ID: 1001970965

View in Genome Browser
Species Human (GRCh38)
Location 5:175954595-175954617
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 2, 1: 0, 2: 2, 3: 23, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001970965_1001970966 -7 Left 1001970965 5:175954595-175954617 CCAGCAATGGGGCAAAGGGAGGC 0: 2
1: 0
2: 2
3: 23
4: 202
Right 1001970966 5:175954611-175954633 GGGAGGCTACATTAACATTCAGG No data
1001970965_1001970967 2 Left 1001970965 5:175954595-175954617 CCAGCAATGGGGCAAAGGGAGGC 0: 2
1: 0
2: 2
3: 23
4: 202
Right 1001970967 5:175954620-175954642 CATTAACATTCAGGTTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001970965 Original CRISPR GCCTCCCTTTGCCCCATTGC TGG (reversed) Intronic
900167023 1:1247906-1247928 CCCTCCCTTTGCCCCAAGCCTGG - Intergenic
900614968 1:3561337-3561359 GCCTCCCATTGCCAACTTGCCGG - Intronic
902290688 1:15432711-15432733 TCCGCCCCCTGCCCCATTGCTGG - Intergenic
903545336 1:24120424-24120446 GCCTCTCCTTGCCCCATTCCTGG - Exonic
903933654 1:26879619-26879641 GCCTCCACTTTCCCCAGTGCTGG + Exonic
904488560 1:30844073-30844095 TCCTCCATTTGCCCCTTTCCTGG - Intergenic
908004967 1:59718478-59718500 GCCACCCTCTGCCCCATGCCAGG - Intronic
909351205 1:74655537-74655559 GCCTCCCTCTTCCCCATTTAGGG + Intronic
912332298 1:108830785-108830807 GCCTCCCTTTCCCCAACTGGAGG - Intronic
912427342 1:109606240-109606262 GCCTGCCTGTGCCCCTTTTCAGG + Exonic
914221965 1:145689408-145689430 CCCTCCTGTTGCCCCATTGCAGG + Intronic
915839248 1:159201908-159201930 GCCACCCTGTGCCCCCTTCCTGG + Exonic
915921322 1:159977910-159977932 CCCTCCCTTTTCCCCATGGCAGG - Intergenic
916442263 1:164839100-164839122 GCTTCCCTTTGCCCCACTCTTGG + Intronic
920222926 1:204417241-204417263 GCCTCCCTCTGCCCTCTAGCAGG - Intergenic
921285338 1:213604521-213604543 CCCGCCCTGTGCCCCATTTCTGG + Intergenic
921456325 1:215376405-215376427 TCCACCCTTGGCCCCACTGCTGG + Intergenic
924954631 1:248914637-248914659 GCTTCCCTGTGCCCCTTTGCAGG - Intronic
1063565718 10:7171158-7171180 GCCTCCCTTTGCTCCCTCACTGG + Intronic
1064998706 10:21318169-21318191 GACTCTGTTTTCCCCATTGCGGG + Intergenic
1067439289 10:46299603-46299625 GCCTCCCTGTTCCTCACTGCAGG + Intronic
1067750417 10:48967938-48967960 GCCTCCATTTGCCCCAGGACTGG + Intronic
1068963396 10:62887612-62887634 GGCTCCCTTTTCCCCACTGTGGG - Intronic
1070496409 10:77028012-77028034 CCCTCCCTTTGGCACAGTGCCGG - Intronic
1073562091 10:104505779-104505801 ACTCCCCTTTGCCCCACTGCAGG + Intergenic
1074473182 10:113745655-113745677 CCCTCCCTCTGCCCCAGTGGTGG + Intergenic
1075399381 10:122150268-122150290 TCCTCCCTGAGCCCCATTTCAGG - Intronic
1076568876 10:131418831-131418853 GTCTCCCTTTGCAACAGTGCTGG + Intergenic
1076604688 10:131681779-131681801 GCCTCCCTCTGCCACAGTGATGG - Intergenic
1076856506 10:133117904-133117926 CCCTCCCTTTGCCCACGTGCTGG + Intronic
1077528798 11:3085527-3085549 GCCTCCGTTTGCAACTTTGCAGG - Intergenic
1079478081 11:20852090-20852112 ACCTCCTTATGCCTCATTGCTGG + Intronic
1081706924 11:45187664-45187686 GCCTCCCTGTGCCCATCTGCTGG - Intronic
1081803043 11:45872708-45872730 GCCTCCCTTTTTCCCTTAGCTGG - Intronic
1083445842 11:62707557-62707579 GCCTGCCCCTCCCCCATTGCAGG - Intronic
1084021377 11:66420137-66420159 GCATCCCTTCCCCCCGTTGCCGG - Intergenic
1084220367 11:67674211-67674233 GCCTCACTTTGCCCTTTGGCAGG - Intronic
1084748829 11:71190454-71190476 ACGTCCCTTTCTCCCATTGCAGG - Intronic
1085157984 11:74313500-74313522 CCCTCACCTTGCTCCATTGCTGG - Intergenic
1085311702 11:75520767-75520789 TCCTCCCTTTGCCCCCTTTGGGG - Intronic
1087950797 11:104218635-104218657 GCCCCCCTTTGGCCCAAGGCAGG + Intergenic
1087976627 11:104557259-104557281 GCCTGCCTTTGCTCCTTGGCAGG - Intergenic
1088572524 11:111236905-111236927 GCCTCCCTCTTCCACATTGAAGG + Intergenic
1089287721 11:117418321-117418343 CCCTACCTTTGCCCCTTTCCAGG - Intergenic
1089765271 11:120758519-120758541 ACCTCCCGTGGCACCATTGCAGG + Intronic
1090454056 11:126832230-126832252 TCCTCCCTTTGGCTCAGTGCTGG + Intronic
1090838613 11:130471406-130471428 CCCTCCCTTTGCTCCCTGGCAGG - Intronic
1092081893 12:5723373-5723395 GCCTCCCTTCCCCTCATTGGCGG - Intronic
1092083094 12:5734466-5734488 GCCTCCCTTAGCCCCTGTGCAGG - Intronic
1092279450 12:7088786-7088808 TCCCCCCTTTTCCCCATTGCTGG + Intronic
1094394634 12:29992533-29992555 GCCTCCCTCTTCCCCATTTAAGG + Intergenic
1097386956 12:58961736-58961758 ACTTCCCTCTGCCCCATTTCTGG + Intergenic
1098993791 12:77095472-77095494 GTCCAGCTTTGCCCCATTGCTGG + Intergenic
1100196935 12:92256752-92256774 GCCTGCCTTTGACCCTTGGCAGG - Intergenic
1100670972 12:96812518-96812540 GCCTCCATTTCCTCCATTGTAGG + Intronic
1101007190 12:100412410-100412432 CCCTCCCCTTGCCCCCTAGCAGG - Intronic
1103048893 12:117762085-117762107 GCCTTCCACTGCCCCATAGCTGG + Intronic
1103507163 12:121449287-121449309 CCCTCCCTTTGCTCCGTCGCTGG - Intronic
1104639697 12:130459584-130459606 GCCGCCCTTAGCCCCCTTGATGG - Intronic
1104772508 12:131372385-131372407 GCCTCCTTGTCCCCCATTTCTGG - Intergenic
1105538823 13:21297125-21297147 TCCTCCCTTAGCCCCTTTGGAGG - Intergenic
1105871244 13:24507472-24507494 GCCTCCCTCTCCCCCTTGGCTGG + Intronic
1114614568 14:24061475-24061497 GCCTCCCTTTCCCCCATACTAGG + Exonic
1114653786 14:24303776-24303798 GCCTCTCTTTGCCACTTTGATGG + Exonic
1116434722 14:44884302-44884324 GCCTCCCTTCTCCCCATGCCTGG - Intergenic
1117003120 14:51392060-51392082 ACCTCCACTTGGCCCATTGCTGG - Intergenic
1117795397 14:59388466-59388488 GCTTCCCTTTGGCCCAGGGCAGG + Intergenic
1118598328 14:67453305-67453327 GCCTTCCTTTGCACAATGGCTGG - Intronic
1119972971 14:78992964-78992986 GCCACCCTGTGCTACATTGCTGG + Intronic
1120631585 14:86898297-86898319 GCCTCTGTTTGCCAAATTGCTGG - Intergenic
1121640488 14:95481782-95481804 AGCTCCCTTTGCCCGATTCCAGG + Intergenic
1123635066 15:22297336-22297358 GACTGCCGTTTCCCCATTGCAGG - Intergenic
1125481838 15:40086557-40086579 GCCTCCCAATGCCACATAGCTGG + Intergenic
1127674138 15:61224788-61224810 GCCTCCCTGTGTCCCACTTCAGG + Intronic
1128367396 15:67013997-67014019 CCCTCCCTCAGCCCCACTGCAGG - Intergenic
1129123631 15:73419358-73419380 CCCACCCTCTGCCCCATGGCAGG + Intergenic
1129382063 15:75174285-75174307 GCCACCCTTTGCTCCCTTGAGGG + Intergenic
1131035862 15:89221700-89221722 GTCTTCCTTTGCCCCACTGAGGG - Exonic
1131157916 15:90086224-90086246 GCTTCCCTTTTCCCCATACCAGG + Intronic
1133363918 16:5196046-5196068 GCTTCATTGTGCCCCATTGCAGG - Intergenic
1134196086 16:12160174-12160196 CCCACTGTTTGCCCCATTGCTGG + Intronic
1134669706 16:16045814-16045836 CCCTCTCTTTGCTCCTTTGCAGG + Exonic
1138027932 16:53537510-53537532 GCCTCCATTTGTCCCATTGCAGG - Intergenic
1139005104 16:62560065-62560087 TGCTCCCTTTGCCCCAATTCAGG - Intergenic
1141018199 16:80469844-80469866 GCCTCCCTTAGTCCCAGTCCTGG + Intergenic
1141308335 16:82888230-82888252 CGCTCCCATTGCCTCATTGCAGG + Intronic
1141426501 16:83947725-83947747 GCCTCCCTCGGCCCCCCTGCAGG - Intronic
1141693705 16:85610445-85610467 GCCAGCCTTAGCCCCAGTGCTGG + Intergenic
1142617073 17:1142901-1142923 GCCTCCAGTTGCCGCTTTGCTGG - Intronic
1143709462 17:8724320-8724342 TCCTCCTTTTGCCCCAATACCGG - Intergenic
1147249062 17:39142190-39142212 ACCCCCCCTTGCCCCATTGAGGG + Intronic
1148126157 17:45238192-45238214 CCCTCCCTCTGCAACATTGCTGG - Intronic
1148150961 17:45396279-45396301 GCCTCCCTCTGGCCCAGGGCTGG - Exonic
1148745426 17:49915424-49915446 ACCTCTCTGTGCCCCAGTGCTGG + Intergenic
1148849733 17:50548756-50548778 GCCTCCCTCTGACCCGTTGCTGG + Intronic
1151356405 17:73561151-73561173 CCCTCCCTTGGCCCCATCTCGGG - Intronic
1152467537 17:80474585-80474607 CCCTCCCTATCCCCCACTGCAGG - Intronic
1155746498 18:29361582-29361604 TCCTCCCTTTACCCCTTTGAAGG + Intergenic
1157905643 18:51567540-51567562 TCCACCCTTTGCCCCATGGAAGG + Intergenic
1159274134 18:66193652-66193674 GCCTCCCTCTACCACTTTGCTGG - Intergenic
1160538771 18:79609416-79609438 GCCTCCCTGAGCCCCAAAGCTGG - Intergenic
1161349580 19:3784464-3784486 TCCTCCCTTTGCCCCTCTCCCGG - Intronic
1162800059 19:13105234-13105256 TCCTCCCTTTCCTCCACTGCAGG - Intronic
1165094952 19:33405216-33405238 CCCTCCCTGGGCCCCATGGCAGG + Intronic
1166334443 19:42096637-42096659 GCCTCACTTTCCCCCTCTGCAGG + Intronic
1166912268 19:46167467-46167489 GCCTGCATTAGCCCCATTGTAGG - Intergenic
1168131836 19:54326222-54326244 TCCTCCCTGTGGCCCAATGCTGG + Intergenic
1168651644 19:58096027-58096049 GCCTCCTTCAGCCCCATTCCTGG + Intronic
925031704 2:654824-654846 TCCTCCCTGTGCCCCAGTGCTGG - Intergenic
925703394 2:6661448-6661470 GCCTCCATCTCCCCCATGGCAGG + Intergenic
926479412 2:13371643-13371665 GACTGCCATTTCCCCATTGCAGG - Intergenic
926633540 2:15158509-15158531 GCCTCCCATTCCTCCTTTGCTGG + Intergenic
927784583 2:25964880-25964902 TCCTCCCTCTTCCCCATTACAGG + Intronic
928213871 2:29344793-29344815 GCCTTCTTTTGCCCCCTGGCTGG - Intronic
928561828 2:32496471-32496493 GCCTCCATTTCCCAAATTGCTGG + Intronic
929408183 2:41666837-41666859 GCCTCCCTGTGCCACATTTAAGG + Intergenic
929814531 2:45220518-45220540 TCCTCCCTCTGCCCCATTGCTGG + Intergenic
930916788 2:56701263-56701285 GTCACACTTTGCCTCATTGCAGG - Intergenic
934542405 2:95186829-95186851 GCCTCCCCCTGCCCCACAGCAGG + Intergenic
934573211 2:95384840-95384862 GCCTCTCCTTGCCCCAGTCCTGG + Exonic
934690651 2:96356245-96356267 CCCTCCCCTTGCCACATCGCTGG + Intronic
934939903 2:98493161-98493183 GACTCCCTTTGCCCCTATGCTGG + Intronic
935291208 2:101612465-101612487 ACCTCCCTTTTCTGCATTGCTGG - Intergenic
942353056 2:175074999-175075021 GCCTTCTTTTGACCTATTGCAGG - Intronic
944546078 2:200800072-200800094 GCCTCCCTTTTCCACATTTAAGG - Intergenic
944909344 2:204294050-204294072 GCACCACTTTGCACCATTGCTGG - Intergenic
945500436 2:210566258-210566280 CCCTCCCTTTTCCCCAGTGATGG - Intronic
947418368 2:229921381-229921403 GCCTCCCCTTTCCCGATTTCCGG + Intronic
947530451 2:230905782-230905804 ACGTCCCTCTGCCCCACTGCAGG - Intergenic
948567160 2:238894478-238894500 GCCTCCCTCTGGGCCATTGGGGG + Intronic
1170756622 20:19211839-19211861 GTTTCCCTCTGCCCCCTTGCGGG - Intergenic
1172934319 20:38608982-38609004 GCCTCCCTCTTCCCCATTTAAGG + Intronic
1175206400 20:57315088-57315110 GCCTCCCTTGGCACCATGCCTGG + Intergenic
1175239362 20:57535447-57535469 GCCTCCCTCTGACCCATGGTGGG - Intergenic
1175327895 20:58142335-58142357 GCCTGCCTCTGGCCCTTTGCTGG - Intergenic
1175353791 20:58346044-58346066 TCCTCCCTTGGCCTCAGTGCTGG + Intronic
1175569654 20:60009202-60009224 GCCACTCTGTGCCCCATTTCTGG - Intronic
1176888897 21:14290291-14290313 ACCTCACTTTGCCTCCTTGCAGG - Intergenic
1178891706 21:36525553-36525575 GCCTCCCTTTGACCTCATGCCGG - Intronic
1181041708 22:20195445-20195467 GCTTCCCTGGGCCCCACTGCAGG + Intergenic
1182881270 22:33735533-33735555 CCCTCCCTTTCCTCCACTGCTGG - Intronic
1184059804 22:42074704-42074726 CCCTCCCTGTGCCCCAGTGCTGG + Intronic
1184410823 22:44325334-44325356 GCCTCTCTCTGCCCATTTGCAGG - Intergenic
1184502544 22:44882752-44882774 GCCTCCCTCTGGCCCGTTGGAGG - Exonic
1184857723 22:47155647-47155669 GGCTTCCTTTGCCCCTTTGCAGG - Intronic
1185166366 22:49265002-49265024 TCCTTCCTCTTCCCCATTGCCGG - Intergenic
952955877 3:38556843-38556865 GCCTCCCATTGGCCCAGGGCCGG - Intronic
953490371 3:43345285-43345307 ACCTCCCTTGGTTCCATTGCTGG + Intronic
954135872 3:48581883-48581905 ACCTCCCCTTGCCCCATACCAGG + Intronic
954636731 3:52074949-52074971 TCCTCCCTCTGCCCCTGTGCTGG - Intergenic
956605563 3:71069909-71069931 CGCTCCCTTTGCCTCTTTGCAGG - Intronic
958034005 3:88149394-88149416 GCCTCCATTTCCCTCGTTGCCGG - Intronic
958941549 3:100321387-100321409 GCCCCCCTTTGTCTCATTGTGGG + Intronic
960493425 3:118346525-118346547 GCTTCCCTGGGCCACATTGCAGG + Intergenic
960974912 3:123164240-123164262 TCCTCCCTCTGCCCCACTGGAGG + Intronic
961676051 3:128567383-128567405 GTGTCCCTTTGCCACATTGGTGG - Intergenic
964763946 3:160160227-160160249 GCCTGCCTTTGACCCTGTGCTGG - Intergenic
966933677 3:184691809-184691831 CCCTGCCTTTCCCCCATGGCAGG + Intergenic
971191198 4:24430624-24430646 GCCTCCCTGTGGCCCATAGCAGG - Intergenic
972757496 4:42063562-42063584 TCCTCCCATTCCCCCAGTGCAGG - Intronic
981579382 4:146236681-146236703 TCCTCCCTTTGGCCCACTGCTGG - Intergenic
982084337 4:151818331-151818353 GCCTCTGTTTGCACCCTTGCTGG + Intergenic
984141728 4:176012384-176012406 ACCTCCCAGTGCCCCACTGCAGG + Intergenic
988392881 5:30658618-30658640 GCCTTTCTTTGCCCCACTGTAGG - Intergenic
988682636 5:33498637-33498659 GCCTCTGTTTGCCCAATGGCAGG - Intergenic
992810852 5:80387024-80387046 GACTCCCTTTGCCCCCTTGGTGG + Intergenic
994886193 5:105564473-105564495 GGCTCCCTTGTCCCCCTTGCAGG - Intergenic
995112351 5:108442167-108442189 GCCTCCCCTTGCCCCACTGTGGG - Intergenic
995268615 5:110194841-110194863 GCTTCCCTCTGGCCCAGTGCAGG + Intergenic
999247042 5:150160596-150160618 GCCTCTCCTTGCCCCCTTGCTGG + Intergenic
999276903 5:150337569-150337591 GCCCTCCTGTGCCCCATTCCTGG + Intronic
1000170679 5:158700549-158700571 GCCTCCCTGTGTCCACTTGCAGG - Intronic
1001770746 5:174294075-174294097 GCCTCCCTTTTCCACCTTGAAGG - Intergenic
1001970965 5:175954595-175954617 GCCTCCCTTTGCCCCATTGCTGG - Intronic
1002246477 5:177889182-177889204 GCCTCCCTTTGCCCCATTGCTGG + Intergenic
1003995601 6:11537501-11537523 GCTTCCCTCCGCCCCACTGCGGG + Intergenic
1004075700 6:12342252-12342274 GCCTCCAGCTTCCCCATTGCTGG - Intergenic
1006338590 6:33433547-33433569 CCCTCCCTTTCCCCCATGTCTGG + Intronic
1006433886 6:34015856-34015878 GCCTCCCTTTTCTGCACTGCTGG + Intergenic
1006511938 6:34526176-34526198 TCCACCCTTTGCCCCATTCCAGG - Intronic
1008047653 6:46867703-46867725 GCTTCCCTTTGCCCCAGCTCTGG + Intronic
1009778362 6:68235680-68235702 GCCTCTCTCTGCCCTCTTGCAGG - Intergenic
1010076728 6:71806889-71806911 TCCTCCCTTTGCCCCAGGCCTGG + Intergenic
1011333203 6:86233461-86233483 GCCTCCCTCTGGCCCAGGGCAGG + Intergenic
1014730188 6:125023296-125023318 ACTCCCTTTTGCCCCATTGCAGG - Intronic
1016441203 6:144085267-144085289 GACCCCATTTGCCCCAGTGCAGG + Intergenic
1017298704 6:152831309-152831331 GCATCCCTGTGCATCATTGCTGG - Intergenic
1017854510 6:158338654-158338676 GCCTCTCTATTCCCCACTGCAGG - Intronic
1018770822 6:166970387-166970409 TCCTCCCTCTGCCCCAGTGTGGG - Intergenic
1019568027 7:1694298-1694320 GCCTCCCTTTGCCGTTTTGCTGG + Exonic
1021368083 7:19806619-19806641 TCCTCCCTTTTCCTCATTGAGGG + Intergenic
1022410307 7:30134905-30134927 GCCTCCCCCCGCCCCCTTGCGGG - Exonic
1024093505 7:45966874-45966896 GCCTCCCTTTGCCTGAATGCAGG + Intergenic
1024313585 7:47992275-47992297 GCCCCACTTTTCCCCCTTGCGGG - Intronic
1024494950 7:50034981-50035003 GCCTCTATTTGCCCGATGGCAGG + Intronic
1026582980 7:71633369-71633391 GCCTCAGTCTGCCCCTTTGCAGG - Intronic
1032875413 7:136033135-136033157 TCACCCCTTTTCCCCATTGCAGG + Intergenic
1033620711 7:143059867-143059889 GCCTCCCTCTGTCTCAGTGCAGG - Intergenic
1038460164 8:27709520-27709542 GCCTCCCCCTGCCTCAGTGCTGG - Intergenic
1038546694 8:28431183-28431205 CCCTCCCTTTTCACCATGGCAGG + Intronic
1039606348 8:38884021-38884043 GCCTCCCCTTACCCCACTCCTGG - Intergenic
1040514583 8:48124503-48124525 TCATCCCTTTGGTCCATTGCTGG + Intergenic
1041852308 8:62405215-62405237 GCCACCCTTAGCCCAATGGCAGG - Intronic
1042738729 8:72018781-72018803 GCCTCCTTTTGCCTCCTAGCTGG + Intronic
1046431508 8:114134644-114134666 GCCTCCCTTTGGCCACTTGGTGG + Intergenic
1049208393 8:141374070-141374092 GGCTGCCATGGCCCCATTGCAGG + Intergenic
1049363402 8:142224998-142225020 GCCTCCCTTGGCTCTGTTGCTGG - Intronic
1050145225 9:2560257-2560279 GCTTCCCTTTGGCCCAGAGCAGG - Intergenic
1059032786 9:110718146-110718168 GCCTCCCTTTGTCCCCATGTGGG + Intronic
1059421351 9:114194441-114194463 ACCTACCTTTGCCCCATCGTGGG - Exonic
1059634040 9:116154744-116154766 GCCTCACTTTGCTCCATCGGTGG + Intronic
1060414492 9:123420874-123420896 CCCTCCCCCTGCCCCACTGCTGG - Intronic
1061244140 9:129392559-129392581 GCCCACCTTTGCCCAATAGCTGG + Intergenic
1061755485 9:132809394-132809416 GCCTCCCTCTTCCCCAGAGCAGG + Intronic
1061904996 9:133692194-133692216 GCCTCAGTTTCCCCCATTGGTGG - Intronic
1061905760 9:133696051-133696073 GGCCCCCTTTGCCCCATCCCAGG - Intronic
1061960459 9:133986188-133986210 GCTTGGCTGTGCCCCATTGCTGG - Intronic
1062244985 9:135561617-135561639 GCCTCCCATTGCCCCAGTGGAGG + Intergenic
1062249661 9:135587816-135587838 GCCTCCCATTGTCCCAGTGGAGG + Intergenic
1062652034 9:137582823-137582845 GTCTCCCTTTGCCCTTGTGCTGG - Intronic
1188543883 X:31280459-31280481 GCCTCCTTGTGCCCCTTTGCAGG - Intronic
1191079452 X:56493808-56493830 GCTTCCCTTTGCGCCTTTGTGGG + Intergenic
1192841209 X:74857753-74857775 GCCTCCCTTTGGCCCAGGGCAGG - Intronic
1194914408 X:99687304-99687326 TGCTCCCATTGTCCCATTGCTGG - Intergenic
1195381034 X:104270879-104270901 GCCCCCTTTTGCCTTATTGCTGG - Intergenic
1195462017 X:105138199-105138221 GTCTCCCTTTGCACCATTCCTGG + Intronic
1196056660 X:111363317-111363339 GCCTCCCTTCCCCCAATGGCTGG - Intronic
1196814420 X:119653632-119653654 ACCTCTCTTTGGCCCACTGCTGG + Intronic
1198832616 X:140766089-140766111 GCCCACCTTTTCCCCATTCCAGG - Intergenic