ID: 1001964775

View in Genome Browser
Species Human (GRCh38)
Location 5:175902515-175902537
Sequence TCTCATCTGCACCAGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001964769_1001964775 9 Left 1001964769 5:175902483-175902505 CCAGAGGCCCTTCTGTTGGCGTT No data
Right 1001964775 5:175902515-175902537 TCTCATCTGCACCAGGAGGACGG No data
1001964770_1001964775 2 Left 1001964770 5:175902490-175902512 CCCTTCTGTTGGCGTTTAAAGAG No data
Right 1001964775 5:175902515-175902537 TCTCATCTGCACCAGGAGGACGG No data
1001964771_1001964775 1 Left 1001964771 5:175902491-175902513 CCTTCTGTTGGCGTTTAAAGAGG No data
Right 1001964775 5:175902515-175902537 TCTCATCTGCACCAGGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001964775 Original CRISPR TCTCATCTGCACCAGGAGGA CGG Intergenic
No off target data available for this crispr