ID: 1001976719

View in Genome Browser
Species Human (GRCh38)
Location 5:176006382-176006404
Sequence CTCCTGGTCAACCATGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001976710_1001976719 26 Left 1001976710 5:176006333-176006355 CCATCTCTCCTTTGTCAACATCT 0: 2
1: 0
2: 5
3: 47
4: 495
Right 1001976719 5:176006382-176006404 CTCCTGGTCAACCATGTGGCAGG 0: 2
1: 0
2: 0
3: 8
4: 110
1001976712_1001976719 -6 Left 1001976712 5:176006365-176006387 CCAACCTGATCCCCAAGCTCCTG 0: 2
1: 0
2: 0
3: 30
4: 346
Right 1001976719 5:176006382-176006404 CTCCTGGTCAACCATGTGGCAGG 0: 2
1: 0
2: 0
3: 8
4: 110
1001976714_1001976719 -10 Left 1001976714 5:176006369-176006391 CCTGATCCCCAAGCTCCTGGTCA 0: 2
1: 0
2: 0
3: 21
4: 291
Right 1001976719 5:176006382-176006404 CTCCTGGTCAACCATGTGGCAGG 0: 2
1: 0
2: 0
3: 8
4: 110
1001976711_1001976719 18 Left 1001976711 5:176006341-176006363 CCTTTGTCAACATCTGCTTCATC 0: 2
1: 0
2: 2
3: 31
4: 302
Right 1001976719 5:176006382-176006404 CTCCTGGTCAACCATGTGGCAGG 0: 2
1: 0
2: 0
3: 8
4: 110
1001976709_1001976719 27 Left 1001976709 5:176006332-176006354 CCCATCTCTCCTTTGTCAACATC 0: 2
1: 0
2: 2
3: 25
4: 305
Right 1001976719 5:176006382-176006404 CTCCTGGTCAACCATGTGGCAGG 0: 2
1: 0
2: 0
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001976719 Original CRISPR CTCCTGGTCAACCATGTGGC AGG Intronic
904036765 1:27563161-27563183 GTCTTGGTCAACTATGTGACAGG - Intronic
904036771 1:27563275-27563297 GTCTTGGTCAACTATGTGACAGG - Intronic
906111089 1:43322571-43322593 CTCCTGGACTTCCATGTGGTGGG - Intronic
907311476 1:53541396-53541418 CTCTTGGTCAATCATGTGGGTGG - Intronic
908080625 1:60574272-60574294 CTCCTGCTCACCCAGGTGGAGGG + Intergenic
909300316 1:74004875-74004897 ATCCTGTTCGACCATGTGGATGG + Intergenic
916687131 1:167157625-167157647 CTGCTGGTCAACCCTGGTGCTGG + Intergenic
916738428 1:167628526-167628548 CACCTGAGCAGCCATGTGGCTGG + Intergenic
918578810 1:186100039-186100061 GGCCTGGTCTAGCATGTGGCAGG + Intronic
920698047 1:208196691-208196713 CTCCTGTTCACCCTTGTAGCGGG + Intronic
923250856 1:232178553-232178575 CTCCTGTTCATCCACATGGCTGG + Intergenic
1063159424 10:3408645-3408667 CTCCTCTTCCTCCATGTGGCTGG - Intergenic
1063401388 10:5749295-5749317 CTCCTGGACAAGCACTTGGCAGG + Exonic
1070530301 10:77331113-77331135 CTGCTGTTCAGGCATGTGGCTGG - Intronic
1070826682 10:79394317-79394339 CTCCTGGGCCAACATGGGGCAGG - Exonic
1074473223 10:113745985-113746007 CAACTGGACAACCATGTGGATGG + Intergenic
1076076577 10:127538160-127538182 CTCTTCGTCCACCCTGTGGCTGG + Intergenic
1076247802 10:128961313-128961335 CTCCTGGTCACCCATGACTCCGG - Intergenic
1077234113 11:1471667-1471689 CACCTGTACAGCCATGTGGCTGG - Intronic
1077526285 11:3067707-3067729 GTCCTGGCCCACCCTGTGGCAGG + Intergenic
1077882857 11:6364544-6364566 ACCCTGGTCAGCCATGTGGTTGG + Intergenic
1079193386 11:18301694-18301716 CTCCTGCTCAACGATGTGCCAGG + Intronic
1081719499 11:45277550-45277572 ATCCTGGTGAACAATGAGGCTGG - Intronic
1084760930 11:71270370-71270392 CACCGGGAGAACCATGTGGCTGG + Intergenic
1089595990 11:119580549-119580571 CTCCAGTTCTCCCATGTGGCTGG + Intergenic
1091003612 11:131932096-131932118 CTCCATGCCAACCATGTGCCAGG + Intronic
1093872696 12:24311116-24311138 CTCCTGGCCCCCCATGGGGCAGG - Intergenic
1095652492 12:44628750-44628772 CTCATTGTCTACCATCTGGCGGG - Intronic
1097827237 12:64186736-64186758 CTCCTGGCCACCCGGGTGGCTGG + Intronic
1102139415 12:110602341-110602363 CTCCGGGTCAACCCTGTGAGAGG + Intergenic
1102536872 12:113588311-113588333 GTCCTGGTCAAACATGTTCCAGG + Intergenic
1104311709 12:127659029-127659051 CTCCAGGTCACCCAGCTGGCAGG + Intergenic
1106347480 13:28893035-28893057 CTCCTCTCCAACCATGTGGAAGG - Intronic
1107409307 13:40143699-40143721 ATCCTGCTCTACCATGTGCCAGG - Intergenic
1110664410 13:78099920-78099942 CACATTGTAAACCATGTGGCTGG + Intergenic
1113784779 13:112996732-112996754 CTCCTGGTGAGCCCTGTGGGTGG + Intronic
1114498795 14:23153060-23153082 CTTCTGATCACCCATGAGGCTGG - Intronic
1116184400 14:41578194-41578216 CTCAAGGTCAACTAAGTGGCAGG - Intergenic
1122999884 14:105287626-105287648 CTCCAGGGAAACCATGAGGCAGG + Intronic
1124177643 15:27441334-27441356 ATCCTTGTAAACCACGTGGCAGG + Intronic
1128155818 15:65391278-65391300 CCTCTGCTAAACCATGTGGCTGG + Intronic
1132181179 15:99754012-99754034 CTGCTGGTAAACCGTGGGGCAGG + Intergenic
1138436523 16:57003686-57003708 CTCCAGTTCTCCCATGTGGCAGG + Intronic
1142251281 16:88993178-88993200 CTCCTGCTCCACCAAGTGGGAGG + Intergenic
1142630014 17:1219357-1219379 CTCCTTGTCACCCATGAGCCAGG - Intronic
1146659175 17:34653165-34653187 CTTCTGGTGAACCATGGGGCAGG - Intergenic
1148331283 17:46815345-46815367 CTTCTGGTCAACCTTCTGTCAGG + Intronic
1148375830 17:47145604-47145626 GTAAAGGTCAACCATGTGGCCGG + Intronic
1152134935 17:78498265-78498287 CTCCTGGTCTATCCTGTGGTGGG + Intronic
1153908283 18:9683535-9683557 CTCCAGGGCCACCATGTGGCCGG + Intergenic
1156460957 18:37321060-37321082 GCCCTGGTTAACCCTGTGGCTGG + Intronic
1157440588 18:47708626-47708648 CTCCTATTAATCCATGTGGCAGG - Intergenic
1163675990 19:18655563-18655585 CTCCTGGCCCACCTTGTGGCAGG - Intronic
1166852131 19:45766081-45766103 CTCCTGGCCAACCCTGTGTCTGG - Exonic
1168082308 19:54019119-54019141 CTCCTGGTCACCCATGACCCGGG - Intergenic
1168657724 19:58143113-58143135 CTCCTGGGCTACCAAGTAGCTGG - Exonic
928427888 2:31193535-31193557 CCCCCGGTCAGCCATGTGGCCGG - Intronic
935941952 2:108248272-108248294 CTCCTGGTCAGCCATGCCGAAGG + Intronic
937635865 2:124154559-124154581 CTCTTTGTCCATCATGTGGCAGG - Intronic
940506727 2:154564964-154564986 CTCCTGGTCAGCAAAGTGTCTGG + Intergenic
942510831 2:176698161-176698183 AACCTGGTCACCCAGGTGGCAGG + Intergenic
946147245 2:217740377-217740399 ATCATAATCAACCATGTGGCTGG - Intronic
1170673594 20:18457815-18457837 CTTCTAGGCAACCATGTGCCTGG + Intronic
1170961753 20:21031468-21031490 CACCTGGTGGACCATGGGGCTGG - Intergenic
1171117258 20:22535681-22535703 CTTCTGGTAAACCATGTGTGGGG + Intergenic
1180054752 21:45351958-45351980 CCCCGGGTCATCCATGTGGGAGG - Intergenic
1184152307 22:42646244-42646266 CTCCTGGGCCCCCAGGTGGCTGG - Intronic
1184911800 22:47540230-47540252 CTCCTGCTGCACCCTGTGGCTGG - Intergenic
1185086250 22:48742539-48742561 TGCCTGGTCCACCATGCGGCCGG - Intronic
949879927 3:8653150-8653172 AACCTGGTCATCCATCTGGCTGG + Intronic
950101309 3:10358619-10358641 CTCCAGGTCACCCTGGTGGCTGG + Intronic
951810232 3:26690367-26690389 CTCTTGGTGAACCAAATGGCAGG - Intronic
953480463 3:43247183-43247205 CTCATGGTAAACAATGAGGCCGG + Intergenic
953980157 3:47409612-47409634 CTCCAGGTGAACCATGGGGCTGG - Intronic
954847810 3:53575074-53575096 CCCCAGGCCAACCATGTGCCAGG - Intronic
959476898 3:106822352-106822374 CTCCTGTGCAAGCCTGTGGCTGG - Intergenic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
961317728 3:126051979-126052001 CGCCTGGTCAAGCCTGTTGCTGG - Intronic
967197324 3:187039798-187039820 CTCCAAGTCCACCAGGTGGCTGG - Intronic
971716305 4:30181495-30181517 TTCCTTGTCAAGCATGTTGCAGG + Intergenic
976510327 4:85901444-85901466 CTACTGGTCTACTATGTGGTAGG - Intronic
988629414 5:32913025-32913047 TTCCTTGTCAACCATGTGTATGG + Intergenic
991621922 5:68553779-68553801 CTCCAAGTCAACCATGAGGGTGG + Intergenic
997371347 5:133363214-133363236 CTCATGGTTAAGCATGTGGTGGG + Intronic
1000419730 5:161025043-161025065 CTTCTGATCTACCAAGTGGCAGG - Intergenic
1001954071 5:175836429-175836451 CTCCTGGTCACTCAGGTGACTGG + Intronic
1001976719 5:176006382-176006404 CTCCTGGTCAACCATGTGGCAGG + Intronic
1002240706 5:177837399-177837421 CTCCTGGTCAACCATGTGGCAGG - Intergenic
1008495078 6:52124999-52125021 CTCATGGCCAACCTTGTAGCTGG + Intergenic
1011561569 6:88622806-88622828 ATACTGATCAACCATGTGCCCGG + Intronic
1015370823 6:132450243-132450265 TACCTAGTCAACCATATGGCAGG + Exonic
1017569908 6:155732727-155732749 ATCCTTGTCACCCATGTGACAGG + Intergenic
1018378982 6:163240555-163240577 CTCCTCCTCAACCACCTGGCTGG + Intronic
1019924466 7:4182959-4182981 CTCCAGTTCCCCCATGTGGCTGG - Intronic
1022885931 7:34643694-34643716 CTTCTGATTAACCATTTGGCAGG - Intergenic
1023820134 7:43976001-43976023 CTCCTGGCCACCCATGGTGCAGG - Intergenic
1026762661 7:73138094-73138116 CTCATGGTGTCCCATGTGGCAGG + Intergenic
1029392095 7:100282306-100282328 CTCATGGTGTCCCATGTGGCAGG - Intergenic
1029748413 7:102529454-102529476 CTCCTGGCCACCCATGGTGCAGG - Intergenic
1029766360 7:102628541-102628563 CTCCTGGCCACCCATGGTGCAGG - Intronic
1032840871 7:135712558-135712580 ATCCTGGCCATCAATGTGGCAGG - Intronic
1034696156 7:153055750-153055772 CTGCTGGTCAAACCTGTGCCTGG + Intergenic
1034993939 7:155566321-155566343 CTCTTTGTCAACCCTGGGGCCGG - Intergenic
1035834361 8:2732742-2732764 CTCATGCTCAGCCTTGTGGCGGG - Intergenic
1038242196 8:25820100-25820122 CTCCTGTTCTACCCTGTGGTAGG + Intergenic
1038257829 8:25966881-25966903 TCTCTGGCCAACCATGTGGCAGG - Intronic
1039331467 8:36542499-36542521 CTCCTCTTCCACCATGTTGCTGG - Intergenic
1039920587 8:41891578-41891600 CTCCTGGTCTAGCCTATGGCTGG + Intronic
1040913183 8:52541942-52541964 GCCCTGGTCAAATATGTGGCTGG - Intronic
1041683238 8:60614911-60614933 CTCCTGCTTCCCCATGTGGCCGG - Intronic
1042792733 8:72626295-72626317 CTCCTGGTCCCCCAAGTGACTGG - Intronic
1045654185 8:104369802-104369824 CTTCTGGTCAACCAGGTGAGTGG + Intronic
1047766270 8:127992552-127992574 CTTCTGGTCCATGATGTGGCTGG - Intergenic
1049795070 8:144493474-144493496 TTCCTGGTCCATCTTGTGGCTGG + Intronic
1055147309 9:72951822-72951844 CTGCTGGTCAACCATGTTAAAGG + Intronic
1062031303 9:134363270-134363292 CTCCCAGTCCAGCATGTGGCAGG + Intronic
1062133723 9:134913791-134913813 CCTATGGACAACCATGTGGCTGG - Intronic
1062745501 9:138209209-138209231 CAGCTGCTCAACCATGTGGGGGG - Intergenic
1193743128 X:85243012-85243034 CTCCTGGTCTACTATGAGCCAGG + Intergenic
1200135318 X:153871883-153871905 TTCCTGCTCAGCCATGAGGCAGG + Intronic