAGATCACTTGAGCCCAGGAGG - Intronic
1048112524 8:131484286-131484308 AGAGATCACTTGAACCCAGGAGG + Intergenic
1048183044 8:132213784-132213806 AAGGTCCCCTTGACCTCACGGGG + Intronic
1048668642 8:136692353-136692375 GAAACTCCCTTGAACCCAGGAGG + Intergenic
1049723477 8:144133138-144133160 AGAATCCACTTGAACCCAGGAGG + Intergenic
1049727262 8:144153848-144153870 AAGAACCGCTTGAACCCAGGAGG - Intronic
1049962969 9:754086-754108 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1050557691 9:6803909-6803931 AGAATCACTTTGAACCCAGGAGG - Intronic
1050559197 9:6817289-6817311 GAAGACTGCTTGAACCCAGGAGG - Intronic
1050600060 9:7241629-7241651 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1051082856 9:13313191-13313213 GAAGATCACTTGAACCCAGGAGG - Intergenic
1051280603 9:15439622-15439644 AAGATTCACTTGAACCCAGGAGG - Intronic
1051676276 9:19561522-19561544 GAAAATCCCTTGAACCCAGGAGG - Intronic
1051797158 9:20884967-20884989 AAGAATCCCTTGAACCCAGGCGG + Intronic
1051848130 9:21475960-21475982 GAAATTCGCTTGAACCCAGGAGG + Intergenic
1052025904 9:23572877-23572899 AAGGATCCCTTGAGCCCAGGAGG + Intergenic
1052543350 9:29839993-29840015 AAAAATCGCTTGAACCCAGGAGG - Intergenic
1052954614 9:34243937-34243959 AAGAATCCCTTGAACCCAGGAGG - Intronic
1053218967 9:36295458-36295480 GAGGATCCCTTGAACCCAGGAGG + Intronic
1053348181 9:37393563-37393585 GAAGACGCCTTGAGCCCAGGAGG + Intergenic
1053439601 9:38105350-38105372 GAAGATCCCTTGAGCCCAGGAGG - Intergenic
1053448236 9:38169962-38169984 AATGTCCTCTTTATCCCAGGTGG - Intergenic
1053460216 9:38262891-38262913 AAAAATCACTTGAACCCAGGAGG + Intergenic
1053488421 9:38480069-38480091 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1053579645 9:39391267-39391289 AAGATTCGCTTGAACCCAGGAGG + Intergenic
1053623372 9:39843357-39843379 AAACTAACCTTGAACCCAGAGGG - Intergenic
1053797105 9:41736581-41736603 AAAAATCACTTGAACCCAGGAGG - Intergenic
1053844160 9:42219347-42219369 AAGATTCGCTTGAACCCAGGAGG + Intergenic
1053881496 9:42599871-42599893 AAACTAACCTTGAACCCAGAGGG + Intergenic
1053891169 9:42694441-42694463 AAACTAACCTTGAACCCAGAGGG - Intergenic
1054101232 9:60950076-60950098 AAGATTCGCTTGAACCCAGGAGG + Intergenic
1054148092 9:61578287-61578309 AAAAATCACTTGAACCCAGGAGG + Intergenic
1054185519 9:61948662-61948684 AAAAATCACTTGAACCCAGGAGG - Intergenic
1054220527 9:62407342-62407364 AAACTAACCTTGAACCCAGAGGG + Intergenic
1054230188 9:62501830-62501852 AAACTAACCTTGAACCCAGAGGG - Intergenic
1054467832 9:65509381-65509403 AAAAATCACTTGAACCCAGGAGG + Intergenic
1055042897 9:71894433-71894455 AGAGCCTACTTGAACCCAGGAGG - Intronic
1055055573 9:72021072-72021094 AGAATTGCCTTGAACCCAGGAGG + Intergenic
1055498589 9:76881055-76881077 AAAAATCGCTTGAACCCAGGGGG - Intronic
1055582695 9:77724278-77724300 AGATTTCGCTTGAACCCAGGAGG - Intronic
1055875997 9:80942022-80942044 AGAATCCCCTTGAACCAGGGAGG + Intergenic
1055939058 9:81631998-81632020 AAAAATCGCTTGAACCCAGGAGG + Intronic
1055962455 9:81833468-81833490 AAGAACCACTTGAACCCAGGAGG + Intergenic
1056141410 9:83683929-83683951 GAAGACTACTTGAACCCAGGAGG + Intronic
1056349424 9:85734161-85734183 AAGGATCGCTTGAACCCAGGAGG + Intronic
1057103819 9:92391507-92391529 AAGAATCCCTTGAACCCAGGAGG + Intronic
1057124968 9:92609828-92609850 GAGAACCCCTTGAACCCAGGAGG - Intronic
1057145031 9:92752665-92752687 AAAGATCACTTGAGCCCAGGAGG + Intronic
1057556704 9:96093991-96094013 GAAGATCACTTGAACCCAGGAGG + Intergenic
1058121676 9:101145924-101145946 GAGGACCCCTTGAGCCCAGGAGG + Intronic
1058276018 9:103042296-103042318 GAAGATCCCTTGAACCCAGGAGG + Intergenic
1058334268 9:103805860-103805882 GAAAACCGCTTGAACCCAGGTGG + Intergenic
1058443244 9:105029935-105029957 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1058457289 9:105149287-105149309 AAGAACCACTTGAACCCAGGAGG - Intergenic
1058482402 9:105409593-105409615 GAAGATCCCTTGAGCCCAGGAGG + Intronic
1058526941 9:105868542-105868564 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1058685397 9:107475766-107475788 GAAGATCCCTTGAGCCCAGGAGG - Intergenic
1058688952 9:107503054-107503076 GAGGACCACTTGAACCCAGGAGG + Intergenic
1059119263 9:111627361-111627383 AATGATCACTTGAACCCAGGAGG + Intergenic
1059138099 9:111826614-111826636 GAAGATCACTTGAACCCAGGAGG + Intergenic
1059183915 9:112247142-112247164 AAGGATCACTTGAACCCAGGAGG + Intronic
1059241175 9:112807152-112807174 AGAATCCCCTTGAACCCAGAGGG - Intronic
1059280461 9:113128921-113128943 AAAAATCGCTTGAACCCAGGAGG + Intergenic
1059456836 9:114405162-114405184 GAGGACCACTTGAACCCAGGAGG - Intronic
1059550211 9:115221387-115221409 AAGAACCGCTTGAACCCAGGAGG + Intronic
1059845851 9:118275882-118275904 GAAAATCCCTTGAACCCAGGAGG - Intergenic
1060168782 9:121443396-121443418 GAAGATCACTTGAACCCAGGAGG - Intergenic
1060529144 9:124338068-124338090 AAGAAACCCTTGAACCCAGGAGG - Intronic
1060584121 9:124775543-124775565 AAAAATCACTTGAACCCAGGAGG - Intergenic
1060628540 9:125135561-125135583 AAGAACCACTTGAACCCAGGAGG + Intronic
1060651438 9:125330406-125330428 GAAGACTGCTTGAACCCAGGAGG - Intronic
1060810593 9:126609784-126609806 ACAGCGACCTTGAACCCAGGTGG - Intergenic
1060834203 9:126742727-126742749 AAGAACCACTTGAACCCAGGAGG + Intergenic
1061050624 9:128192630-128192652 GAGGACCACTTGAACCCAGGAGG - Intronic
1061197814 9:129117491-129117513 AAGAACCGCTTGAACCCAGGAGG - Intronic
1061240260 9:129366315-129366337 GAGGATCCCTTGAACCCAGGAGG - Intergenic
1061310825 9:129761209-129761231 AAGAACCGCTTGAACCCAGGAGG - Intergenic
1061608105 9:131726912-131726934 AAAGACTCCTTGAGCTCAGGAGG + Intronic
1061872993 9:133530521-133530543 AAAGTCCACTTGGACTCAGGCGG + Intergenic
1061967187 9:134021961-134021983 GAAAACCACTTGAACCCAGGAGG - Intergenic
1061988617 9:134145186-134145208 GAGAACCCCTTGAACCCAGGAGG - Intronic
1062036565 9:134385161-134385183 TAAGTCCCCATCCACCCAGGAGG - Intronic
1062317038 9:135972492-135972514 GAATTTCGCTTGAACCCAGGAGG - Intergenic
1062413830 9:136438183-136438205 GAGGATCCCTTGAACCCAGGAGG + Intronic
1062485538 9:136773279-136773301 AAAGGCCCCTTGAACACAAACGG + Intergenic
1062508031 9:136887957-136887979 AAAAATCGCTTGAACCCAGGAGG - Intronic
1062581203 9:137230042-137230064 AAAGTCCCCATGCACACAGCGGG + Intergenic
1203747380 Un_GL000218v1:48422-48444 AAGAGTCCCTTGAACCCAGGAGG - Intergenic
1185562635 X:1071605-1071627 GAAGATCTCTTGAACCCAGGAGG - Intergenic
1185834585 X:3333211-3333233 GAAGACCACTTGAACCCAGGAGG + Intronic
1185865714 X:3622052-3622074 AAGAACCGCTTGAACCCAGGAGG + Intronic
1185873915 X:3686645-3686667 AAAAATCGCTTGAACCCAGGAGG - Intronic
1185916876 X:4045427-4045449 AAAAATCACTTGAACCCAGGAGG - Intergenic
1186100032 X:6146023-6146045 AAGGATCCCTTGAGCCCAGGAGG + Intronic
1186264883 X:7821374-7821396 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1186319570 X:8409877-8409899 AAGATTCACTTGAACCCAGGAGG - Intergenic
1186476083 X:9858713-9858735 AAAAATCGCTTGAACCCAGGAGG + Intronic
1186652833 X:11579206-11579228 AAAGTCCCCTTGAATAAAAGTGG - Intronic
1187227392 X:17386571-17386593 AGAATCACTTTGAACCCAGGAGG + Intronic
1187334803 X:18372804-18372826 GAGGACCGCTTGAACCCAGGAGG - Intergenic
1187336946 X:18389591-18389613 AGAATCCCTTAGAACCCAGGAGG + Intergenic
1187443034 X:19337132-19337154 AGGGTACACTTGAACCCAGGAGG - Intergenic
1187496712 X:19801986-19802008 AAGGATCACTTGAACCCAGGAGG + Intronic
1187555738 X:20349491-20349513 AGAATCCGCTTGAACCCAGGAGG + Intergenic
1187703979 X:21991265-21991287 AAGAACCGCTTGAACCCAGGAGG - Intronic
1187841770 X:23495934-23495956 AAAAATCGCTTGAACCCAGGGGG + Intergenic
1187897809 X:23998993-23999015 AGAATCCGCTTGAACCCAGGAGG - Intronic
1188237994 X:27752577-27752599 GAGGATCCCTTGAACCCAGGAGG - Intergenic
1188689860 X:33116101-33116123 AAAAATCGCTTGAACCCAGGAGG + Intronic
1188854013 X:35170112-35170134 GGAGAACCCTTGAACCCAGGAGG - Intergenic
1188889212 X:35589079-35589101 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1189298279 X:39934453-39934475 GAGGATCCCTTGAACCCAGGAGG + Intergenic
1189339667 X:40195148-40195170 AAGAATCCCTTGAACCCAGGAGG - Intergenic
1189395069 X:40613953-40613975 AGAATCACCTTGAACCTAGGAGG + Intergenic
1189477185 X:41365223-41365245 AAAGATTGCTTGAACCCAGGAGG - Intergenic
1189786808 X:44566331-44566353 GAAAATCCCTTGAACCCAGGAGG - Intergenic
1190040722 X:47069373-47069395 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1190194703 X:48307090-48307112 AAGGATCCCTTGAGCCCAGGAGG - Intergenic
1190328524 X:49221496-49221518 CAAGCTCGCTTGAACCCAGGAGG - Intronic
1190661183 X:52655571-52655593 AAGGATCCCTTGAGCCCAGGAGG - Intronic
1190764363 X:53463876-53463898 GAAGATCCCTTGAACCCAGGAGG - Intergenic
1190854664 X:54282127-54282149 AAGGATCCCTTGAACCCAAGAGG - Intronic
1191632524 X:63337631-63337653 GAAATTCGCTTGAACCCAGGAGG - Intergenic
1191810830 X:65186400-65186422 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1192399199 X:70817592-70817614 GAGAACCCCTTGAACCCAGGTGG + Intronic
1192612566 X:72582156-72582178 AAAGTTGCCTGGAACTCAGGAGG - Intronic
1193138394 X:77999084-77999106 AAGGATCGCTTGAACCCAGGAGG - Intronic
1193373035 X:80721934-80721956 AAGAACCGCTTGAACCCAGGAGG - Intronic
1193409955 X:81150474-81150496 AGAATCGCTTTGAACCCAGGAGG + Intronic
1194026539 X:88759829-88759851 GAGGACCCCTTGATCCCAGGAGG + Intergenic
1194036707 X:88883891-88883913 AAGGATCCCTTGAGCCCAGGAGG + Intergenic
1194641607 X:96409395-96409417 AAGAATCCCTTGAACCCAGGAGG + Intergenic
1195031487 X:100931040-100931062 GACAACCCCTTGAACCCAGGAGG + Intergenic
1195800039 X:108698452-108698474 AGAATCGCCTTGAACCCAGGAGG - Intergenic
1195865572 X:109429322-109429344 AGAATCGCCTTGAACCCAGGAGG + Intronic
1196056205 X:111357915-111357937 AAGAATCCCTTGAACCCAGGAGG - Intronic
1196319293 X:114269357-114269379 AAGGATCACTTGAACCCAGGAGG - Intergenic
1196685250 X:118505111-118505133 AAGGATCACTTGAACCCAGGAGG - Intronic
1196851243 X:119941048-119941070 AAGAACCACTTGAACCCAGGAGG + Intronic
1196852151 X:119947725-119947747 GAAGATCGCTTGAACCCAGGAGG - Intergenic
1196933665 X:120707228-120707250 GAAGATCTCTTGAACCCAGGAGG + Intergenic
1197254390 X:124247258-124247280 GAGGATCCCTTGAACCCAGGAGG - Intronic
1197511912 X:127380366-127380388 GAGGACCACTTGAACCCAGGAGG - Intergenic
1197606106 X:128587591-128587613 AAGAACCACTTGAACCCAGGGGG - Intergenic
1197944491 X:131823643-131823665 AAGAACCACTTGAACCCAGGAGG + Intergenic
1198038369 X:132823759-132823781 AAAAATCACTTGAACCCAGGAGG + Intronic
1198086625 X:133288433-133288455 GAGGAACCCTTGAACCCAGGAGG + Intergenic
1198113193 X:133521045-133521067 GAAGATCACTTGAACCCAGGAGG - Intergenic
1198206881 X:134474507-134474529 AAGGATCGCTTGAACCCAGGAGG - Intronic
1198375299 X:136032951-136032973 GAAGTTCACTTGAACCCGGGAGG - Intronic
1198472853 X:136965385-136965407 GAAGACCGCTTGAGCCCAGGAGG - Intergenic
1198744474 X:139875505-139875527 AAAGATCCCTTGAGCCCAGAAGG + Intronic
1198809045 X:140516715-140516737 GAGGTTCACTTGAACCCAGGAGG + Intergenic
1199357873 X:146882379-146882401 GAAGATCACTTGAACCCAGGAGG + Intergenic
1199394252 X:147316244-147316266 AGAATTCGCTTGAACCCAGGAGG - Intergenic
1199753184 X:150840497-150840519 GAAGATCACTTGAACCCAGGAGG - Intronic
1199774086 X:150995804-150995826 AGAATCTGCTTGAACCCAGGAGG - Intergenic
1200853275 Y:7909033-7909055 AAAGATCCCTTGAACCCAGGAGG - Intergenic
1200899544 Y:8415808-8415830 GAGGCTCCCTTGAACCCAGGAGG - Intergenic
1201236079 Y:11913465-11913487 AAGAACCACTTGAACCCAGGAGG - Intergenic
1201280850 Y:12340713-12340735 GAGGATCCCTTGAACCCAGGAGG - Intergenic
1201293576 Y:12445361-12445383 AAAGATTGCTTGAACCCAGGAGG + Intergenic
1201706328 Y:16941213-16941235 CAGGATCCCTTGAACCCAGGAGG - Intergenic
1202097139 Y:21263590-21263612 AAAAATCACTTGAACCCAGGAGG - Intergenic
1202301528 Y:23420767-23420789 AGAATCACTTTGAACCCAGGAGG - Intergenic
1202569283 Y:26249831-26249853 AGAATCACTTTGAACCCAGGAGG + Intergenic