ID: 1001957735

View in Genome Browser
Species Human (GRCh38)
Location 5:175859754-175859776
Sequence CATGGGGACCAGCTTGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001957729_1001957735 0 Left 1001957729 5:175859731-175859753 CCCTCTCTTTCAGTCAACGTGAC 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1001957735 5:175859754-175859776 CATGGGGACCAGCTTGTAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 116
1001957728_1001957735 12 Left 1001957728 5:175859719-175859741 CCATTGTGAATTCCCTCTCTTTC 0: 1
1: 0
2: 1
3: 46
4: 575
Right 1001957735 5:175859754-175859776 CATGGGGACCAGCTTGTAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 116
1001957730_1001957735 -1 Left 1001957730 5:175859732-175859754 CCTCTCTTTCAGTCAACGTGACC 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1001957735 5:175859754-175859776 CATGGGGACCAGCTTGTAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 116
1001957727_1001957735 15 Left 1001957727 5:175859716-175859738 CCACCATTGTGAATTCCCTCTCT 0: 1
1: 0
2: 1
3: 30
4: 630
Right 1001957735 5:175859754-175859776 CATGGGGACCAGCTTGTAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001957735 Original CRISPR CATGGGGACCAGCTTGTAGT AGG Intronic
902775861 1:18674589-18674611 CAAGGGGGCCAGCTTGGAGGAGG - Intronic
904396256 1:30224486-30224508 CATGGGGACCTGCTAGGACTTGG + Intergenic
910204446 1:84734219-84734241 CCTGGGCTCCAGCTTGTAGATGG - Intergenic
914438541 1:147681428-147681450 CATGGGGGCCAGCTAGAGGTTGG - Intergenic
922385427 1:225076290-225076312 TGTGAGGACCAGCTTGGAGTTGG + Intronic
923757831 1:236809364-236809386 CTTGGGCACCAGCTGGTAGGAGG + Intronic
1066296538 10:34058865-34058887 CCTGGGAACCAGCTGGTGGTGGG - Intergenic
1068617010 10:59129907-59129929 CATGGTGACCAGCTTTGGGTGGG - Intergenic
1076046397 10:127297438-127297460 CATGGGGACCATCTTGATGGAGG + Intronic
1077736953 11:4801372-4801394 CATGGGTGCCAGCTTGTTTTTGG + Intronic
1078532524 11:12148208-12148230 TAGGGGGCACAGCTTGTAGTAGG + Intronic
1079584895 11:22113625-22113647 CATGGGGACCAGATTATGTTGGG + Intergenic
1084319653 11:68366247-68366269 GATGGGGCCCAGCTTGCAGAAGG + Intronic
1085394935 11:76202467-76202489 CATGGGCACCAGCATGAGGTGGG - Intronic
1086428468 11:86711872-86711894 CATGGGGCTCAGCCTGTAGAAGG - Intergenic
1089721516 11:120428058-120428080 CATAGGAACCAGCTTGGGGTGGG - Exonic
1092384657 12:8026937-8026959 CATGGGGCCCATCTTGGGGTGGG - Intergenic
1094072373 12:26431876-26431898 CATTGGTACCAGCATGTATTAGG + Intronic
1095656803 12:44679673-44679695 GATAGGGACCAGCTTGTGGAAGG - Intronic
1098794447 12:74870735-74870757 CATAGTGTCCAGCATGTAGTAGG - Intergenic
1101645267 12:106625686-106625708 CATGGAGTCTAGCATGTAGTAGG - Intronic
1106257572 13:28035431-28035453 GATGGGGACTAACTTCTAGTGGG + Intronic
1106720728 13:32432272-32432294 CACGGTGCCCAGCTTGTATTTGG + Intergenic
1108621988 13:52194026-52194048 CACAGCGACCAGCTTGTAATCGG + Intergenic
1110424401 13:75350046-75350068 CATGGGGATGAGCTGTTAGTTGG - Intronic
1110808979 13:79791201-79791223 CATGAGGACCAGCTTGATGCTGG + Intergenic
1112574530 13:100623769-100623791 GATGGGTACCAGCTTGTAATGGG + Intronic
1114472359 14:22972610-22972632 AATGGGGACCAGCTCTGAGTGGG - Exonic
1119593621 14:75913524-75913546 CATAGTGCCCAGCCTGTAGTAGG + Intronic
1120277181 14:82390369-82390391 CATGGGGATAAGATTGTAATGGG + Intergenic
1120924014 14:89780137-89780159 CATGGGGCCTGGCATGTAGTGGG + Intergenic
1127431835 15:58918041-58918063 CATTGCGCCCAGCTGGTAGTTGG + Intronic
1130300548 15:82677225-82677247 CATGGGGAGGACCTTGAAGTGGG + Intronic
1132615594 16:839862-839884 CATGTGGACCAGCTGGTTTTCGG + Intergenic
1132710643 16:1265613-1265635 CCTGGGCAGCAGCTTGAAGTGGG - Intergenic
1135812126 16:25597547-25597569 CATGGGGTTCAGCTAGTTGTGGG + Intergenic
1137697841 16:50474265-50474287 CATGGGGTCCTGCTTAGAGTAGG - Intergenic
1141335478 16:83151014-83151036 CATGGTGACAAGCATATAGTAGG + Intronic
1142190685 16:88715989-88716011 CATGGGCAGCAGGTTGCAGTCGG + Exonic
1146097168 17:29942015-29942037 CATGGCGACCTGCTTCTAGTTGG + Intronic
1147789786 17:43006615-43006637 GATGGGGGCCAGTTTGCAGTTGG + Intergenic
1151370513 17:73644086-73644108 CATGGTGACCAGCCTGGAGAGGG + Exonic
1158430936 18:57386822-57386844 CATGGGGACTAGGGTGCAGTAGG - Intergenic
1160069707 18:75616051-75616073 AATGGGGACCAGGTTGGAATGGG + Intergenic
1162836330 19:13320644-13320666 CATGGGGTCCAGCACTTAGTAGG - Intronic
1167050142 19:47072896-47072918 CTCGGGGACCAGCTGGTAGAGGG + Intronic
1167987309 19:53329347-53329369 AATGAGGACCATCATGTAGTTGG - Intergenic
925409097 2:3628524-3628546 CATGGGGACCTGGCTGCAGTGGG + Intronic
930014841 2:46963164-46963186 CAGGGGGACCAGATTCTATTAGG - Intronic
930283949 2:49404667-49404689 CATGAGGACCATCATGTGGTTGG + Intergenic
931216944 2:60254179-60254201 CAGGGGGACCAGCCAGAAGTTGG - Intergenic
932559689 2:72856167-72856189 CACAGTGACCAGCATGTAGTAGG + Intergenic
934499621 2:94846842-94846864 AGTGGGAACCAGCTTGCAGTTGG - Intergenic
934843751 2:97648071-97648093 CTGGGGCACCAGCTTGTAATGGG - Exonic
940108753 2:150127405-150127427 CATGGGAACCAGTTTGAAGCAGG - Intergenic
940450805 2:153834216-153834238 CATGGTGTCCAGCCTGTGGTAGG - Intergenic
940907008 2:159178824-159178846 CACGGGCACCACCTTGTAGCTGG - Exonic
948685863 2:239669513-239669535 CATGGGGGCCAGCTTCTAGAAGG + Intergenic
948824025 2:240565801-240565823 CCTGGGCACCAGCTTGTGATGGG - Intronic
1169971009 20:11269576-11269598 AATGGGGACTGGCATGTAGTTGG - Intergenic
1171890854 20:30713552-30713574 AGTGGGAACCAGCTTGCAGTTGG - Intergenic
1174182012 20:48680854-48680876 CATGGAGCCGACCTTGTAGTTGG - Intronic
1175965255 20:62657125-62657147 CATGAAGACCAGCTGGTAGCGGG - Exonic
1179562480 21:42224342-42224364 CATTGGGACCAGCTGGGAGGAGG + Intronic
1179908253 21:44435187-44435209 CATGGGGTACAGCGTGTGGTTGG - Exonic
1181805756 22:25373620-25373642 GATGGGGCCCAGCTTGCAGAAGG - Intronic
1181983455 22:26782676-26782698 CATGGTGTTCAGCTTGCAGTTGG + Intergenic
1183537415 22:38411127-38411149 CATGGGGCCCAGCACATAGTGGG - Intergenic
1184712539 22:46261453-46261475 CCTGGGGACCATCCTGTACTTGG - Exonic
949893558 3:8752467-8752489 CTTGGGGACCAGCTTGTCAGAGG - Exonic
954430765 3:50469878-50469900 GATGGGGAACAGCTTGGAGTGGG - Intronic
955118518 3:56031247-56031269 CATGGGGATCAGCTTGGGTTGGG - Intronic
959740779 3:109716877-109716899 CATGGTGAGAAGCTTGTGGTTGG + Intergenic
963080868 3:141392660-141392682 CAGGCGGACCAGCTTGAAGAAGG - Intronic
966068588 3:175846825-175846847 CATGGGGACCAGCCTGGTGATGG - Intergenic
972254185 4:37335562-37335584 CATGTGGCCCAGCTTCTAGCAGG - Intronic
972995705 4:44877048-44877070 CATGGCTATCAGCTTGTTGTTGG + Intergenic
973740799 4:53917464-53917486 AATGGTGCCCAGCATGTAGTAGG + Intronic
974118853 4:57613467-57613489 GATGGGGCTCAGGTTGTAGTAGG + Intergenic
975421237 4:74166983-74167005 CATGGGGACCAGCCTGGCATTGG - Intronic
980894069 4:138844772-138844794 CATGTCCACCAGCTTGTAGGCGG + Intergenic
983677592 4:170314053-170314075 AATGGTGGCCAGCATGTAGTAGG - Intergenic
986353533 5:6902873-6902895 CATGGGGACCAGGATGCACTAGG - Intergenic
990734532 5:58845465-58845487 CATGGGAACCATTTTGTGGTAGG + Intronic
991038184 5:62149391-62149413 CATGGTTCTCAGCTTGTAGTAGG + Intergenic
1001094054 5:168762571-168762593 GATGCGGACCAGCTTCTGGTTGG + Exonic
1001957735 5:175859754-175859776 CATGGGGACCAGCTTGTAGTAGG + Intronic
1007544182 6:42679500-42679522 CATTGGGACCAGTTTGATGTAGG + Intronic
1007679193 6:43622769-43622791 GAGGGGGACCAGCTGGTGGTGGG - Exonic
1012898282 6:104976841-104976863 GGTTGGGACCAGCTTGTAGCAGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018617902 6:165705111-165705133 CCTGGGGACCAGCATGGAATGGG + Intronic
1020259258 7:6521493-6521515 CATGGACACCACCTTGTCGTGGG + Exonic
1024674058 7:51622375-51622397 CATGGGGACCAGGTAGGATTAGG + Intergenic
1025923501 7:65937326-65937348 CAGGAAGAGCAGCTTGTAGTGGG + Intronic
1027478331 7:78661964-78661986 CAAGGCTACCAGCTTGGAGTAGG + Intronic
1027498374 7:78917301-78917323 CATGTGGACCTGGTTGTAGGAGG + Intronic
1031173510 7:118320444-118320466 CATGGGGAACAGTTTGAAGTAGG - Intergenic
1035358031 7:158290530-158290552 CTTGGGTACCAGCCTGGAGTAGG + Intronic
1038777674 8:30545720-30545742 CATGGGGTCGAGATTGTTGTTGG + Intronic
1041984312 8:63902902-63902924 CAAGGAGATGAGCTTGTAGTTGG + Intergenic
1043390376 8:79785851-79785873 CATGGGGACCAACTTGACTTTGG + Intergenic
1044371790 8:91420526-91420548 CATGGTGACTAGCTTGAAGAAGG + Intergenic
1049585175 8:143429702-143429724 CATGGACACCAGCTGGTCGTCGG + Exonic
1049591836 8:143466233-143466255 CATGGGGACCAGTGTCTAGGTGG + Intronic
1051605572 9:18915029-18915051 CATGGGGGCCTGCTTTTAGGGGG - Intergenic
1053502270 9:38608811-38608833 AATGGGGACCAACTTGGAGTTGG - Intergenic
1053657537 9:40233698-40233720 AGTGGGAACCAGCTTGCAGTTGG + Intronic
1053907900 9:42862975-42862997 AGTGGGAACCAGCTTGCAGTTGG + Intergenic
1054358000 9:64082204-64082226 AGTGGGAACCAGCTTGCAGTTGG + Intergenic
1054369661 9:64379969-64379991 AGTGGGAACCAGCTTGCAGTTGG + Intronic
1054527059 9:66142530-66142552 AGTGGGAACCAGCTTGCAGTTGG - Intronic
1054677288 9:67869722-67869744 AGTGGGAACCAGCTTGCAGTTGG + Intronic
1055620814 9:78123054-78123076 GATGGGGCCCTGCTTGTAGAAGG - Intergenic
1058640829 9:107083497-107083519 CATGGGGACTGGCAGGTAGTGGG - Intergenic
1059537390 9:115094151-115094173 CATGGTGTCAAGCTCGTAGTAGG + Intronic
1061699584 9:132405990-132406012 AATGGGGAGCAGCTGGTTGTTGG - Intronic
1203560462 Un_KI270744v1:51317-51339 AGTGGGAACCAGCTTGCAGTTGG - Intergenic
1197275571 X:124475215-124475237 GATGAGGATCAGTTTGTAGTAGG - Intronic
1198281420 X:135146537-135146559 GATGGGGAACAGCTTGTCGGTGG + Intergenic
1198289539 X:135225979-135226001 GATGGGGAACAGCTTGTCGGTGG - Intergenic
1198394179 X:136206413-136206435 CATGGTGCCCACCTTGTAGCTGG - Exonic
1201483607 Y:14468535-14468557 CATGAAGACCTGCTTGTGGTTGG + Intergenic