ID: 1001951719

View in Genome Browser
Species Human (GRCh38)
Location 5:175821028-175821050
Sequence ATCCCAGGACAACCCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001951719_1001951724 11 Left 1001951719 5:175821028-175821050 CCTCCTGGGGGTTGTCCTGGGAT 0: 1
1: 0
2: 3
3: 8
4: 155
Right 1001951724 5:175821062-175821084 TCCTGGCTGCTCCTGACCCCTGG 0: 1
1: 0
2: 6
3: 66
4: 587
1001951719_1001951723 -6 Left 1001951719 5:175821028-175821050 CCTCCTGGGGGTTGTCCTGGGAT 0: 1
1: 0
2: 3
3: 8
4: 155
Right 1001951723 5:175821045-175821067 TGGGATTTGGCAAAAGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001951719 Original CRISPR ATCCCAGGACAACCCCCAGG AGG (reversed) Intronic
900902304 1:5525327-5525349 CTCCTAGGACAACTCACAGGGGG + Intergenic
900953803 1:5874693-5874715 TTCCCAGGAGGACCCACAGGAGG + Intronic
901476719 1:9495081-9495103 CTCCCAGGACACACCCCAAGCGG - Intergenic
902930032 1:19724600-19724622 ATCCTAGAATAACCCCCAGAGGG + Intronic
903846152 1:26280836-26280858 CTCCCAGGACAACGCCCTGAGGG + Exonic
904701648 1:32361755-32361777 GTCCCAGGACAGCCCGGAGGCGG - Exonic
914230037 1:145757337-145757359 ATCCCAGCAGAAACCCAAGGTGG + Intronic
920355549 1:205369372-205369394 ATCTGAGGACAACTCTCAGGAGG + Intergenic
921584544 1:216931613-216931635 GTCCCAGGAGAACCCTGAGGAGG - Intronic
921924307 1:220698836-220698858 CTCCCAGGACAACCCCTAGGAGG - Exonic
922429417 1:225534196-225534218 AGCCCGGAAAAACCCCCAGGAGG + Intronic
922623096 1:227006485-227006507 ATCCTCAGACAAGCCCCAGGAGG - Intronic
922641583 1:227237651-227237673 ATTCCAGGACAAACCACAGATGG - Intronic
1063533310 10:6857330-6857352 TTTACAGGACAACCCCCACGAGG + Intergenic
1066807538 10:39275651-39275673 ATCCCAGGACAAAAACCAGAAGG - Intergenic
1070286579 10:75087906-75087928 AGGCCAGCAGAACCCCCAGGAGG + Intergenic
1070397819 10:76027123-76027145 ATCCAAGGACAACCACCAGGAGG - Intronic
1070694503 10:78552009-78552031 ATCAAAGGGCTACCCCCAGGAGG - Intergenic
1070806677 10:79274922-79274944 ATGGCAGGCCAGCCCCCAGGAGG + Intronic
1073547938 10:104368524-104368546 ATCCCAGGAAAACCAACAGAAGG + Exonic
1075223063 10:120601061-120601083 AGCTCAGGACCACCCCCTGGTGG + Intergenic
1076739523 10:132476458-132476480 TTCCCAGGACACAGCCCAGGTGG - Intergenic
1077382243 11:2249642-2249664 GCCCCAGCACAGCCCCCAGGTGG + Intergenic
1078084530 11:8225739-8225761 ATCCCAGTTCAACCACCAGGTGG + Intronic
1078932425 11:15922494-15922516 GACCCAGGATAACCCACAGGAGG - Intergenic
1080756297 11:35202763-35202785 ATCCCATTACAAACCCCAGTAGG + Intronic
1081738198 11:45419858-45419880 GTCCCAGGACCACTCCCATGGGG + Intergenic
1082797306 11:57387575-57387597 ATCCCAACTCAACCCACAGGAGG + Intronic
1083169844 11:60916872-60916894 ATCCAAGGACCTCCACCAGGAGG - Intronic
1083259871 11:61517103-61517125 TTCCCAGAACTACCGCCAGGTGG - Intronic
1084707642 11:70824568-70824590 ATCCCAGGCCAAGCCCCTCGAGG - Intronic
1084876898 11:72139741-72139763 AGCCCAGGGCAACCCCAATGAGG + Exonic
1084884700 11:72196051-72196073 AGCCCAGGGCAACCCCAATGAGG + Exonic
1084887674 11:72221624-72221646 AGCCCAGGGCAACCCCAACGAGG + Exonic
1085049624 11:73373469-73373491 ATCCTAGGCTAACCCCCAGCGGG - Intergenic
1086260048 11:84928722-84928744 ATCTCAGGAAAATCCCAAGGAGG - Intronic
1086318305 11:85616539-85616561 ATGCCAGGACAAAACCCAGAAGG + Intronic
1090933395 11:131320123-131320145 ATTCCAGGAAAAACCACAGGAGG + Intergenic
1098067459 12:66633928-66633950 AGTCCAGGATAACCCTCAGGTGG + Intronic
1099780124 12:87183424-87183446 AGCCCAGGACAACAGCCAGGAGG + Intergenic
1100269915 12:93014790-93014812 ATCCCAGGACAAGAGGCAGGAGG + Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1101862592 12:108495152-108495174 AGCCCAAGACAGCCTCCAGGGGG - Intergenic
1101935331 12:109052527-109052549 ACCGCAGGACAGCTCCCAGGGGG - Intronic
1102245503 12:111353301-111353323 AGGCCAGGACAGCCCCCAGGAGG + Intergenic
1102464543 12:113120735-113120757 AGACCAGGAAAACCCACAGGTGG - Intronic
1105070905 12:133234095-133234117 AGCCCAGGCCTACCTCCAGGAGG + Exonic
1105325924 13:19370620-19370642 ATCCCAGGACTGGCCCCAGTGGG - Intergenic
1105867583 13:24474474-24474496 ATCCCAGGACTGGCCCCAGTGGG + Intronic
1106411421 13:29514097-29514119 ATCCCAGAACAGTCCCCGGGAGG + Exonic
1108594158 13:51935930-51935952 TTCCCAGAACCACCCACAGGTGG + Intronic
1110594824 13:77308691-77308713 ATCCCAGGAAAAACACCAGTAGG + Intronic
1111858211 13:93667678-93667700 ATCCCAGCACAAGGCCAAGGTGG - Intronic
1112439213 13:99413834-99413856 AGTCAAGGACAGCCCCCAGGTGG + Intergenic
1118348515 14:64957271-64957293 ATCCCAGCACAGCCCTTAGGAGG - Intronic
1119024407 14:71141104-71141126 ATCCTAGAACAACCCTGAGGTGG + Intergenic
1121599283 14:95191130-95191152 ACCCCAGGCCAAGCCCCAGCTGG - Exonic
1122241918 14:100374705-100374727 ATCCCTGGAATACCACCAGGAGG + Intronic
1123112670 14:105880487-105880509 GTCTCAGGAAGACCCCCAGGAGG - Intergenic
1128680628 15:69648797-69648819 AACTAAGGACAACCCCCAAGAGG - Intergenic
1128777375 15:70331912-70331934 TTCCCAGGACAAACCCCACTTGG + Intergenic
1129891543 15:79075035-79075057 AACCCAGGTCAAGCCTCAGGAGG - Intronic
1132780980 16:1625297-1625319 AGCCCAAGACGACCCCGAGGAGG - Intronic
1133021354 16:2968276-2968298 AGTCCAGGACCACCCCCAGAGGG - Exonic
1133169335 16:3971392-3971414 CTCCCAAGACCAGCCCCAGGTGG - Intronic
1133256168 16:4517785-4517807 ACCCCAGGACCAGCCCCAAGAGG - Intronic
1135484335 16:22850896-22850918 ATCCCAGTAGAACCCTCAGATGG - Intronic
1136280361 16:29205060-29205082 ACCCTAGGACAACCTCTAGGAGG + Intergenic
1139923397 16:70473147-70473169 CTCCCAGGACAGGCGCCAGGAGG - Exonic
1142024101 16:87803277-87803299 ATTCCAGGCCAGGCCCCAGGAGG + Intergenic
1142084726 16:88171002-88171024 ACCCTAGGACAACCTCTAGGAGG + Intergenic
1142277266 16:89127052-89127074 TTCCCAGGACAAACCCCACTTGG + Intronic
1142425187 16:89998760-89998782 ACACCAGGACAGCCCTCAGGAGG - Intergenic
1144786065 17:17832239-17832261 ATCCCCTGACAACCCCAAGTAGG - Intronic
1145065005 17:19756111-19756133 AGCACAGGACACGCCCCAGGTGG - Intergenic
1153715522 18:7843927-7843949 ATCCCAGCAGCAGCCCCAGGTGG - Intronic
1153778938 18:8477716-8477738 AGGCAAGGACAACCGCCAGGTGG - Intergenic
1155035129 18:22019642-22019664 AAGGCAGGACAGCCCCCAGGTGG + Intergenic
1156924504 18:42559292-42559314 AGCCCTGGACAAACCCCAGCAGG - Intergenic
1159370855 18:67525986-67526008 AGCCCAGGACAACACACAGTAGG - Intergenic
1164334486 19:24299467-24299489 ATCCCAGGACAAAAACCAGAAGG + Intergenic
1165388065 19:35523390-35523412 ATCCCAGTACAACCCCCTTCAGG + Exonic
1165726967 19:38119642-38119664 GGCCCAGGACTACGCCCAGGGGG + Exonic
1166270794 19:41712216-41712238 ATCCTGGGACCTCCCCCAGGTGG + Intronic
1167499366 19:49836615-49836637 ATCCCAGGAGCACACACAGGAGG - Intronic
925158444 2:1664329-1664351 ATCCCAGGACAGGAACCAGGAGG + Intronic
927448398 2:23185864-23185886 ATCCCTGAACTACCCCCAAGTGG + Intergenic
927639574 2:24838197-24838219 ATCCCAAGACCACATCCAGGAGG - Intronic
932417700 2:71583810-71583832 ATCCAAGGACCACAGCCAGGAGG - Intronic
932732658 2:74232054-74232076 ATCCCAGGACAGCCTTCTGGAGG + Intronic
933159591 2:79009281-79009303 ATGCCAGGACAAACCCTGGGAGG - Intergenic
935663895 2:105493746-105493768 ATCCGAGGACTATCCCCATGTGG + Intergenic
936449798 2:112625626-112625648 ATCCCAGGACAACCCTAGGGGGG + Intergenic
938319526 2:130353934-130353956 ATCCCAGGGAAACACCCAGCTGG + Intergenic
946828622 2:223705109-223705131 ACACCAGGACAACCCCCATGAGG + Intergenic
947959264 2:234221343-234221365 ATCCCGGGAGAACCCCCAAATGG + Intergenic
1172150555 20:32787370-32787392 AGCCCAGGACAGCCAGCAGGGGG + Exonic
1176031055 20:63011967-63011989 ATGCCAGGGCAACCCAGAGGTGG - Intergenic
1176200416 20:63857906-63857928 ATCCCAGTACACACCCCTGGGGG - Intergenic
1177487444 21:21777758-21777780 AGCCCATGAAAACACCCAGGTGG - Intergenic
1177594752 21:23224143-23224165 ATCCCAAGGCAGCCCCAAGGTGG + Intergenic
1179535045 21:42046071-42046093 CTCCCCAGACAACCCCCAAGAGG + Intergenic
1179607249 21:42524875-42524897 GCCCCAGGACAACCTCCTGGGGG + Intronic
1179935674 21:44602228-44602250 AGCCCAGGACCACCCGCGGGTGG - Intronic
1180188347 21:46151321-46151343 TTCCCTGGAAAATCCCCAGGAGG + Intronic
1182052413 22:27323647-27323669 ACCCCAGGCCAACCCACAAGAGG + Intergenic
1183336114 22:37247568-37247590 ATCCCAGGACCACCTGCAGATGG - Intergenic
1183492129 22:38122327-38122349 GTCCCAGGACAATGTCCAGGGGG + Intronic
1184051544 22:42009161-42009183 ATCCCAGCACAAGGCCAAGGTGG - Intronic
952748379 3:36803340-36803362 GTCCCAGCACAGCCCCCATGGGG - Intergenic
953718120 3:45333264-45333286 AGGGGAGGACAACCCCCAGGTGG + Intergenic
957127754 3:76184292-76184314 AGCCCAGGGCAACCCACTGGAGG - Intronic
968553384 4:1235657-1235679 ACCCCAGCCCAGCCCCCAGGAGG - Intronic
971353004 4:25869471-25869493 ATCCCAGGCCCACAGCCAGGAGG + Intronic
977830948 4:101592058-101592080 ATCCCAGGACAGGCAACAGGGGG - Intronic
980510749 4:133784460-133784482 ATCCTAGGACAACCTCTAGTGGG + Intergenic
989845860 5:46140101-46140123 ATCCCAGGAAAAACACCAGAAGG + Intergenic
998105046 5:139462989-139463011 ATTCCAGGAAAACCCCCAGGCGG - Intergenic
998172735 5:139882007-139882029 ATCCCAGGCTGGCCCCCAGGAGG + Intronic
998474332 5:142407947-142407969 ATCCCAGCAGAGCCTCCAGGTGG + Intergenic
1001951719 5:175821028-175821050 ATCCCAGGACAACCCCCAGGAGG - Intronic
1002093664 5:176818522-176818544 ACCTCAGGACAACCTACAGGTGG + Intronic
1002170256 5:177370827-177370849 TTCCCAGGACAAACGCGAGGGGG - Intronic
1007211328 6:40195449-40195471 ATAGCAGGACAACCCCCTAGGGG + Intergenic
1007630558 6:43270855-43270877 GTCTCAGGACAAATCCCAGGCGG + Intronic
1008554019 6:52657492-52657514 CTCCCAGGACAACGCCCTGAGGG + Intergenic
1009251088 6:61299911-61299933 ATCCCAGGATAAAACCTAGGAGG - Intergenic
1015903076 6:138087562-138087584 ATCCAAAGACAAACCCCAGGAGG - Intergenic
1017521289 6:155205528-155205550 GTCCCTGGACACCCACCAGGTGG - Intronic
1018686600 6:166308335-166308357 GTCCCGGGAGCACCCCCAGGAGG - Exonic
1022044320 7:26611102-26611124 CACACAGGACAACACCCAGGAGG - Intergenic
1022949938 7:35328503-35328525 TTCCCAGGGCAATCCCCAGAAGG + Intergenic
1023183695 7:37511875-37511897 ATGCCAGGAGACCCCCCTGGAGG - Intergenic
1024093211 7:45964728-45964750 ATGCCAGCACCACCCCAAGGAGG - Intergenic
1025581404 7:62723284-62723306 ATCCCAGGACTAAACCCAGAAGG + Intergenic
1025600438 7:62990500-62990522 ATCCCAGGATAACACCTAGAAGG + Intergenic
1027530428 7:79323956-79323978 TTCCCAGGAGCATCCCCAGGAGG - Intronic
1035404541 7:158588646-158588668 ACCCCAGGACCACCCCCTGCCGG + Intergenic
1035686684 8:1528538-1528560 ATCGCAGGCCAGCCCCCGGGTGG - Intronic
1036654855 8:10671494-10671516 ACCCCTGGACACCCCACAGGCGG + Intronic
1036689131 8:10930604-10930626 TTCCCAGGATAAACCCCAGTTGG - Intronic
1038467314 8:27775978-27776000 TACCCAGGAAAAGCCCCAGGGGG + Intronic
1040322707 8:46326677-46326699 CCCCCAAGGCAACCCCCAGGTGG - Intergenic
1042530044 8:69805323-69805345 ATCCCCTGAAATCCCCCAGGAGG + Intronic
1045221882 8:100207364-100207386 ATCACAGGAAACTCCCCAGGAGG - Intronic
1046406671 8:113781665-113781687 TTCCCAGGCCTACCTCCAGGAGG + Intergenic
1046793210 8:118343525-118343547 ATCTCAGGACAATCAACAGGAGG + Intronic
1048928369 8:139291045-139291067 CTCACAGAACAAGCCCCAGGTGG - Intergenic
1048945185 8:139440310-139440332 ATCCCACGATAAACCCCAGTGGG - Intergenic
1049080301 8:140437819-140437841 CTCCCAGGACCACCTCCAGGAGG + Intronic
1049432514 8:142571808-142571830 AGCCCTGGACACCCCGCAGGTGG - Intergenic
1049441481 8:142611751-142611773 GTCCCAGGACAGCCCAGAGGGGG - Exonic
1049485623 8:142858449-142858471 CTTCCAGGACGACCCCCATGTGG + Intronic
1049807154 8:144546265-144546287 ACCCCAGGCCGACCTCCAGGAGG + Intronic
1050690513 9:8222235-8222257 TCCCAAGTACAACCCCCAGGTGG + Intergenic
1051973032 9:22913770-22913792 GTCCCAAGGCAACCCCCTGGAGG + Intergenic
1052195076 9:25702226-25702248 ATCTCACTACAACCCCCAGATGG - Intergenic
1055842509 9:80522210-80522232 TTCCCAGGACAAACCCTATGTGG + Intergenic
1056135831 9:83628734-83628756 CCCCAAGGACAACCCCCAGGAGG - Intronic
1057147076 9:92765300-92765322 CTGCCGGGAGAACCCCCAGGGGG + Intergenic
1058197696 9:101999145-101999167 ACCCCAGGAACAACCCCAGGTGG + Intergenic
1059654217 9:116342603-116342625 ATCCCAGTAAAACCCTCAGTTGG + Intronic
1062361382 9:136190004-136190026 ATCCCCAGGCAGCCCCCAGGAGG + Intergenic
1187971473 X:24663378-24663400 ATCCCCACAAAACCCCCAGGGGG - Intronic
1188527466 X:31101563-31101585 ATCCCAGCATAACCCCCATTAGG - Intronic
1193352996 X:80483680-80483702 TTCCAAGGACCAACCCCAGGAGG + Intergenic
1198667272 X:139038225-139038247 ATCCCAGGACAAGCAACAGCAGG - Intronic