ID: 1001971373

View in Genome Browser
Species Human (GRCh38)
Location 5:175957464-175957486
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 2, 1: 0, 2: 0, 3: 31, 4: 286}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001971373_1001971376 -7 Left 1001971373 5:175957464-175957486 CCTCCTAGGAGCCTGCTCTGGGC 0: 2
1: 0
2: 0
3: 31
4: 286
Right 1001971376 5:175957480-175957502 TCTGGGCTTAGCCCCTTCCTTGG No data
1001971373_1001971380 9 Left 1001971373 5:175957464-175957486 CCTCCTAGGAGCCTGCTCTGGGC 0: 2
1: 0
2: 0
3: 31
4: 286
Right 1001971380 5:175957496-175957518 TCCTTGGATCCACCTGCCTCTGG 0: 2
1: 0
2: 0
3: 36
4: 564
1001971373_1001971382 14 Left 1001971373 5:175957464-175957486 CCTCCTAGGAGCCTGCTCTGGGC 0: 2
1: 0
2: 0
3: 31
4: 286
Right 1001971382 5:175957501-175957523 GGATCCACCTGCCTCTGGTCAGG 0: 2
1: 0
2: 0
3: 14
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001971373 Original CRISPR GCCCAGAGCAGGCTCCTAGG AGG (reversed) Intronic
900340510 1:2186506-2186528 GGCCAGCTCAGGCTTCTAGGTGG + Intronic
900360599 1:2287088-2287110 GCCCAGAGCTGGCTGCTGTGGGG - Intronic
900391260 1:2434958-2434980 GCCCAGAGCTGGCTTCTCAGGGG + Intronic
900438821 1:2643437-2643459 GCCCAGAGGAGGCGGCTAGATGG - Intronic
900591051 1:3460104-3460126 CCCGAGAGCCGGCTCCTGGGGGG + Intronic
901506282 1:9687910-9687932 GCCCAGAGCACCCCCCAAGGAGG - Intronic
902818166 1:18927787-18927809 GACCAGAGCAGGCTCCCCGGTGG + Intronic
902856546 1:19210292-19210314 GCCCAGCGCCGCCTCCCAGGAGG + Intergenic
903008437 1:20313878-20313900 GCCCAGATCAGGGACCAAGGAGG + Intronic
903163251 1:21504008-21504030 GCTCAGAGCTGACTGCTAGGAGG + Intergenic
903175220 1:21576440-21576462 CCCCAGATTAGGCTCCTTGGTGG - Intronic
903631447 1:24776079-24776101 GCACAGAGCAGGCTCCAAGTAGG - Intronic
903846321 1:26281549-26281571 GCCCAGGGCAGGGACCCAGGAGG - Intronic
904313465 1:29644498-29644520 GACCAGAGCAGGCTAAGAGGAGG - Intergenic
905270778 1:36786156-36786178 GCCCAGAGAAGGATTCGAGGAGG - Intergenic
905369802 1:37476903-37476925 GCCCTGAGGGAGCTCCTAGGTGG + Intronic
906204141 1:43978411-43978433 GCACAGAGCTTGCTCCTAGGTGG + Intergenic
906684489 1:47754855-47754877 GACCAGAGCACGCTTCTACGAGG + Intergenic
906691885 1:47798203-47798225 GCCCAGAGGAGGCACCTAATAGG + Intronic
911548014 1:99244180-99244202 GCCCAGAGCAGGCAACAAGTGGG + Intergenic
912230145 1:107783636-107783658 GGCCAGAGAAGGCTCCGTGGAGG - Intronic
912478587 1:109959972-109959994 GCCCAGGGCAGTCTCCTAAAAGG - Intergenic
915349281 1:155214428-155214450 GCCCACAGCAGGATCCTTGATGG + Intergenic
915352468 1:155235055-155235077 GCCCACAGCAGGATCCTTGATGG + Exonic
915489714 1:156244282-156244304 GCCCAGGGCAGGTTCCTGTGTGG + Exonic
917294240 1:173502444-173502466 GGCCAGAGCAGACTGCTGGGTGG - Intronic
917300201 1:173565279-173565301 GCCCAGACCAGTGTCCTAGAGGG + Intronic
921346165 1:214187522-214187544 GCTCAGGGCAGGCGCCAAGGGGG + Intergenic
922763233 1:228145097-228145119 TCTCAGAGCAGGCTCCCAGAGGG + Intronic
922766501 1:228159012-228159034 GCCCAGGGCTGGCTCCGAGAAGG + Exonic
1062813656 10:483686-483708 GCCCAGAGAGGGCTCCTGAGAGG + Intronic
1066480889 10:35794740-35794762 TCCTAGACCAGGCTCCGAGGAGG - Intergenic
1067094884 10:43293914-43293936 GCCCAGAGCAAGACCCTGGGGGG - Intergenic
1067439790 10:46302135-46302157 CCCTTGAGCAGGGTCCTAGGTGG + Intronic
1067581940 10:47451717-47451739 GCCCTGAGCAGGGTCCTAAGTGG + Intergenic
1069605610 10:69737062-69737084 GCACAGAGCAGGCTAATTGGTGG + Intergenic
1070542296 10:77425008-77425030 GGCCAGGGCAGGCACCTGGGAGG + Intronic
1070546929 10:77459719-77459741 GCCAAGAGCGGGCCCCTGGGAGG - Intronic
1072191653 10:93081002-93081024 GGACAGAGCATGCTCTTAGGAGG + Intergenic
1074055869 10:109922822-109922844 GCCCAGGGCAGGCTACTGGGGGG + Intronic
1074569563 10:114612086-114612108 AACCATAGAAGGCTCCTAGGAGG - Intronic
1075266237 10:121001504-121001526 TCCCAGAGCAGGAGCCCAGGAGG - Intergenic
1076550309 10:131273628-131273650 GCCGAGAGGAGGCTCCAGGGCGG + Intronic
1076734730 10:132453511-132453533 GCCCGGAGGAGGCTCATAGGAGG + Intergenic
1076784321 10:132742169-132742191 GAACAGAACAGGCTCCTATGAGG - Intronic
1077108098 11:850517-850539 GCCCAGTCCAGGCTCCTAGCCGG - Intronic
1077194177 11:1271024-1271046 GCCCAGAACAGGCACTGAGGAGG + Intergenic
1077196299 11:1282211-1282233 GCCCAGAGAAGGATCAGAGGAGG + Intronic
1077320233 11:1937725-1937747 GCCCAGGGCGGGCTCCTCCGTGG + Intronic
1077577669 11:3397173-3397195 GGCCAAGGCAGGCTGCTAGGAGG - Intergenic
1077917624 11:6621701-6621723 GCCCAGGGCAGGCTCAGAGTGGG + Exonic
1079645737 11:22861890-22861912 GATCTGAGGAGGCTCCTAGGAGG - Intergenic
1080029566 11:27646612-27646634 GCTCAGAGCAGGTTGCTTGGAGG + Intergenic
1080606394 11:33868797-33868819 GCCCAGAGCCAGCTCCGAGGTGG + Intronic
1080798268 11:35585983-35586005 ACCCAGAGCTGTCTCCCAGGAGG - Intergenic
1081566647 11:44264747-44264769 GCCCAGGCCAGGTTCCTAAGAGG + Exonic
1081645574 11:44787952-44787974 GCCTGGACCAGGCTCCTAGTAGG - Intronic
1084161582 11:67353237-67353259 GCCTAGAGGAGGCCCCTAGAGGG - Intronic
1085049089 11:73370662-73370684 GCCCAGGGGAGGCTCCTGGAAGG + Intergenic
1085347607 11:75778344-75778366 GCGCAGAGGAGGCTCCAAGGAGG - Intronic
1085640340 11:78189119-78189141 GGCCAGAGCCGGCTGCTGGGCGG - Exonic
1086932694 11:92709720-92709742 ACACAGAGGAGGCACCTAGGTGG + Intronic
1088829162 11:113520587-113520609 GGGCACAGCAGGCTCCTAGAGGG + Intergenic
1088906093 11:114156498-114156520 GGCCACAGCAGGCTCTGAGGAGG - Intronic
1089089809 11:115862207-115862229 GCCCAGGGCAGCCTTCGAGGTGG + Intergenic
1089152750 11:116376671-116376693 ACACAGAGCAGGCTTCCAGGAGG - Intergenic
1089496682 11:118911568-118911590 GCTCTGAGCAGGCTCCTGGCTGG + Intronic
1089563021 11:119355390-119355412 GCACATTCCAGGCTCCTAGGAGG - Exonic
1089964782 11:122647025-122647047 GCCCTAAGGAAGCTCCTAGGAGG + Intergenic
1090404431 11:126468369-126468391 GCCCACTGCAGGCTCCCAGCGGG - Intronic
1090831841 11:130425924-130425946 CCCCACACCTGGCTCCTAGGGGG - Intronic
1091307193 11:134543817-134543839 GCCAAGAGCTGGCTCCCATGAGG - Intergenic
1092239105 12:6826767-6826789 GCCCAGAGCCGGGCCCTCGGGGG + Exonic
1092988458 12:13870503-13870525 GCTCAGAGCAGGCTCAGAGCAGG + Intronic
1095878463 12:47106941-47106963 GTCCAGAGTGGGTTCCTAGGAGG - Intronic
1103733487 12:123043755-123043777 CCACAGAGCAGGCTCCGAGAGGG + Intronic
1105628282 13:22135289-22135311 GCCCAGAGCAGCCTCCACAGAGG - Intergenic
1106300788 13:28462854-28462876 GCACAGAGCAGGCCCCTATCTGG + Intronic
1106587577 13:31070588-31070610 GCTCAGAGCAGACTTCTAGCAGG - Intergenic
1113542389 13:111119046-111119068 GCCCTCAGAAGGCTCCAAGGAGG + Intronic
1113914190 13:113861213-113861235 CCCCTGGGCAGGCTCCTACGAGG - Intronic
1113973825 13:114211509-114211531 GCGGAGAGCAGGGTCCCAGGCGG - Intergenic
1114049717 14:18913186-18913208 GCCCAGAGCTGGCACATAGCAGG - Intergenic
1114526668 14:23370863-23370885 TCCCAGAACAGGATCTTAGGAGG - Intergenic
1114618172 14:24079544-24079566 TCCCATTGCAGGCTCCTAAGCGG + Intergenic
1115485845 14:33910603-33910625 GCGAAGACCAGGCTCCTATGTGG + Intergenic
1118982071 14:70725145-70725167 GCCCAAAGCAGGCTCCCCGTAGG + Intronic
1119046377 14:71321276-71321298 GCCCGGAGCAGGACCCCAGGAGG + Intronic
1119519302 14:75274035-75274057 GCCCAGTGAAGGGTCTTAGGAGG - Intergenic
1119558248 14:75569721-75569743 GACCATAGCAGCCTCCTAAGAGG + Intergenic
1120914764 14:89701575-89701597 GCCCAGAGTGGGCTGCCAGGTGG - Intergenic
1121327291 14:93028651-93028673 GCCCAGAGCAGGCCCCCTGCAGG + Intronic
1121330547 14:93046911-93046933 GCCCAGAGCAGGCGGCTGGTAGG + Intronic
1122234373 14:100323574-100323596 GCAGAGAGCAGGTTCCTGGGAGG + Intronic
1123018877 14:105388330-105388352 GTCCAGAGCACACTCCCAGGAGG - Intronic
1124399611 15:29336779-29336801 GCCCACAGCTGGCTCCTGGTAGG + Intronic
1124693577 15:31845528-31845550 GCCCAGAGCCGGATCCTCTGTGG - Intronic
1126684847 15:51239860-51239882 TCCCAGAGCAGGGAACTAGGGGG - Intronic
1127067702 15:55257608-55257630 GCCTATTGCAGGCTCCTAAGAGG - Intronic
1128061720 15:64739575-64739597 ACCAAGAGCAGGCCCCCAGGTGG - Intergenic
1128661115 15:69501719-69501741 GCACAGAGCAGGACCCTCGGAGG - Intergenic
1129294876 15:74594680-74594702 ATCCAGAGCATGCTCCCAGGAGG - Intronic
1129664384 15:77571475-77571497 GCCCAGGGCAGCCTCAGAGGAGG + Intergenic
1129760069 15:78124163-78124185 GCCCTGAGCATGGTGCTAGGGGG + Intronic
1130353276 15:83109186-83109208 GGCCAGGGAAGGCTTCTAGGAGG + Intronic
1130542103 15:84827644-84827666 GCACAGAGCAGGGTCCAAGGAGG + Intronic
1132336248 15:101050393-101050415 TCCCAGAGCAGCCTGCCAGGGGG + Intronic
1132345199 15:101103857-101103879 GCCCAGAACACTCTCCCAGGCGG + Intergenic
1132828376 16:1916086-1916108 GCTCATTGCAGGCTCCTAGCAGG + Intronic
1134221094 16:12354673-12354695 GCCCAGAGGAAGCTCGTGGGGGG + Intronic
1135221910 16:20621334-20621356 GCCCAGGGTAGGGTCCTGGGGGG + Intronic
1135685692 16:24496752-24496774 GCCCAGGCCTGGCTCCTTGGTGG + Intergenic
1135809875 16:25577393-25577415 GCACAGAGCAGGCCCCTGGGAGG - Intergenic
1137289444 16:47041943-47041965 GCCTTGAGCAGGCTTCCAGGAGG - Intergenic
1137575470 16:49597019-49597041 GCCCAGAGAGAGCTCTTAGGTGG - Intronic
1138510241 16:57504539-57504561 GCCCAGAGCAGGGGCCTGAGAGG + Intergenic
1138582862 16:57952952-57952974 CCCCAGGGCAGGCCCCCAGGAGG + Intronic
1139131838 16:64156153-64156175 GCCGAGACCAGGCTACTGGGAGG - Intergenic
1140144797 16:72296172-72296194 GCCCAGTGTTGGCTCCAAGGAGG + Intergenic
1140229550 16:73106227-73106249 GCCCACTGCTGGGTCCTAGGTGG + Intergenic
1140278157 16:73529539-73529561 GACCTCAGCAGGCTCCCAGGAGG - Intergenic
1140898759 16:79349270-79349292 GCCCAGGTCAGGCTCCTAAGAGG + Intergenic
1141431041 16:83970299-83970321 GCCCAGAGCCGGCACCTACCTGG + Intronic
1142203947 16:88773857-88773879 GCCCAGAGCAAGCTCCGGTGGGG - Intronic
1142285402 16:89169604-89169626 GCCCAGAGTGGGGTCCTAGCTGG + Intergenic
1143376094 17:6468524-6468546 GGCCAGAGCAGTCTCCCAGCTGG + Intronic
1143550474 17:7627506-7627528 GGCCAGAGCGGGGTCGTAGGAGG - Intronic
1144515377 17:15914038-15914060 GCCAGGAACAGGCACCTAGGCGG + Intergenic
1145903035 17:28500203-28500225 CCCCAGAGTAGGCTCCTTGGGGG + Intronic
1146197212 17:30824217-30824239 GACCAGAGCAGAATCCGAGGGGG - Intronic
1147722941 17:42549945-42549967 GCCCAGTGGAGGGTCCCAGGGGG + Exonic
1147724152 17:42556172-42556194 GCCCAGTGGAGGGTCCCAGGGGG + Intergenic
1147867628 17:43563684-43563706 GATCAGAGCAGCCTCATAGGAGG + Intronic
1148339980 17:46867594-46867616 GGACAGAGCAGTCTCCTGGGAGG + Intronic
1149412894 17:56427290-56427312 GCTCAGAGTAGGCTCTTAGAGGG + Intronic
1149780339 17:59392482-59392504 GCCCTGAGCTGGCACATAGGAGG - Intronic
1150431695 17:65123291-65123313 GCCCAGAGCAGGGACCTAAGAGG + Intergenic
1151364194 17:73606471-73606493 GCCCATACCAGGCTCTGAGGAGG - Intronic
1151385064 17:73750160-73750182 GGCCAGACCAGTCTCCCAGGAGG - Intergenic
1151572976 17:74936355-74936377 GCGCAGGGCCGGCTCCGAGGAGG - Intronic
1152069501 17:78127919-78127941 GCCCAGAGCTGGGTCCGAGGCGG + Intronic
1152666329 17:81571865-81571887 CCCCAGAACAGGCACCCAGGAGG - Intronic
1157498283 18:48171689-48171711 GCCCAGAGCAGGCACACAGTAGG + Intronic
1157616705 18:48991538-48991560 GCCCCGGGCAGGCTCCTGAGTGG - Intergenic
1158505638 18:58044282-58044304 GCGCAGAGGAGGCTCGGAGGGGG + Intergenic
1159925046 18:74261873-74261895 GAGCAGAGCGGGCTCCTAGCAGG + Intronic
1160444335 18:78915378-78915400 GCCAAGAGCAGCCGCCCAGGAGG - Intergenic
1160748592 19:723056-723078 ACCCGGAGCAGCCTCCCAGGCGG + Intronic
1160793530 19:933628-933650 GCTCTGAGGAGCCTCCTAGGAGG + Intronic
1161155244 19:2729189-2729211 GCCTAGACCAGGCTCCTGTGAGG - Intronic
1161161256 19:2762898-2762920 GCCCAGAGCGGGCTGAGAGGAGG + Intronic
1161707611 19:5829439-5829461 GCCCAGAGCAGGCACCGGCGAGG + Intergenic
1161778958 19:6279147-6279169 CCGCAGAGCAGGGTCCCAGGGGG + Intronic
1162111891 19:8403948-8403970 GCCCAGAGCACGGTTCTGGGTGG - Exonic
1162531655 19:11239647-11239669 GCCCAGAGCAGGCACAGAGCAGG - Exonic
1162635688 19:11965435-11965457 GCCCAGAGAGGGCTCCGGGGCGG - Intronic
1162977409 19:14216478-14216500 GCCCAGAACAGGATGCTGGGGGG + Intergenic
1163167465 19:15508091-15508113 CCCCAGAGGAGGCTTCTCGGGGG + Intergenic
1163650819 19:18516663-18516685 ACCCAGAGCTGGCTCCTGGGGGG - Intronic
1163676905 19:18659944-18659966 CCCCAGAGCAGACTCTCAGGCGG + Intronic
1165141730 19:33703940-33703962 GCACAGCGCAGGCTCCTAGTGGG + Intronic
1165903851 19:39181594-39181616 GCCAGGAGGAGGCTCCTGGGTGG - Intronic
1166329199 19:42069099-42069121 GCGCAGAGCAGGCCCCTAGTGGG + Intronic
1167493504 19:49805248-49805270 GGCCAAAGGAGGCACCTAGGGGG + Intronic
1167671861 19:50858247-50858269 CCCCAGTGCTGGCTCCTGGGTGG - Exonic
1167674615 19:50876690-50876712 CCCCAGTGCTGGCTCCTGGGTGG - Exonic
925276345 2:2650989-2651011 GCCAAGGGCAGGATCCTGGGAGG + Intergenic
926000162 2:9324271-9324293 TCCCAGAGCAGACTCTTAAGTGG + Intronic
926227776 2:10980701-10980723 GCCCAGAGCAGGCCCCTGGCTGG - Intergenic
926321192 2:11749368-11749390 GCCCAGTGTGGCCTCCTAGGGGG - Intronic
927713969 2:25341263-25341285 GCCCCGCGCAGGCTCCGCGGCGG - Intronic
927717733 2:25363467-25363489 GCTCTGTGCAGGCTCCTAGAGGG - Intergenic
927886397 2:26721282-26721304 GCCCAGAGAAGGTTCCCAGAAGG + Intronic
932486138 2:72085411-72085433 GGCCTGAGCAGCCTCCCAGGGGG - Intergenic
933949244 2:87314050-87314072 GCCCAGAGCAGCCTCCCACGGGG - Intergenic
934640775 2:96026016-96026038 CCCAAGAGAAGGCTCTTAGGTGG + Intronic
935654428 2:105409724-105409746 GCCCTGAGATGGCTCCAAGGTGG - Intronic
936080743 2:109430882-109430904 GCCCACAGCATGTCCCTAGGAGG + Intronic
936330953 2:111547547-111547569 GCCCAGAGCAGCCTCCCACGGGG + Intergenic
938303132 2:130230093-130230115 CCCCAGAGCAGGCTGCTGGACGG - Intergenic
938763405 2:134444642-134444664 GCTCAAAGCAGGCTCCAAGTTGG - Intronic
938918753 2:135972494-135972516 GCCCAGACCAGTGTCCTAGAGGG - Intronic
939173455 2:138722661-138722683 GCCCAGTCCAGGCTAGTAGGTGG + Intronic
941905713 2:170715399-170715421 GCTCAGAGCAGGCGCCAGGGAGG + Exonic
943725220 2:191245684-191245706 GCGCGGAGCAGGCGCCTCGGGGG - Intronic
946228426 2:218277176-218277198 TCCCAGTGCTGCCTCCTAGGGGG + Intronic
946470922 2:219960334-219960356 TCCCAGAGCAGGAACCCAGGCGG + Intergenic
948250930 2:236528425-236528447 GAACAGAGTAGGCTCCAAGGTGG - Intergenic
948553057 2:238787661-238787683 GCCCAGTCCCAGCTCCTAGGCGG + Intergenic
948696643 2:239736270-239736292 GCCCGGAGCTGGCTCCAAGGAGG + Intergenic
1168827184 20:821830-821852 GACCAAGGCAGGCTTCTAGGAGG - Intergenic
1169108961 20:3019710-3019732 GGCCAAAGCAGGCTGCTGGGAGG + Intronic
1171232937 20:23501628-23501650 GACCACAGCTGACTCCTAGGTGG - Intergenic
1171423936 20:25037829-25037851 GGCCAGAGGAGGCTGCCAGGAGG - Intronic
1172844364 20:37920966-37920988 GCCCAGATCAGGCACACAGGAGG - Intronic
1175985249 20:62761210-62761232 GCCCAGAGCTGGCTTCAGGGTGG + Exonic
1176098675 20:63355350-63355372 GCCCATGTCAGGCTCCTAGGAGG - Intronic
1176300077 21:5095215-5095237 GCCCACAGCGGGCCCCTACGAGG - Intergenic
1178470081 21:32884738-32884760 GCCAAGAGCAGCATCTTAGGGGG - Intergenic
1178690444 21:34745776-34745798 GCCCAGAGAAGCCCCCTAGGAGG - Intergenic
1179856945 21:44166696-44166718 GCCCACAGCGGGCCCCTACGAGG + Intergenic
1180631843 22:17235200-17235222 TGCCAGAGCAGCCTCCTAGGCGG + Intergenic
1180801958 22:18636134-18636156 GCCCACAGCAGCCTCTTAAGGGG - Intergenic
1180853193 22:19031675-19031697 GCCCACAGCAGCCTCTTAAGGGG - Intergenic
1181219762 22:21359127-21359149 GCCCACAGCAGCCTCTTAAGGGG + Intergenic
1181468642 22:23124741-23124763 GCCCAGATCAGGGTCCCAGCAGG - Exonic
1181630334 22:24147817-24147839 GCCCAGAGCAGTGTCCTACGAGG - Intronic
1181756633 22:25028953-25028975 GCCCAGAGCAGCGTCCAAGCTGG + Exonic
1182476431 22:30579073-30579095 GGCCAGAGCAGGCACCAAGCAGG + Intronic
1182741608 22:32572027-32572049 GCCCAGAGCTCGCTCACAGGAGG + Intronic
1183218763 22:36498273-36498295 GCCCAGCGCAAACGCCTAGGTGG + Intronic
1183483650 22:38078024-38078046 CCCCTAAGCAGGCTTCTAGGTGG - Intergenic
1184819868 22:46902128-46902150 TCCCACAGAAGGCTCCCAGGAGG - Intronic
1184871914 22:47245960-47245982 GCCCAGCACTGGCCCCTAGGAGG - Intergenic
1185046528 22:48531278-48531300 GCCCAGGACAGGCTCCCAAGAGG - Intronic
950024330 3:9810181-9810203 GCCCATGGCAGCCTCCTGGGTGG - Exonic
950466827 3:13160796-13160818 GCACAGAACAGGCACCCAGGGGG - Intergenic
953707328 3:45241104-45241126 TCCCACAGCTGGCTCCAAGGAGG - Intergenic
954759935 3:52866701-52866723 GCCCAGATCGGGCTCTGAGGAGG - Intronic
955101145 3:55851255-55851277 GCCTGGAGCAGGCTCCTACGTGG + Intronic
955377646 3:58411412-58411434 GACCAGCGCAGGCTCCTTGGGGG + Intronic
956663999 3:71624996-71625018 TCCCAGCTCAGGCTCCTGGGTGG - Intergenic
958632202 3:96699278-96699300 GCCCAGTGCAGTCTCATTGGTGG - Intergenic
961346928 3:126269006-126269028 GCCCAGGACAGGCTCCTACCTGG - Intergenic
964622841 3:158733068-158733090 GCCCAGAAGAGGCGCCGAGGAGG + Intronic
965442332 3:168729904-168729926 CCCCACAGCAGACTCCAAGGAGG + Intergenic
966816774 3:183896185-183896207 GCACAGAGCTGGATCCTGGGTGG - Intergenic
967812499 3:193772646-193772668 TCCCAAAGCAGCCTCCGAGGTGG - Intergenic
968185814 3:196632978-196633000 AGCCAGAGCCGGCTCCAAGGAGG + Intergenic
968525698 4:1055564-1055586 GCCCAGGGGAGGCGCCTGGGAGG + Intergenic
968657906 4:1786565-1786587 GGCCAGAGCAGGCTTCTTGCAGG + Intergenic
968918052 4:3505909-3505931 GACCAGAGCAGGCTCGGAGCAGG - Intergenic
969618632 4:8268002-8268024 GCCCAGAGCTGGCTTTTTGGGGG - Intergenic
969870388 4:10101018-10101040 GCCCAGGGCAGGCTTCCTGGAGG - Intronic
970364091 4:15341311-15341333 CCCAAGAGCAGGGTCCCAGGCGG - Intronic
970578398 4:17450435-17450457 GCACACAGCAGGCTCTCAGGAGG + Intergenic
975139119 4:70902400-70902422 GCCGAGAGCCGGCTGCTCGGTGG - Exonic
975141499 4:70923296-70923318 CCCCAGAGCATCCTCCTATGGGG + Intronic
976333662 4:83861330-83861352 GCACACATCAGGCTCCTGGGAGG - Intergenic
979273635 4:118791883-118791905 GGCCAGGGCAGGCGCCTGGGAGG - Intronic
982133260 4:152248656-152248678 GCCCAGTTCAGGCTCCTCCGTGG + Intergenic
983542779 4:168930943-168930965 CCCCACAGCAGGCACCTAAGGGG - Intronic
983984374 4:174040527-174040549 AGTCAGAGAAGGCTCCTAGGAGG + Intergenic
985335406 4:188887544-188887566 TCCCAGAGCAGGCTCTTTGCAGG - Intergenic
986253280 5:6080691-6080713 GCCAGGAGCAGGCTCCCAAGGGG + Intergenic
986560213 5:9053269-9053291 GCCCAAGGCTGGCTCCTATGAGG + Intronic
990634830 5:57713092-57713114 TGCCAGAGCAGGCACCTATGGGG + Intergenic
991432238 5:66560042-66560064 GCCCAGAGCATGCTGCAAGTGGG - Intergenic
997260140 5:132459510-132459532 TCCTAGAGCAGGGTCCCAGGGGG + Intronic
998139100 5:139689970-139689992 GCCCAGACCTGGCCCCCAGGAGG - Intergenic
998350483 5:141497221-141497243 GATCAGAGAAGGCTTCTAGGAGG + Intronic
999309534 5:150543020-150543042 GGCCACAGCAGACTCCTGGGAGG - Intronic
1000250896 5:159494386-159494408 CCCCAGAGCTGACTCCCAGGTGG + Intergenic
1001539189 5:172525259-172525281 GCACAGGGCAGTCTCCTACGAGG + Intergenic
1001603233 5:172942752-172942774 TCCCAGAGCAGGTTCGGAGGCGG + Intronic
1001971373 5:175957464-175957486 GCCCAGAGCAGGCTCCTAGGAGG - Intronic
1002246069 5:177886313-177886335 GCCCAGAGCAGGCTCCTAGGAGG + Intergenic
1002328156 5:178423489-178423511 GCCCAGCGTAGGCTCCTGTGAGG + Intronic
1002524467 5:179807361-179807383 GCCCAGAGGAAGCTCCTGAGCGG - Intronic
1002549985 5:179980971-179980993 GCACAGAGGAGGCGACTAGGAGG + Intronic
1002688246 5:181032355-181032377 GGCCAGAGCCGACTCCGAGGCGG - Intergenic
1003171441 6:3724635-3724657 GCCCCGAGGTGGCTCCCAGGAGG - Intronic
1004186543 6:13426217-13426239 GCCCAGAACTCCCTCCTAGGAGG - Intronic
1005694939 6:28343093-28343115 GCCCAGATAAGGCTCATAGTGGG + Intronic
1006175457 6:32118700-32118722 GGCCAAAGCAGGCAGCTAGGAGG + Intronic
1006669415 6:35720356-35720378 GCCCACACCAGGCTCCCTGGGGG + Exonic
1006876702 6:37303793-37303815 CCCCAGGGAAGGCTTCTAGGAGG - Intronic
1007406150 6:41637443-41637465 GCCCAGACGCGGCTCCTAGGCGG + Intronic
1007585128 6:42984732-42984754 GCTCCGCGCAGGCTCCAAGGCGG - Intronic
1010954161 6:82071318-82071340 GCACAGAGCAGGCACCGAGCAGG + Intergenic
1011540471 6:88422229-88422251 GCACAGAGGAGGCTTCCAGGGGG + Intergenic
1017788950 6:157778800-157778822 GCACTGCACAGGCTCCTAGGTGG + Intronic
1018845371 6:167551911-167551933 GAACAGAGCAGGCCCCTGGGTGG - Intergenic
1018899957 6:168046007-168046029 TCCAAGAGCAGGGTCCCAGGAGG + Intergenic
1019300640 7:301811-301833 TCGCAGAGCAGGCACGTAGGTGG + Intergenic
1019523574 7:1471033-1471055 GGCCAGACCAGGCTTCCAGGCGG - Intronic
1019539774 7:1546417-1546439 GGCCGTAGCAGGCTCCAAGGAGG + Exonic
1019624031 7:2006769-2006791 GCGCAGAGGAGGCTCCCAGATGG + Intronic
1022260027 7:28695297-28695319 GCCCAGACCAAGCTCTAAGGCGG + Intronic
1022310140 7:29189477-29189499 GCCCAGAGCAGGCTTACAGCTGG + Intronic
1022718972 7:32925557-32925579 TCCCAGAGAAGGCTCCCACGTGG - Intergenic
1022738474 7:33098589-33098611 TCCCAGAGAAGGCTCCCACGTGG - Intronic
1023050188 7:36244578-36244600 GCCCAGAGCCAGCTCTGAGGAGG + Intronic
1023113846 7:36841192-36841214 GCCCACAGCAGGCTCCGCTGAGG + Intergenic
1023232760 7:38051446-38051468 GCCAAACGCAGGCTCCTGGGAGG + Intergenic
1023826988 7:44016309-44016331 GCCCAGAGCAAGCCCCCAGAAGG + Intergenic
1024030472 7:45456024-45456046 GCCCACAGCAGGCACCAGGGAGG + Intergenic
1026297496 7:69067594-69067616 GCCCACTACTGGCTCCTAGGGGG + Intergenic
1027051447 7:75023941-75023963 GACCAGAGAAGGCTCCTGGTTGG + Intronic
1029738140 7:102476056-102476078 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029755273 7:102569710-102569732 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029773221 7:102668790-102668812 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1032321131 7:130887679-130887701 GCACAGTGCGGGCTTCTAGGAGG - Intergenic
1033397850 7:140992841-140992863 GCCCATATCAGACTCCTAGAAGG - Intergenic
1035759909 8:2061633-2061655 GCCCCATGCAGGCTCCTGGGAGG - Intronic
1037751333 8:21684298-21684320 GCACAGAGCAAGCTCTAAGGTGG + Intergenic
1037787799 8:21912783-21912805 GCCCAAAGCAGGCTGCAAGAAGG + Intronic
1037951262 8:23019830-23019852 GCCCAGAGAACTCTCCTGGGAGG + Intronic
1044871624 8:96625629-96625651 GCCCAGGGCAGGGACCTAGAGGG - Intergenic
1049046876 8:140159354-140159376 GCACAGAGCAGGCCCTCAGGAGG + Intronic
1049260888 8:141638569-141638591 GCCCTGAGCAGGCTCCTCGACGG - Intergenic
1051199222 9:14598114-14598136 GCCCAGAGCAAGCTGCCTGGAGG + Intergenic
1051566995 9:18511078-18511100 GCCAAGACCAGGCTCAAAGGAGG + Intronic
1051752107 9:20353343-20353365 CTCCAGAGCAGACTTCTAGGTGG + Intronic
1051809195 9:21031245-21031267 GTCAAGAGAAGGCTCCTGGGGGG + Intronic
1053267465 9:36725690-36725712 GCTCAGTGCAGGCTTCTGGGTGG + Intergenic
1054827957 9:69591616-69591638 GCCCAGAGGAGGCACCAAGCTGG + Intronic
1057694050 9:97311112-97311134 ACCCAGGGCAGACTCCTGGGTGG + Intronic
1059420092 9:114185412-114185434 CCCCAGAGCAGGCTGGTGGGAGG + Intronic
1060718705 9:125958965-125958987 GCCTAGAGCAGGCTCTTACATGG - Intronic
1061004083 9:127918497-127918519 GCTCAAAGGAGGCCCCTAGGGGG - Intergenic
1061087730 9:128409163-128409185 GCCCAGAGCAGAGGCCTGGGTGG + Intergenic
1061853655 9:133429774-133429796 GCCAAGAGCCGGCTCCTGGTGGG + Intronic
1062339472 9:136087563-136087585 ACCCAGAGAGGGCTCCCAGGCGG - Intronic
1062351565 9:136142205-136142227 GCCCAGGGCAGGCTCACAGTGGG + Intergenic
1185507013 X:639089-639111 GAGCAGAGGAGGCTCGTAGGAGG + Intronic
1187915579 X:24149913-24149935 GCGCCGAGCAGGCCCCGAGGAGG + Intronic
1190063266 X:47224114-47224136 GCTCAGAGCCGGCAGCTAGGTGG - Intronic
1199970676 X:152858462-152858484 GTTCAGAGCAGGCACCTAGGAGG - Intronic