ID: 1001955976

View in Genome Browser
Species Human (GRCh38)
Location 5:175848374-175848396
Sequence GTACAAGTCAACCAGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001955969_1001955976 16 Left 1001955969 5:175848335-175848357 CCCTGGACCAAGCGATGCTGAGC 0: 1
1: 0
2: 1
3: 4
4: 95
Right 1001955976 5:175848374-175848396 GTACAAGTCAACCAGGGGACAGG No data
1001955971_1001955976 9 Left 1001955971 5:175848342-175848364 CCAAGCGATGCTGAGCTGAGTTT 0: 1
1: 0
2: 1
3: 19
4: 246
Right 1001955976 5:175848374-175848396 GTACAAGTCAACCAGGGGACAGG No data
1001955970_1001955976 15 Left 1001955970 5:175848336-175848358 CCTGGACCAAGCGATGCTGAGCT 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1001955976 5:175848374-175848396 GTACAAGTCAACCAGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001955976 Original CRISPR GTACAAGTCAACCAGGGGAC AGG Intronic
No off target data available for this crispr