ID: 1001959594

View in Genome Browser
Species Human (GRCh38)
Location 5:175872158-175872180
Sequence GAGGAGGGAGTCGCCCCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 225}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001959582_1001959594 1 Left 1001959582 5:175872134-175872156 CCCGCCGGAGCACGCTTCGCCCC 0: 1
1: 0
2: 1
3: 1
4: 72
Right 1001959594 5:175872158-175872180 GAGGAGGGAGTCGCCCCCAGGGG 0: 1
1: 0
2: 1
3: 28
4: 225
1001959585_1001959594 -3 Left 1001959585 5:175872138-175872160 CCGGAGCACGCTTCGCCCCGGAG 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1001959594 5:175872158-175872180 GAGGAGGGAGTCGCCCCCAGGGG 0: 1
1: 0
2: 1
3: 28
4: 225
1001959583_1001959594 0 Left 1001959583 5:175872135-175872157 CCGCCGGAGCACGCTTCGCCCCG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1001959594 5:175872158-175872180 GAGGAGGGAGTCGCCCCCAGGGG 0: 1
1: 0
2: 1
3: 28
4: 225
1001959581_1001959594 7 Left 1001959581 5:175872128-175872150 CCGAAGCCCGCCGGAGCACGCTT 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1001959594 5:175872158-175872180 GAGGAGGGAGTCGCCCCCAGGGG 0: 1
1: 0
2: 1
3: 28
4: 225
1001959580_1001959594 8 Left 1001959580 5:175872127-175872149 CCCGAAGCCCGCCGGAGCACGCT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1001959594 5:175872158-175872180 GAGGAGGGAGTCGCCCCCAGGGG 0: 1
1: 0
2: 1
3: 28
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001959594 Original CRISPR GAGGAGGGAGTCGCCCCCAG GGG Intronic
900553658 1:3269227-3269249 GAGGAGGAGGACGGCCCCAGAGG + Intronic
900601366 1:3504119-3504141 GAGGAGGGGGCTGGCCCCAGGGG + Intronic
900987342 1:6080778-6080800 GAGGACGGAGTAGCCACCACTGG - Intronic
902778498 1:18689882-18689904 GAGGAGGGGGTTGCCCCTTGGGG + Intronic
902916443 1:19642954-19642976 GAGGAGGGAGATGCTCCCAGAGG + Intronic
902916464 1:19643098-19643120 GAGGAGGGAGATGCTCCCAAAGG + Intronic
903879772 1:26500778-26500800 GAGGCGGGAGTGGGCTCCAGCGG + Intergenic
904467731 1:30718336-30718358 GCGGAGAGAGTCGGCTCCAGGGG - Intronic
907737142 1:57125257-57125279 GAGGAGGGAGCCCTCCCCAAGGG - Intronic
907871553 1:58448257-58448279 GAGGAGGTTGAAGCCCCCAGTGG - Intronic
910638375 1:89434259-89434281 AAGCAGGGTGTCGCCCCTAGAGG - Intergenic
915399898 1:155614556-155614578 GAGGATGGAGTAGGACCCAGGGG - Exonic
915417056 1:155750420-155750442 GAGGATGGAGTAGGACCCAGGGG - Exonic
917215888 1:172677648-172677670 GAGAAGGAAGGCACCCCCAGAGG - Intergenic
918051469 1:180976539-180976561 CAGGAGGAACTCGCACCCAGAGG + Exonic
918184025 1:182111519-182111541 GAGGAGGGAGAAGTCCCCAGAGG + Intergenic
919920304 1:202163270-202163292 CAGGAAGGAGTCACTCCCAGGGG + Intergenic
920346441 1:205308784-205308806 GAGGAGTGAGTCACCCCCAGTGG - Intronic
921073903 1:211684594-211684616 GAGGTGGGACTCGACTCCAGAGG - Intergenic
922369463 1:224895139-224895161 GGAGAGGGAGTCCCCCCTAGAGG + Intergenic
922804665 1:228379049-228379071 GAGGACGGAGACGCCCCGAGGGG - Intergenic
923312771 1:232751947-232751969 GAGGAGGGAGTCACCGGCAGCGG - Intergenic
924531795 1:244899944-244899966 GCCGAGGGAGCCTCCCCCAGGGG - Intergenic
1063268625 10:4482378-4482400 GAGGAAGGAATCACCCGCAGTGG + Intergenic
1063476391 10:6332423-6332445 GGGGAGGGAGTTGCCCCTGGTGG - Intergenic
1063644424 10:7865068-7865090 GAGGAGGGAGTCCTCACCAGTGG + Intronic
1065712768 10:28533276-28533298 GAGGAGGCAGTCGCTCTCCGCGG + Intronic
1066620612 10:37345275-37345297 GAGGAGGGAGCAAGCCCCAGTGG - Intronic
1067576215 10:47410111-47410133 GAGCAGGGAGTGGCCCCTGGAGG - Intergenic
1071601647 10:86961487-86961509 GAGGAGGGAGGAGCCCCCTGGGG - Intronic
1071719729 10:88131279-88131301 GAGTAGTAAGTCACCCCCAGCGG - Intergenic
1072207915 10:93221083-93221105 GAGCAGGCAGGCGCCGCCAGGGG + Intergenic
1072397266 10:95057251-95057273 GAGGTGGGAGTCAACTCCAGAGG - Intronic
1072840757 10:98771484-98771506 GAGGTGGGAGTGGCTCCCAAAGG - Intronic
1076002941 10:126926809-126926831 AAGGAGGAAGTCTCCCCCAGAGG + Intronic
1076402710 10:130194256-130194278 GACGATGGAGGAGCCCCCAGGGG + Intergenic
1076531600 10:131148895-131148917 CAGGACAGAGTCGCCCCGAGGGG - Intronic
1076824948 10:132962199-132962221 GAGGTGGGAGTCGACTCCAGAGG + Intergenic
1077981963 11:7309734-7309756 GAGCAGGGAGACTGCCCCAGGGG - Intronic
1078023214 11:7672394-7672416 GAGGAGGGCCTAGCCCCCAGAGG + Intronic
1079241641 11:18726226-18726248 GACTAAGGAATCGCCCCCAGGGG - Intronic
1081853481 11:46289964-46289986 GATCAGGGACTCTCCCCCAGGGG + Intronic
1083581261 11:63826977-63826999 GCGGATGGAGGAGCCCCCAGCGG + Exonic
1084028422 11:66466987-66467009 GGGGAGGGAGCGGCGCCCAGCGG + Exonic
1084571898 11:69964955-69964977 GAGGTGGGAGACCCCTCCAGGGG - Intergenic
1084596755 11:70121103-70121125 GAGGAGGGACCCACCCTCAGTGG - Intronic
1084720086 11:70899847-70899869 GCGGAGGGATGCGGCCCCAGAGG + Intronic
1088553717 11:111039932-111039954 GTGGAAAGAGTGGCCCCCAGGGG - Intergenic
1089053613 11:115566533-115566555 GAGGAGGGAGTCACACACACTGG - Intergenic
1089555883 11:119315837-119315859 GAGGTCAGAGTCTCCCCCAGGGG + Intronic
1089787577 11:120919158-120919180 GAGGAGAGAGTTGCCGGCAGAGG + Intronic
1090509779 11:127362953-127362975 GAGGAGGGAGTCATATCCAGAGG - Intergenic
1094440460 12:30470439-30470461 TGGGAGGGAGTGGCACCCAGGGG + Intergenic
1097409592 12:59234815-59234837 CAGGAGGGAGTTGTGCCCAGTGG - Intergenic
1099190164 12:79554072-79554094 GAGCAGGGAGTGGCACCCATTGG + Intergenic
1101731880 12:107433509-107433531 GAGGAAGGAGCAGCCCCCATGGG + Intronic
1101842670 12:108339483-108339505 GAGGGGCGGGTCGTCCCCAGCGG - Intergenic
1101963366 12:109265936-109265958 AAGGAGGGAGTCGAGCACAGGGG + Intronic
1104798436 12:131536473-131536495 GAGGAGAAAGTGGCCCCCTGTGG - Intergenic
1105210125 13:18252677-18252699 GAGGAGGGAGCAGGCCCCAAGGG + Intergenic
1108239205 13:48444640-48444662 CTGGAGGGTGTGGCCCCCAGAGG - Exonic
1109102504 13:58203287-58203309 CAGGAGGGAGTGGCACCCAGTGG + Intergenic
1112809288 13:103199114-103199136 CGGGAGGGAGTGGCACCCAGTGG + Intergenic
1113140571 13:107144339-107144361 AAGGAGGGATTCTCCCCAAGAGG + Intergenic
1113676187 13:112209444-112209466 GAGGCCGGACTCGACCCCAGAGG - Intergenic
1114189155 14:20428110-20428132 AAGGAGGGAGAGGCCCACAGTGG - Intergenic
1114523409 14:23352610-23352632 GAGGATGGCGTCGCCACCTGGGG + Intronic
1116176214 14:41473520-41473542 GTGGAGGGAGTTGTCGCCAGGGG + Intergenic
1119266250 14:73264683-73264705 GAAGAGGGGATGGCCCCCAGGGG - Exonic
1119441465 14:74631373-74631395 GGGGAGGGAGGAGGCCCCAGGGG + Intergenic
1121553703 14:94820681-94820703 GAGGAGGGAGTAGCTCTAAGAGG + Intergenic
1122174808 14:99909009-99909031 GAGGAGGGAGTTGGGACCAGAGG - Intronic
1122268844 14:100559266-100559288 GAGGAGGGAGTAGCGATCAGTGG - Intronic
1122888798 14:104723406-104723428 GTGGAGGGACTAGGCCCCAGAGG - Intergenic
1125134766 15:36328697-36328719 CAGGAGGGAATGGCGCCCAGTGG + Intergenic
1125519608 15:40340507-40340529 GAGGAAAGAGCCGCTCCCAGGGG + Intronic
1126311583 15:47323153-47323175 TAGGAGGGAGTGGTGCCCAGCGG + Intronic
1128936791 15:71753527-71753549 GAGAAGGCAGTCCCCACCAGAGG + Intronic
1130261282 15:82355732-82355754 GAGGAGTGAGTCCGCCCCAGCGG - Intergenic
1130279953 15:82513286-82513308 GAGGAGTGAGTCCGCCCCAGCGG + Intergenic
1130471328 15:84229472-84229494 GAGGAGTGAGTCCGCCCCAGCGG + Intergenic
1130478822 15:84344043-84344065 GAGGAGTGAGTCCGCCCCAGCGG + Intergenic
1130492948 15:84444088-84444110 GAGGAGTGAGTCCGCCCCAGCGG - Intergenic
1130593622 15:85234099-85234121 GAGGAGTGAGTCCGCCCCAGCGG + Intergenic
1131947061 15:97635189-97635211 GAGGAGGGAGTGGCTGCCAATGG - Intergenic
1133187584 16:4110932-4110954 GAGGTGGGACTCGACTCCAGAGG - Intronic
1134095016 16:11413353-11413375 GAGGAGGGAGCAGCTCCCAGGGG - Intronic
1136249105 16:28992008-28992030 GAGGAGAGAGTGGCCCAGAGAGG + Intergenic
1138252179 16:55509537-55509559 GAGGAGGGAGGTGGCCCGAGGGG + Intronic
1138572612 16:57885187-57885209 GGAGAGGGAGCAGCCCCCAGAGG + Intronic
1139311683 16:66033080-66033102 GAGGAGGCAGTCTCCCTGAGGGG - Intergenic
1139340120 16:66262973-66262995 GAGGAGGGATTCTCCCCTGGAGG - Intergenic
1139356371 16:66369185-66369207 GAGGAGGAAGTGGGACCCAGGGG + Intronic
1140638073 16:76940175-76940197 GGGGAGGGACTCACTCCCAGTGG - Intergenic
1141145100 16:81523741-81523763 GAGGAGGGAGGCTCCACCAGGGG - Intronic
1141622920 16:85246771-85246793 CAGGGGGGAGGCTCCCCCAGAGG - Intergenic
1141770185 16:86085216-86085238 GAGTAGGGAGTCTGCCCCACGGG + Intergenic
1142160252 16:88553868-88553890 GAGGAAGGAGTCAGCCCCGGTGG + Intergenic
1143018459 17:3904194-3904216 CAGGAGGGAGTCCCTCCCGGAGG + Intronic
1144702732 17:17349420-17349442 CAGGAGGGAATGTCCCCCAGTGG - Intergenic
1145246534 17:21273310-21273332 GAGGAGGAAGCCTCCGCCAGGGG + Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147819676 17:43234279-43234301 AACAAGGAAGTCGCCCCCAGCGG - Intergenic
1147820985 17:43241676-43241698 AACAAGGAAGTCGCCCCCAGCGG - Intergenic
1147821792 17:43246166-43246188 AACAAGGAAGTCGCCCCCAGCGG - Intergenic
1147822884 17:43252321-43252343 AACAAGGAAGTCGCCCCCAGCGG - Intergenic
1147825402 17:43267125-43267147 AACAAGGAAGTCGCCCCCAGCGG - Intergenic
1147826525 17:43273592-43273614 AACAAGGAAGTCGCCCCCAGCGG - Intergenic
1147827414 17:43278470-43278492 AACAAGGAAGTCGCCCCCAGCGG - Intergenic
1147828522 17:43284631-43284653 AACAAGGAAGTCGCCCCCAGCGG - Intergenic
1147829631 17:43290783-43290805 AACAAGGAAGTCGCCCCCAGCGG - Intergenic
1147831408 17:43300533-43300555 AACAAGGAAGTCGCCCCCAGCGG - Intergenic
1148680365 17:49470212-49470234 GAGGAGCGAGTCGGCCCTAATGG + Intronic
1149538670 17:57452280-57452302 GAGCAGGGAGCCTCCTCCAGAGG + Intronic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150128257 17:62652707-62652729 GTGGAGGGAGGGGCGCCCAGTGG + Intronic
1150637971 17:66929587-66929609 GAGGTGGGACTCAACCCCAGAGG - Intergenic
1150723966 17:67636635-67636657 TACGAGGGAGTCGCCCCTGGGGG - Intronic
1151223399 17:72630723-72630745 GAGGAGGCAGGGGTCCCCAGTGG + Intergenic
1151231506 17:72688485-72688507 GAGGAGGCATTTGTCCCCAGTGG - Intronic
1151597781 17:75088500-75088522 GAGGAGGGAGGCAGCCCCAGAGG - Intronic
1151646615 17:75436773-75436795 GAGAAGGAAGATGCCCCCAGAGG - Intergenic
1151750134 17:76032483-76032505 GAGGAGAGAGTGGGCACCAGAGG - Intergenic
1152424405 17:80211088-80211110 GAGAAGGGAGCCGCCCAGAGTGG - Intronic
1152428951 17:80236814-80236836 GAGGCAGGAGACGCCCCCACCGG - Intronic
1152524308 17:80878943-80878965 GAGGAGGGACGGGCCCCTAGAGG - Intronic
1153625743 18:7020825-7020847 GAGGAGGGAATGGCTGCCAGGGG - Intronic
1161060745 19:2213635-2213657 GATGAGGTAGTGGACCCCAGAGG + Exonic
1161709797 19:5841569-5841591 GAGGAGGGAGAAGGCCCCACGGG + Intergenic
1161716004 19:5876716-5876738 GAGGAGGGAGAAGGCCCCATAGG + Intronic
1162930014 19:13952911-13952933 TCGGAGGGAGGCGACCCCAGAGG + Intronic
1163686548 19:18715106-18715128 CAGGAGGGATCCGCCCCTAGAGG - Intronic
1165079251 19:33298346-33298368 GAGGAGGGCGAGGCCCCCGGGGG - Intergenic
1165377725 19:35454903-35454925 GAGGAGGGACTTGACCCCAGGGG - Intergenic
1165880369 19:39038395-39038417 GAGGCGGGACTCGACTCCAGAGG + Intergenic
926084016 2:10009913-10009935 GAGGAGGGAGGCACCACCATGGG + Intergenic
926144599 2:10389008-10389030 GAGGCGGGACTCGACTCCAGAGG + Intronic
926151275 2:10426959-10426981 GAGGAGGGAGGCGCAGCCACCGG - Exonic
926198245 2:10776383-10776405 GGGGAGGGTGTCGCCTCCTGAGG + Intronic
930675523 2:54196767-54196789 GGGGATGAAATCGCCCCCAGAGG + Intronic
931412774 2:62049407-62049429 GAGGAGGGATTGTCCCCCAGGGG + Intronic
933261183 2:80133250-80133272 GAGGAAGGATTCTCCCCTAGAGG + Intronic
933340405 2:81018108-81018130 CAGAAGGGAGTGGCACCCAGTGG - Intergenic
936081635 2:109436459-109436481 GAGGTGGCAGTCGTGCCCAGAGG + Intronic
936939608 2:117870965-117870987 GAGGAGGAAGCCGCGCACAGTGG - Intergenic
937227171 2:120376520-120376542 CAGGAGGGAGTGGGGCCCAGAGG - Intergenic
941818758 2:169824867-169824889 GAGGTGCGGGTCGCCTCCAGAGG - Exonic
946198111 2:218050552-218050574 TAGGAGGGAGTGGCACTCAGTGG - Intronic
946433356 2:219637037-219637059 GGGGAGGGAGTCAGACCCAGGGG + Intronic
948205793 2:236162267-236162289 GAGCAGGGAGTGGCCCCCCCAGG - Intergenic
948806955 2:240457134-240457156 GGGGAGGGAGTCCTCCGCAGGGG - Intronic
949006676 2:241653398-241653420 GAGGAGGGAGTCGGTGCCTGTGG + Intronic
1171206203 20:23283247-23283269 CAGGAGGGAGAGGCCACCAGGGG - Intergenic
1172778975 20:37424591-37424613 GAGGAGGGAGGCGTGTCCAGTGG + Intergenic
1175291507 20:57879007-57879029 GAGGAGGAAGAGGACCCCAGGGG + Intergenic
1175429129 20:58890319-58890341 GAGGAGGGCGCCGCCGCCGGGGG + Intronic
1175842735 20:62040467-62040489 GAGCAGGGGCTCACCCCCAGGGG + Intronic
1176138560 20:63535687-63535709 GTGGAGGGGGTGGACCCCAGGGG - Intronic
1176169410 20:63690233-63690255 GATGAGGGTGTTGTCCCCAGAGG + Intronic
1177632164 21:23742730-23742752 CAGGAGGGAGTAGCACCCAGCGG - Intergenic
1179879534 21:44287603-44287625 GAGAAGGGAGGCGCTCCCACTGG - Intronic
1180187489 21:46146592-46146614 GAGAAAGGAGTTGCCCCCTGGGG + Intronic
1181033905 22:20160895-20160917 GGGGAGGCAGGAGCCCCCAGGGG + Intergenic
1181305589 22:21915733-21915755 AGGGAGGGAGTGGGCCCCAGAGG + Intergenic
1181477961 22:23180384-23180406 GATGGGGGAGCCGCCTCCAGGGG + Exonic
1181927610 22:26372576-26372598 TAGGAGGGAGTGGCCACCAAAGG - Intronic
1182487213 22:30646718-30646740 GAGGCGAGAGTCGCCAGCAGTGG - Exonic
1183568616 22:38634957-38634979 GAGGAGGGGGTCGGGCGCAGTGG + Intronic
1184562338 22:45270401-45270423 CAGGAGGGAGTGGACCACAGAGG + Intergenic
1185349393 22:50326744-50326766 GAGGCGGGACTGGCCCCGAGAGG + Intronic
950419825 3:12892381-12892403 GAGGAGGGAGCCGCCCTGAGAGG - Intergenic
950897629 3:16467837-16467859 GAGCAGGGAGCAGACCCCAGAGG + Intronic
952822691 3:37498709-37498731 GAGGACAGAGTGGCGCCCAGAGG - Intronic
952901939 3:38116582-38116604 GAGGAGGCAGCCACCCTCAGGGG - Exonic
954339336 3:49940389-49940411 GATGAGGGAGGCGCCGCCCGTGG + Intronic
955325852 3:58008965-58008987 TAAGGGGGAGTCGTCCCCAGGGG + Intronic
956349240 3:68316274-68316296 AGGGAGGGAGTCCTCCCCAGTGG - Intronic
958619504 3:96538427-96538449 CAGGAGGGAGTGGCCCCTGGAGG - Intergenic
961339989 3:126211625-126211647 CAGGAGGTAGGAGCCCCCAGCGG - Intergenic
964222584 3:154364131-154364153 CAGGAGGGAGTGGCACCCAGTGG - Intronic
968602607 4:1517418-1517440 GGGGAGCGACTGGCCCCCAGTGG + Intergenic
969049851 4:4365023-4365045 GAGGAAGGAGTTGCCACCTGAGG - Intronic
969422242 4:7104156-7104178 GAGGAGGGGGACCTCCCCAGTGG - Intergenic
969479038 4:7437372-7437394 GAGGAGGGTGGCACACCCAGAGG - Intronic
971386672 4:26147004-26147026 GAGGAGGGAGTTGCCCAATGAGG + Intergenic
975495903 4:75035616-75035638 GAGGAGGGAAGTGCTCCCAGTGG - Intronic
985315777 4:188657599-188657621 GAGGAGAGAGGAGCCTCCAGGGG - Intergenic
985717918 5:1473026-1473048 GAGGAGAGAGGAGCACCCAGAGG - Intronic
986767370 5:10939921-10939943 GAGGAGGGTGTTGGCCCCATGGG + Intergenic
986809989 5:11346596-11346618 GGGGACGGAGTCGACACCAGGGG + Exonic
989168988 5:38456822-38456844 GAGGAGGGAGTCATCCCAGGTGG + Intronic
989617361 5:43350175-43350197 GACGAGGCAGTAGCCCCCAGAGG - Intergenic
990048798 5:51469089-51469111 GAGGAGGGAGTTTCTCCAAGAGG - Intergenic
997799460 5:136845205-136845227 GAGAAAGGAGTCTTCCCCAGAGG + Intergenic
998202327 5:140135020-140135042 GATGAGGAAGTCAGCCCCAGAGG - Intergenic
999318386 5:150598826-150598848 GGGGAGGGAGGGGTCCCCAGAGG + Intergenic
999322550 5:150624589-150624611 GAGGAGGGAGTCGCACCCCCAGG + Intronic
1001278322 5:170366900-170366922 GACTTGGGAGTCTCCCCCAGAGG - Intronic
1001959594 5:175872158-175872180 GAGGAGGGAGTCGCCCCCAGGGG + Intronic
1002660427 5:180787838-180787860 GTGGATCAAGTCGCCCCCAGTGG - Intergenic
1004152201 6:13132306-13132328 GAGGAGGGAGCAGTCCCCACAGG - Intronic
1004511473 6:16287442-16287464 GAGGAGGGAATGGCACCCAAAGG - Intronic
1006787876 6:36679982-36680004 GGGGGGCGAGTCGCCCCCTGGGG + Intronic
1011643185 6:89433574-89433596 GAAGAGGGAGGCGCCCCGGGGGG - Intronic
1015752189 6:136571429-136571451 TGGGAGGGAGTGGCACCCAGTGG - Intronic
1016119115 6:140326157-140326179 TGGGAGGGAGTGGCACCCAGTGG + Intergenic
1018464398 6:164029852-164029874 GAGGAGGTAGGGGCTCCCAGTGG + Intergenic
1019278346 7:187731-187753 GAGGAGGGAGACGGCTGCAGTGG - Intergenic
1019420375 7:948011-948033 GAGGAGGGAGACGGCCCCTCCGG - Intronic
1023803120 7:43852047-43852069 CAGGAGGGAGTGGCACCCAGTGG - Intergenic
1029531300 7:101127078-101127100 AAGGAGGCAGTGGCCCACAGAGG + Exonic
1032128103 7:129209207-129209229 GAGGAGAGAGTCTGCCCCACTGG - Intronic
1035382450 7:158448501-158448523 GGGGAGGGGGTCCCCTCCAGAGG + Intronic
1035835772 8:2750103-2750125 GAGGAGGGAGTCCCCACAAAAGG - Intergenic
1037062443 8:14531470-14531492 CAGGAGGGAGTGGTGCCCAGTGG - Intronic
1038014047 8:23498227-23498249 GGGTAGGGAGGAGCCCCCAGGGG + Intergenic
1039821921 8:41142179-41142201 GAGGAAAGCGTCGCCCCCACTGG + Intergenic
1039884872 8:41649142-41649164 GAGGAGGCCTTCACCCCCAGGGG + Intronic
1041877114 8:62701948-62701970 GAGGAAAAAGACGCCCCCAGTGG - Intronic
1045534473 8:103014266-103014288 GAGGCGGGACTCGACTCCAGAGG + Intergenic
1048330540 8:133467696-133467718 GAGGAAGGAGTGGCCAGCAGTGG + Intronic
1048892139 8:138957566-138957588 TGGGAGGGAGTGGCACCCAGTGG - Intergenic
1049224213 8:141441912-141441934 CAGGAGGGAGTAGCCCCAGGGGG - Intergenic
1049258838 8:141628039-141628061 GTGCAGGGAGGCGGCCCCAGTGG + Intergenic
1049323045 8:142007349-142007371 GAGGAGGCAGTTGCACCCTGCGG - Intergenic
1050140310 9:2510569-2510591 GAGGTGGTAGTTGCCACCAGGGG - Intergenic
1051092841 9:13430470-13430492 GAGGAGGGAGTTGCAGACAGAGG - Intergenic
1059247394 9:112860393-112860415 AAGGAGGGAGTTGCAGCCAGGGG - Intronic
1060267960 9:122123161-122123183 GAGGAGGGACTGCCACCCAGAGG + Intergenic
1060295255 9:122338896-122338918 GATGAGGGAATGGTCCCCAGGGG - Intergenic
1060419218 9:123455531-123455553 GAGGAAGGAGAAGCCTCCAGAGG - Intronic
1060823443 9:126674197-126674219 GAGAAGGGGGTCTTCCCCAGTGG + Intronic
1061803899 9:133127701-133127723 GAGGAGGAAGAAGCCACCAGAGG - Intronic
1062279968 9:135747449-135747471 GAGGCGGGAGCTGCCCCCGGGGG - Intronic
1186659746 X:11657685-11657707 GAGTGAGGAGTCTCCCCCAGAGG + Intronic
1188161949 X:26815029-26815051 AAGGATGGAGTCTCTCCCAGAGG + Intergenic
1188751457 X:33910487-33910509 CAGGAGGGAGCTGCCCTCAGTGG + Intergenic
1190094434 X:47467385-47467407 GAGGAGGGAGAGGACCCCAGAGG - Intronic
1191104935 X:56766934-56766956 GAGGCAGGAGTCTCCCTCAGCGG - Intergenic
1193640211 X:84003211-84003233 GAGGAGGGAGGGGTCCCAAGGGG - Intergenic
1193953989 X:87835682-87835704 GAGGATGGAGTCACTCTCAGTGG + Intergenic
1199978045 X:152905815-152905837 GTGGAGGGACTCCCCTCCAGGGG + Intergenic
1200173693 X:154097436-154097458 GAGGGGAGAGTCGCCACCGGCGG + Intronic