ID: 1001960247

View in Genome Browser
Species Human (GRCh38)
Location 5:175875912-175875934
Sequence AGAGGTACTTTGCAAACTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001960243_1001960247 16 Left 1001960243 5:175875873-175875895 CCACAGGGATGTAAGCATTGAGA 0: 1
1: 0
2: 0
3: 14
4: 156
Right 1001960247 5:175875912-175875934 AGAGGTACTTTGCAAACTGGTGG 0: 1
1: 0
2: 1
3: 9
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001960247 Original CRISPR AGAGGTACTTTGCAAACTGG TGG Intronic
900035143 1:401552-401574 AGAGGTTCTTTTCAAGTTGGAGG + Intergenic
900056763 1:637305-637327 AGAGGTTCTTTTCAAGTTGGAGG + Intergenic
906566135 1:46802485-46802507 ATAGGTATTTTGCAAACTACTGG + Intronic
915830607 1:159126302-159126324 CCAGAGACTTTGCAAACTGGAGG - Intronic
922257675 1:223907108-223907130 AGAGGTTCTTTTCAAGTTGGAGG + Intergenic
924338869 1:243009887-243009909 AGAGGTTCTTTTCAAGTTGGAGG + Intergenic
1062820159 10:528744-528766 AGTGGTACTTTGCAAGCTCCTGG - Intronic
1063229383 10:4049027-4049049 AGAGGTACTTTTAAAACTCTTGG + Intergenic
1066351129 10:34637739-34637761 ACAGGTGCTTTCCAAACTGCCGG - Intronic
1067182629 10:44000488-44000510 TGAGGTTCTTTGCCAACAGGTGG - Intergenic
1068235406 10:54227046-54227068 AGAGGTACTGTGTAAGCTGTTGG + Intronic
1068326091 10:55489326-55489348 AGAGGTAATTTTCTAACTGCTGG - Intronic
1069548211 10:69343820-69343842 AGAGATACTTGTCAATCTGGAGG - Exonic
1070413668 10:76168959-76168981 ATAGGTACTTTACAAATTGTGGG + Intronic
1078064130 11:8066835-8066857 AGAGGTCATTTGCAAAGTGCAGG - Intronic
1078610199 11:12813167-12813189 AGAGGCAGTGGGCAAACTGGGGG + Intronic
1080822845 11:35823944-35823966 AGAGGCAGTTTGCAAAATGCCGG - Intergenic
1083181072 11:60985971-60985993 AGAAGCATTTTGCTAACTGGTGG + Intronic
1084382836 11:68824413-68824435 ACAGGCATTTTGCATACTGGTGG - Intronic
1084459558 11:69288867-69288889 AGAGATTCTTTGCATACAGGTGG - Intergenic
1085212140 11:74791024-74791046 AGAGGTACGTGGACAACTGGAGG + Intronic
1085403983 11:76250898-76250920 TGAGGTACTTGGACAACTGGAGG - Intergenic
1086256673 11:84885181-84885203 AAAGGTTGTTTGCATACTGGAGG + Intronic
1087385649 11:97464922-97464944 AGAGGTACATAGCAAAGTTGGGG - Intergenic
1087470831 11:98572204-98572226 AGAGGTAGTTTGGAGATTGGAGG + Intergenic
1089154013 11:116386597-116386619 AGAGATACTTAGTTAACTGGTGG + Intergenic
1093182996 12:15988317-15988339 AGAAGTACTTGGACAACTGGAGG + Intronic
1094242563 12:28245828-28245850 AAAAGTACTTTCCAAAATGGTGG - Intronic
1095772804 12:45980837-45980859 ACAGGTATTTTGGAACCTGGTGG - Intronic
1095910289 12:47419089-47419111 AGAGGTACTTTGCAAGTTGTGGG - Intergenic
1098458614 12:70705559-70705581 AGATGTACTTTTGAAACTGTTGG + Intronic
1099906238 12:88774401-88774423 AAAGGTATTTTGCAAGCTGAGGG - Intergenic
1100513044 12:95296366-95296388 AAAAGTACTATGCATACTGGTGG - Intronic
1101702845 12:107191452-107191474 AAAGGTAGATTGCAAACTCGTGG + Intergenic
1102611320 12:114114965-114114987 TGAAGTACTTTGACAACTGGGGG - Intergenic
1102829676 12:115986143-115986165 AGAGAAAATTTGCAAACAGGTGG - Intronic
1104814499 12:131637926-131637948 TGAGGTACTGTCAAAACTGGGGG + Intergenic
1108767333 13:53648489-53648511 ACAGGCACTTTGCAAGTTGGGGG - Intergenic
1109076970 13:57847894-57847916 TGAAATGCTTTGCAAACTGGTGG + Intergenic
1109109097 13:58293022-58293044 AGATGCACATTGCAAGCTGGCGG - Intergenic
1113597098 13:111540812-111540834 ATAGGTAATTTAGAAACTGGAGG + Intergenic
1114819437 14:25999680-25999702 AAATGTACTTTGCAAACTCTAGG + Intergenic
1116130539 14:40850638-40850660 ATAGGTAGTCTGCAAGCTGGGGG - Intergenic
1116313713 14:43359908-43359930 TGAGGTACTTAGACAACTGGAGG + Intergenic
1117741883 14:58827420-58827442 AGAGGAGCATTGAAAACTGGTGG - Intergenic
1118823318 14:69359040-69359062 AGAGGTACTTTTCAGACAGGTGG - Intergenic
1122844407 14:104483774-104483796 AGAGGGACTTTGCCAGGTGGAGG + Intronic
1126349262 15:47727667-47727689 AAAGATCCTTTGCAAACTGGGGG - Intronic
1128156829 15:65396518-65396540 AGTGGTACTAAGAAAACTGGGGG - Intronic
1128183890 15:65627716-65627738 AGAGGCACTTTGGAAACTGCTGG - Intronic
1129155443 15:73714458-73714480 GGAGGGATTTTGTAAACTGGGGG + Exonic
1129638216 15:77345372-77345394 AGAGAAACTATGCAAAATGGGGG - Intronic
1131717467 15:95129103-95129125 CGACGTCCTTTGCAAAATGGAGG - Intergenic
1133514298 16:6493083-6493105 ACAGGTTGTTTGCAAAATGGAGG - Intronic
1135720475 16:24813241-24813263 AGAGATATATTGCATACTGGTGG + Intronic
1139023609 16:62784076-62784098 AAAGGTACTGTGCAAACTGAAGG - Intergenic
1141517040 16:84552397-84552419 AGAGGGACTGTCCACACTGGAGG + Intronic
1141722098 16:85762088-85762110 ATTGGTACTTTGCTAACTGCAGG + Intergenic
1142426589 16:90004896-90004918 AGAGCTCGTTTGCAAACAGGGGG - Exonic
1150476597 17:65480321-65480343 AGAGGTTCTTTGGAAAGTGAAGG + Intergenic
1152002023 17:77652768-77652790 ATAGCTACTTTGGAAACTAGCGG - Intergenic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1154202630 18:12309410-12309432 AGAGATACGTTTTAAACTGGGGG - Intronic
1156022440 18:32615602-32615624 AGAGGTTCTTATCAATCTGGAGG + Intergenic
1156481211 18:37437485-37437507 GGAGATACTATGGAAACTGGGGG + Intronic
1156988546 18:43378547-43378569 AGAGAAACTTTGCACACTGTTGG - Intergenic
1157400314 18:47381799-47381821 GGAAGTGCTTTGCAAACTGTAGG + Intergenic
1158586729 18:58745158-58745180 TGAGGTACTGAGCAAGCTGGGGG + Intronic
1159087529 18:63810434-63810456 AGAGGTTATTTGCAAAGAGGTGG - Intergenic
1162873736 19:13605388-13605410 ATTGGTTCTTTGCAATCTGGGGG - Intronic
925925136 2:8664842-8664864 TCAGTTACTTTGAAAACTGGAGG - Intergenic
927069321 2:19509644-19509666 AGAGGTACTTTACCAAAGGGGGG + Intergenic
928704173 2:33929979-33930001 ATAGGTATATTGCATACTGGTGG + Intergenic
935207187 2:100906198-100906220 CCAGGTGCTTTGCAAACTGTAGG + Intronic
937022932 2:118675024-118675046 AGAGGTACTTTGAAGGCTGAAGG - Intergenic
938318944 2:130349476-130349498 AGATCTACTTTAAAAACTGGTGG - Intergenic
939024045 2:136990612-136990634 GGAGGTGCTTTGCAAAATGTGGG + Intronic
943180580 2:184535666-184535688 AGAGTTAATTTCCAAACTGAGGG + Intergenic
944999475 2:205332788-205332810 CTAGGTACTTTGCACACTGTGGG - Intronic
945910312 2:215641284-215641306 AGATGGACTTTGCAGAATGGAGG - Intergenic
946683388 2:222241164-222241186 AAAGGTAATTTGCACACTGAAGG + Intronic
946876732 2:224136993-224137015 AGAGGTACCTTGACAAATGGTGG + Intergenic
947452224 2:230219537-230219559 AGAGGTACTTGGGAAGCTGGTGG - Intronic
1172458513 20:35096386-35096408 AGAGGTACTTCGCCCTCTGGTGG - Intergenic
1173048331 20:39534334-39534356 AGAGGATCTTTTCAAACTGCTGG - Intergenic
1174406848 20:50308579-50308601 AGAGGGACTTTGCATACAGGAGG - Intergenic
1174574071 20:51524578-51524600 ATAGGTGCTTTTCAAACTAGGGG - Intronic
1175240842 20:57547506-57547528 AGAGGTACTTTGCATCCTCCTGG - Intergenic
1177902777 21:26936875-26936897 AGAAGTACTGTGTAAACTAGGGG + Intronic
1182836676 22:33347816-33347838 ACAAGTACTTTGCAAAGTTGTGG + Intronic
1184830268 22:46981608-46981630 AGAAGTACTGAGCAAAGTGGGGG - Intronic
949262192 3:2115639-2115661 AAAGGTACCTTGTAAACTTGGGG + Intronic
949588315 3:5465722-5465744 ATAGTTACTTTGTAAACTGGAGG + Intergenic
949694615 3:6680352-6680374 AGAGATAGTTTGCAGAATGGTGG + Intergenic
952038883 3:29237319-29237341 AGATGTACTTTCCCACCTGGAGG + Intergenic
952951454 3:38528621-38528643 AGAGGTACTTGGCACACTCAGGG - Intronic
954971934 3:54658733-54658755 AAAGACACTTTGAAAACTGGAGG + Intronic
956710029 3:72030810-72030832 AAAGTTACTTTGCAAGATGGAGG + Intergenic
961655035 3:128436460-128436482 AGACGTAGTCTGCAAACTAGGGG - Intergenic
963285628 3:143431865-143431887 AGATGTACCTGGCAAATTGGAGG - Intronic
966622862 3:181984563-181984585 AGAGCTCCTTTGCAAAAAGGGGG + Intergenic
969367346 4:6704668-6704690 AGAGGAAATTTGCAAAGAGGTGG + Intergenic
971254440 4:25001389-25001411 ATGGGTACTTGGCAAACTGTAGG - Exonic
973752966 4:54042050-54042072 AGAGGTGCTTTGTAAGATGGAGG - Intronic
979238251 4:118425351-118425373 AGAGGTTCTTTTCAAGTTGGAGG - Intergenic
980027885 4:127787961-127787983 AGTGGTAGTTTGCAAACTCCTGG + Intronic
980582755 4:134774560-134774582 TGAGGTACTCTGACAACTGGAGG - Intergenic
986283767 5:6345242-6345264 ATGGGTACTTTCCACACTGGTGG - Intergenic
986931447 5:12827621-12827643 CTAGGTTCTTTGCAAACTTGTGG + Intergenic
988456660 5:31392978-31393000 AGAGGGAGTTTGCAAGGTGGGGG - Intergenic
992155244 5:73948925-73948947 AGAGGTACTTTGTTTCCTGGTGG + Intergenic
992870845 5:81004030-81004052 AGAGGAAATTTTTAAACTGGAGG - Intronic
996773471 5:127109423-127109445 AGAGATACTTTGTAAACTATTGG + Intergenic
997857934 5:137390125-137390147 AAAGGGACTCTGCAACCTGGGGG + Intronic
998749377 5:145301581-145301603 AGAGTAACTTTGTAAACTTGAGG - Intergenic
1000225577 5:159257933-159257955 ACAGGTCGTCTGCAAACTGGAGG - Intergenic
1001960247 5:175875912-175875934 AGAGGTACTTTGCAAACTGGTGG + Intronic
1002738676 5:181417319-181417341 AGAGGTTCTTTTCAAGTTGGAGG - Intergenic
1004425955 6:15507308-15507330 CGAGGGACGTTACAAACTGGCGG - Intronic
1006392422 6:33766384-33766406 AGAGGTATTGTGGGAACTGGGGG - Intergenic
1007227567 6:40325663-40325685 AGAGCTGCTTTGCAGACAGGTGG + Intergenic
1007831726 6:44644018-44644040 GGAGAGACTTTGCGAACTGGAGG - Intergenic
1008171744 6:48216242-48216264 AAAGGGACTTTGGGAACTGGGGG - Intergenic
1008434686 6:51461886-51461908 AAAGGCACTTTGTAAACTGTAGG + Intergenic
1008879987 6:56371975-56371997 AGAGGTGCTTAGCAAAGTGAAGG + Intronic
1011851231 6:91631459-91631481 AGAGGTACTTGGGAAAAGGGAGG - Intergenic
1014227111 6:118861478-118861500 TGAGGTACTTGGACAACTGGAGG + Intronic
1015395038 6:132724011-132724033 AGAAGTATTTTTCAAACTGCAGG + Intronic
1016038070 6:139403650-139403672 AGAGGTACTGGGCAAACAGATGG + Intergenic
1016662210 6:146594928-146594950 AGAGGTTCTTTAAAAAATGGGGG - Intergenic
1018262224 6:161981732-161981754 AAAGTAACTATGCAAACTGGAGG + Intronic
1019072249 6:169356906-169356928 AGATCTACTTTGCAATCTGTAGG + Intergenic
1019243780 6:170692871-170692893 AGAGGTTCTTTTCAAGTTGGAGG - Intergenic
1020734578 7:11931643-11931665 AGAGGTACTTTGAAAACAGGAGG - Intergenic
1023438933 7:40167363-40167385 AGAGGTAGTTTGCAAAGGGCAGG + Intronic
1024228836 7:47348442-47348464 AGAGGTAATTTTCAAAGGGGAGG + Intronic
1026653257 7:72234313-72234335 GGAGGTACTTTGCTGGCTGGAGG - Intronic
1028054491 7:86225678-86225700 AGAGGTACGTGGAAAACTGAAGG + Intergenic
1029458191 7:100681534-100681556 CGAGGCACTTTACAGACTGGGGG - Exonic
1035068285 7:156123406-156123428 AGTGGTACTGTGGAAACTGACGG + Intergenic
1035504343 8:115289-115311 AGAGGTTCTTTTCAAGTTGGAGG + Intergenic
1037461870 8:19118710-19118732 AGAGGTTCTTTTCAGAATGGTGG - Intergenic
1041362192 8:57065987-57066009 AGAGGTACTTGGCAAATGGTGGG + Intergenic
1045477105 8:102562496-102562518 AGACTTACTGTGCAAACTGGAGG - Intergenic
1046244399 8:111539568-111539590 AGAAGTACTGAGCAAAATGGGGG + Intergenic
1048961184 8:139579702-139579724 TGAAGTTCTTTGCAAACAGGAGG - Intergenic
1051990010 9:23141572-23141594 AGAGGACCTTTCCAAACTGCCGG - Intergenic
1056335060 9:85560178-85560200 ATAGGTACTTAGCAAAGTGAAGG - Intronic
1056557212 9:87699765-87699787 AGAGATACTGTGGAAAGTGGAGG - Intronic
1058834957 9:108852828-108852850 AGAGGGATGTTGCAGACTGGAGG - Intergenic
1060566695 9:124599136-124599158 AGAGGAACTTTTTAAAATGGGGG - Intronic
1060760264 9:126241167-126241189 TGATGTTCTTTGCAATCTGGAGG - Intergenic
1062133175 9:134911202-134911224 ATTTGTACTTAGCAAACTGGTGG + Exonic
1203603969 Un_KI270748v1:42094-42116 AGAGGTTCTTTTCAAGTTGGAGG - Intergenic
1187801280 X:23066370-23066392 AGAGGCATTATGCAAAGTGGAGG - Intergenic
1187988502 X:24842267-24842289 AGAGTACCTTTGCAAAATGGAGG - Intronic
1189186911 X:39062632-39062654 AGATGTACCTTGCAAGCTAGTGG + Intergenic
1191016415 X:55814136-55814158 TGAGGTACTTGGACAACTGGAGG - Intergenic
1192095371 X:68205089-68205111 AAAGGTGCTTTGGCAACTGGCGG + Intronic
1193257119 X:79362580-79362602 AGAGCTCTTTGGCAAACTGGCGG - Exonic
1195880258 X:109586084-109586106 TGAGGTACATGGAAAACTGGAGG + Intergenic
1197192022 X:123658137-123658159 AAATGTACATTGCAAACTGTGGG + Intronic
1197303671 X:124813723-124813745 AAAGGTACTTTAGAAACCGGAGG + Intronic
1198793837 X:140374709-140374731 ACAGGTCATTTGCAAATTGGAGG - Intergenic
1199877577 X:151946586-151946608 AGAGGTAGCCTGCACACTGGAGG - Intergenic
1201225646 Y:11816417-11816439 ATAGGTACTTTATAAACTGAGGG - Intergenic
1201570024 Y:15403745-15403767 AGCTGTACATTGCAAACTGAAGG + Intergenic