ID: 1001987868

View in Genome Browser
Species Human (GRCh38)
Location 5:176091018-176091040
Sequence ATGTGTATGTGGAAGTATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 3, 1: 0, 2: 4, 3: 59, 4: 560}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001987865_1001987868 2 Left 1001987865 5:176090993-176091015 CCATGTCAGAGAGTCCTTAGCAT 0: 3
1: 2
2: 0
3: 4
4: 97
Right 1001987868 5:176091018-176091040 ATGTGTATGTGGAAGTATGTTGG 0: 3
1: 0
2: 4
3: 59
4: 560
1001987863_1001987868 20 Left 1001987863 5:176090975-176090997 CCCTGGTGTAACTTGTCACCATG 0: 5
1: 0
2: 0
3: 5
4: 125
Right 1001987868 5:176091018-176091040 ATGTGTATGTGGAAGTATGTTGG 0: 3
1: 0
2: 4
3: 59
4: 560
1001987864_1001987868 19 Left 1001987864 5:176090976-176090998 CCTGGTGTAACTTGTCACCATGT 0: 5
1: 0
2: 1
3: 7
4: 105
Right 1001987868 5:176091018-176091040 ATGTGTATGTGGAAGTATGTTGG 0: 3
1: 0
2: 4
3: 59
4: 560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001987868 Original CRISPR ATGTGTATGTGGAAGTATGT TGG Intronic
900978211 1:6030692-6030714 ATGTGTGTGTGTATGTGTGTAGG + Intronic
901474178 1:9478113-9478135 GTGTATATGTGTATGTATGTTGG - Intergenic
901863525 1:12089517-12089539 TTGTATAGGAGGAAGTATGTGGG + Intronic
902175852 1:14650149-14650171 GTGGGTATGTGGAAGGAAGTAGG + Intronic
903265146 1:22153729-22153751 ATGTGTGTGTGAATGTGTGTTGG + Intergenic
903345034 1:22678454-22678476 ATGTGTGTGTGTATGTGTGTGGG - Intergenic
904043205 1:27595898-27595920 GTGTGTGTGTGGAAGTGTGTGGG + Intronic
905354424 1:37371555-37371577 ATGTGTGTGTGTGTGTATGTAGG - Intergenic
905786181 1:40759614-40759636 ATATGTGTGTGTATGTATGTAGG + Intronic
905893208 1:41529779-41529801 ATGTGTATGTATGAGTGTGTGGG - Intronic
906925354 1:50110035-50110057 GTGTGTATGTGTAAGGATGCTGG + Intronic
906986739 1:50691022-50691044 ATGTGTATGTGAATGTTTATAGG - Intronic
908940318 1:69424443-69424465 ATGTGTATCAAGTAGTATGTAGG + Intergenic
909106474 1:71415902-71415924 GTGTGTATGTGGATGTGTGTGGG + Intronic
909256983 1:73437023-73437045 CTATGCATGTGGGAGTATGTGGG + Intergenic
909902548 1:81156307-81156329 ATGTGTAAGTGAAATTTTGTTGG + Intergenic
910197242 1:84655064-84655086 ATGTGAATGAGGAAGGGTGTAGG + Intronic
910947213 1:92607121-92607143 ATGTGTATGTACCAGTGTGTTGG - Intronic
911563550 1:99435350-99435372 ATGTGTATTTTGAAGTAGTTAGG - Intergenic
911618102 1:100037302-100037324 ATGTGTATGTATATGTAGGTGGG - Intergenic
911641346 1:100292801-100292823 ATCTAAATGTGGAAGCATGTTGG - Intergenic
912154306 1:106898512-106898534 ATGTGTATGGGGAGGGGTGTTGG - Intergenic
912304425 1:108552337-108552359 ATGTGTATGTGGAAATGCTTGGG - Intergenic
912942100 1:114054128-114054150 GTGTGTATGTACATGTATGTAGG + Intergenic
913538464 1:119796519-119796541 ATGTGTGTGTGGCTGTATATTGG + Intronic
913690127 1:121271736-121271758 ATGTGTGTGTGCATGTGTGTTGG + Intronic
914147413 1:145008227-145008249 ATGTGTGTGTGCATGTGTGTTGG - Intronic
914972200 1:152317430-152317452 ATGTGGATTTGGAAATATGAAGG - Intronic
915047011 1:153026270-153026292 GTGTGTATGTGTATGCATGTGGG + Intergenic
915679487 1:157566798-157566820 ATGTTTATGCAAAAGTATGTTGG - Intergenic
915943521 1:160134122-160134144 ATGTGTGTGTGTGTGTATGTGGG - Intronic
916419178 1:164620460-164620482 ATGTGCATTTGTGAGTATGTGGG + Intronic
917757168 1:178113474-178113496 TTGTGTATGTGTATGTGTGTGGG + Intronic
917772426 1:178294293-178294315 GTTTGTGTATGGAAGTATGTGGG - Intronic
919583639 1:199408672-199408694 GTGTGTATGTGGGGGTGTGTTGG - Intergenic
919930092 1:202215474-202215496 TTCTGTGTGTGGAGGTATGTGGG - Intronic
920477449 1:206290217-206290239 ATGTGTGTGTGCATGTGTGTTGG + Intronic
921847246 1:219897243-219897265 GTGTATATGTGTATGTATGTTGG - Intronic
921973127 1:221172867-221172889 GTGTGTATCTGGGTGTATGTAGG + Intergenic
921984828 1:221301256-221301278 ATTTGTATATTGAAGTATTTAGG - Intergenic
922779283 1:228238927-228238949 ATGTGTATATAGGTGTATGTGGG - Intronic
923186086 1:231574872-231574894 ATGTGTATGATGAAGTAAGAGGG - Intronic
923540291 1:234883935-234883957 ATGTGTATGTGTGTGTGTGTTGG - Intergenic
924395172 1:243611204-243611226 ATGTATGTGTGGAACTATGATGG - Intronic
924607677 1:245549127-245549149 GTGTGTGTGTGTAAGTGTGTAGG + Intronic
1062993417 10:1842324-1842346 ACATGTATGTGCATGTATGTGGG - Intergenic
1063144873 10:3287969-3287991 ATGTGTGTGTGCACGTGTGTGGG + Intergenic
1063482380 10:6386910-6386932 CTGTGTATGTGCCTGTATGTGGG - Intergenic
1064120693 10:12615926-12615948 ATGTGTGTTTGCAAGTGTGTTGG + Intronic
1065288562 10:24208391-24208413 GTGTGTGTGTGTAAGTGTGTTGG + Intronic
1065385608 10:25130397-25130419 ATTTGTATGAGGAAGTTTGTGGG - Intergenic
1066120298 10:32279898-32279920 ATGTGTATATGGAATTTTGGGGG - Intronic
1067536784 10:47116571-47116593 ATGTGTGTGTGGATGTTTATGGG + Intergenic
1068303228 10:55173347-55173369 ATGTGTATGTAGAAGGATGGGGG + Intronic
1068395316 10:56453955-56453977 ATGTGTGTGTGTATGTGTGTGGG - Intergenic
1069808291 10:71139792-71139814 ATATGTATGCTGAAGTATTTAGG + Intergenic
1069890684 10:71650450-71650472 ATGTGTATGGGGGTGTGTGTAGG + Intronic
1070017448 10:72547771-72547793 ATTTATTTGTGGAAGAATGTAGG - Intronic
1070097627 10:73353340-73353362 ATGTGTTAGTGGAAGTGTGCAGG - Intronic
1070104752 10:73420962-73420984 ATGTGTATGTGTATGTATTGGGG - Intergenic
1070981232 10:80649857-80649879 ATGTGTGTGTGTATGAATGTAGG + Intergenic
1071058177 10:81535366-81535388 ATGTGTGTGTGTATGTGTGTGGG + Intergenic
1071127486 10:82352184-82352206 GTGTGTTTGTGCATGTATGTGGG - Intronic
1072062827 10:91832998-91833020 ATGTGCATGTGGAAGTATTTAGG - Intronic
1073091037 10:100939908-100939930 ATCTGTATCTGAAAATATGTTGG + Intronic
1073493554 10:103871611-103871633 TTGTGTATGTGTATGTTTGTAGG - Intergenic
1074236733 10:111592255-111592277 GTGTGTGTGTGCATGTATGTAGG + Intergenic
1074833756 10:117269194-117269216 GTGTGTATGTGTATGTGTGTAGG - Intronic
1075913115 10:126142857-126142879 GTGTGTATGTGTGTGTATGTGGG + Intronic
1076647903 10:131966037-131966059 ATGTGCATGTAGAAGTTTCTAGG + Intergenic
1077738026 11:4812198-4812220 ATATCTATGTAGAAATATGTTGG + Intronic
1079567956 11:21906041-21906063 ATGTGTATGTGTATTTATGTGGG - Intergenic
1079658566 11:23012736-23012758 AAATGTATGTGGAAGTGTGCAGG - Intergenic
1079920201 11:26424252-26424274 ATGTGTATGTGTGTGTGTGTGGG - Intronic
1080161644 11:29183795-29183817 ATATATAAGTGGAAGGATGTTGG + Intergenic
1080214483 11:29825723-29825745 CTGTCTATGTGGAAGTGAGTTGG + Intergenic
1080981617 11:37414126-37414148 GTGTGTGTGTGTAAGTATGTTGG + Intergenic
1081480692 11:43485817-43485839 ATGTGAATGGGGTTGTATGTTGG + Intronic
1082018098 11:47507599-47507621 AGTTGTATTTGGAAGTTTGTAGG - Intronic
1083510861 11:63208562-63208584 GTGTGTATGTGTGAGAATGTGGG + Intronic
1083830230 11:65226899-65226921 GTGTGTGTGTGTAAGTATGTGGG - Intergenic
1084494982 11:69498341-69498363 ATGTGTAGGTGGAAGGGTGCAGG + Intergenic
1084676232 11:70637103-70637125 GTGTGTATGTGCACGTGTGTGGG + Intronic
1084908690 11:72369763-72369785 CTGTGTGTGTGTATGTATGTGGG + Intronic
1084955672 11:72690051-72690073 CTGGGTATGAGGAAGGATGTGGG + Intronic
1085137368 11:74104500-74104522 ATGTGTATGTACATGTATGGGGG + Intronic
1085733176 11:79016739-79016761 ATGTGTGTGAGGAAGTCTTTGGG + Intronic
1085835885 11:79956067-79956089 ATCTGTAGGTGGAGGTATGTGGG - Intergenic
1085900636 11:80695913-80695935 AGGTGAATCTGGAATTATGTTGG - Intergenic
1086316437 11:85599289-85599311 ATGCGTGTGTGTATGTATGTGGG - Intronic
1087284277 11:96247859-96247881 ATGTGTTGGTGGAAGGTTGTTGG - Intronic
1087401350 11:97670348-97670370 CTGTGTGTGTGCATGTATGTAGG - Intergenic
1087770571 11:102205297-102205319 ATGTGTATGTGGATATATTAAGG + Intronic
1088578421 11:111295059-111295081 TTGTGCATGTGGAAATATTTTGG - Intergenic
1088846261 11:113670793-113670815 ATGTCTATGTGTAAGTGTGCAGG - Intergenic
1089031578 11:115335415-115335437 TTGTTTATGTTGAAGTATATGGG + Intronic
1089110157 11:116049192-116049214 ATGTGTAAGTGTATGTTTGTAGG - Intergenic
1089750048 11:120645143-120645165 GTGTGTATGTGTATGTATGGTGG + Intronic
1089789599 11:120933113-120933135 CTGTCTATGTGGACCTATGTGGG - Intronic
1090270359 11:125381522-125381544 ATGGCTATGTGTATGTATGTGGG - Intronic
1090366406 11:126210510-126210532 GTGTGTGTGTGTATGTATGTTGG - Intronic
1090537194 11:127656168-127656190 GTGTGTAGGTGGAAGTTTGTGGG + Intergenic
1091150772 11:133326514-133326536 GTGGGTATGTGTAAGTGTGTGGG + Intronic
1091150939 11:133327193-133327215 GTGTGTATGAGGGGGTATGTGGG + Intronic
1091196830 11:133738721-133738743 GTGTGTATGTGGGTGTGTGTGGG + Intergenic
1091196834 11:133738745-133738767 GTGTGTATGTGGGTGCATGTGGG + Intergenic
1091196891 11:133739001-133739023 GTGTGTATGTGGGTGTGTGTGGG + Intergenic
1091472415 12:740640-740662 ATCTGATTGTGGAAATATGTAGG + Intergenic
1092804989 12:12213161-12213183 AAATGTGTGTGGAAGTATATGGG + Intronic
1092836900 12:12498865-12498887 ATGGGTTTGTGGAAGTTTATAGG - Intronic
1093259777 12:16921281-16921303 ATGTGTGTGTGTGTGTATGTTGG + Intergenic
1093703089 12:22244948-22244970 ATATCTATGTGGAAATATTTGGG + Intronic
1093703727 12:22251810-22251832 ATTGGGATGTGGAAGTAAGTGGG + Intronic
1093897391 12:24589761-24589783 ATGTGTATGTGTATATATGCAGG - Intergenic
1094410804 12:30167170-30167192 GTGTGTGTGTGTATGTATGTAGG - Intergenic
1094536465 12:31325907-31325929 GTGTGTATGTGGAAGGACGGGGG + Intronic
1095527887 12:43149920-43149942 ATATGTTTGTGGAAGGAGGTAGG + Intergenic
1096056379 12:48655901-48655923 ATGTATGTGTGTAAGTAGGTGGG - Intronic
1097506577 12:60480512-60480534 AAGTATATGTGGAGGCATGTTGG + Intergenic
1097971478 12:65637939-65637961 AAGTGTTTGTGGAAGGATGAAGG + Intergenic
1098041362 12:66356712-66356734 AGGTGTATACTGAAGTATGTAGG - Intronic
1098656510 12:73037607-73037629 ATGTGTGTGTGGGTTTATGTGGG - Intergenic
1098859931 12:75697266-75697288 ATGTGTATGTGTGTGTGTGTAGG - Intergenic
1098927756 12:76370783-76370805 ATATGTATGTGCAAACATGTAGG + Intronic
1099019620 12:77387337-77387359 CTGAGTATGTGGAAGTATTCTGG + Intergenic
1099364165 12:81746814-81746836 ATGGGTATGGGTAAGTGTGTGGG + Intronic
1099387302 12:82030319-82030341 AAGTGTATATGGAAGTATTTTGG + Intergenic
1100003160 12:89861617-89861639 ATGAGTATGTGCAACTGTGTAGG + Intergenic
1100510993 12:95273366-95273388 ATGTGTATCTGGAGATACGTAGG - Intronic
1101170762 12:102089946-102089968 GTGTGTATGTGATCGTATGTGGG - Intronic
1101357832 12:103997294-103997316 TTGTAAATGTGGAAGTATTTTGG - Intronic
1101384377 12:104243328-104243350 ATGTGTTTCTGAAAGTCTGTAGG - Intronic
1101806315 12:108067323-108067345 ATGTGTTTGTGGTTGTATGCAGG + Intergenic
1102321846 12:111942762-111942784 ATGTGTATGTGTGTGTGTGTGGG + Intronic
1102866078 12:116375421-116375443 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1103149212 12:118622523-118622545 ATTTGCATATGGAAATATGTAGG - Intergenic
1103490980 12:121319871-121319893 ATGAGTATATGAAAGTATTTTGG + Intronic
1104242768 12:127006902-127006924 ATGTGTGTGTAGATGTTTGTAGG - Intergenic
1104371224 12:128225483-128225505 ATTTGGATGTGGATGTATTTGGG - Intergenic
1104636300 12:130439835-130439857 ATGTGTATCTGTGAGTCTGTGGG + Intronic
1105209341 13:18248618-18248640 TTGTGTATGTGTGAGTGTGTGGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1105759313 13:23498845-23498867 ATGTATATGTGCGCGTATGTGGG + Intergenic
1106941213 13:34781674-34781696 AACTTTATGTGAAAGTATGTTGG - Intergenic
1107022067 13:35762264-35762286 GTGTGTATGTGTAGGTGTGTAGG - Intergenic
1107354697 13:39554554-39554576 ATGTGACTGTAGAAGTATGCAGG - Intronic
1107733634 13:43373573-43373595 GTGTGTATGTGTATGTGTGTGGG - Intronic
1107800509 13:44103842-44103864 ATGTGTGTGAGGGGGTATGTGGG - Intergenic
1108163049 13:47662796-47662818 ATGTGTGTATGTATGTATGTAGG - Intergenic
1108187768 13:47905551-47905573 GTGTGTGTGTGTATGTATGTAGG - Intergenic
1108563848 13:51674715-51674737 GTGTGTATGTGTCTGTATGTGGG + Intronic
1108779061 13:53805606-53805628 ATCTGTATTTGGAAATATTTTGG - Intergenic
1108835085 13:54534889-54534911 ATGTGTATGTGAAGGTGTGTTGG - Intergenic
1109266709 13:60208774-60208796 ATGTGTGTGTGGGTGTGTGTGGG - Intergenic
1109654129 13:65367258-65367280 ATGTGTGTGTGTGTGTATGTGGG + Intergenic
1109774458 13:67021902-67021924 ATGTGTATATATATGTATGTAGG + Intronic
1110333850 13:74303339-74303361 ATGTGGATGTGAAAGCATATGGG - Intergenic
1110820850 13:79914396-79914418 ATGTGTATGTGGGTGTGTCTTGG + Intergenic
1110921538 13:81093525-81093547 GTGTGTGTGTGTATGTATGTTGG + Intergenic
1111402888 13:87764127-87764149 ATGAGTTTGTGGATGTTTGTTGG + Intergenic
1111408708 13:87845547-87845569 ATAGGTATGTGGTAGGATGTAGG - Intergenic
1112477481 13:99745009-99745031 AGGTGGCTGGGGAAGTATGTTGG - Intronic
1113612118 13:111654481-111654503 GTCTGTGTGTGGAAGAATGTAGG - Intronic
1113870585 13:113557375-113557397 AGGTGTGTGTGCATGTATGTAGG + Intergenic
1115447445 14:33507898-33507920 ATGTGGATGTGGGTATATGTGGG + Intronic
1116411425 14:44627881-44627903 ATGTGTGTATGGAACAATGTAGG - Intergenic
1116530116 14:45960938-45960960 ATGTGTATGTGCATATGTGTGGG + Intergenic
1116825508 14:49669730-49669752 ATTTGTATGTTAAATTATGTGGG - Intronic
1118080458 14:62352607-62352629 ATGTGTATGTGCATATGTGTGGG - Intergenic
1118230738 14:63946427-63946449 ATGTGTATGTGTATGTTTTTTGG - Intronic
1118264307 14:64279824-64279846 ATGTGTGTTTGGAAGTGGGTTGG - Intronic
1118337734 14:64868299-64868321 AAGTAGATGTGGAAGTATGGGGG + Intronic
1118562159 14:67097556-67097578 GTGTGTGTGTGCAGGTATGTAGG - Intronic
1119106508 14:71930417-71930439 ATATGTATGTGTATGTATGTGGG - Intergenic
1119717085 14:76867036-76867058 GTGTGCATGTGGTAGTGTGTGGG + Intronic
1119884048 14:78125364-78125386 ATGTGTGTGTGTAGGTAGGTAGG + Intergenic
1120255691 14:82116430-82116452 ATGTGTATATGTGTGTATGTGGG - Intergenic
1120679437 14:87462695-87462717 ATGTTTATGTTGAATTATTTTGG - Intergenic
1121148967 14:91613148-91613170 AGATGTATATTGAAGTATGTGGG + Intronic
1121298419 14:92849457-92849479 TTGTGAATGTGTATGTATGTAGG + Intergenic
1121604338 14:95229581-95229603 ATGTGTGTGTGGCACTATGCAGG + Intronic
1122764551 14:104057128-104057150 ATATGTATGCTGAAGTATTTAGG - Intergenic
1124072994 15:26413146-26413168 ATTTGTTTGTGGAAGGATTTGGG - Intergenic
1124250890 15:28106055-28106077 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1124368319 15:29089436-29089458 AGGTGTATGTGGGAGTGTGGGGG - Intronic
1124690917 15:31822212-31822234 ATGTGTATGAGGAACTCAGTAGG + Intronic
1124725263 15:32150929-32150951 ATGTGTTTTTGGAAGTAAGGGGG + Intronic
1124785873 15:32680031-32680053 ATGTGTATTTGTAAGTAGATGGG + Intronic
1125110804 15:36031037-36031059 ATGTGTATATGTATGTGTGTAGG + Intergenic
1125114397 15:36072362-36072384 ATGTATATGTGCATGTGTGTAGG - Intergenic
1125142813 15:36429638-36429660 ATGTTTATGTGTCTGTATGTTGG - Intergenic
1125196239 15:37050174-37050196 ATCTGTTTGTGGAAGTATTCTGG - Intronic
1125806901 15:42501238-42501260 ATGTGTGTGTGTATGTATGGAGG - Intronic
1126276272 15:46885443-46885465 ATGTGTATGTGTGTGTATATGGG + Intergenic
1126311878 15:47326736-47326758 ATGTGTATGTTGAAGTAAGTGGG + Intronic
1127601573 15:60542964-60542986 AGGTGTATGTGTAAGCATGTGGG - Intronic
1127665848 15:61146443-61146465 GTGTGTATGTGTATGTGTGTTGG - Intronic
1127745928 15:61972482-61972504 GTGTGTATGTGCATGTGTGTTGG + Intronic
1127977861 15:64011526-64011548 AAGTGTTTGTGGAAGTGTTTAGG + Intronic
1128049418 15:64650507-64650529 ATTTGTATGTGGAAGTCTTGGGG + Intronic
1128913328 15:71536801-71536823 GTGTGTATGTGGGAGGAAGTAGG + Intronic
1129435469 15:75536622-75536644 ATGTGTATGAGGGAGAATGGTGG + Intronic
1130850097 15:87784503-87784525 ATGTGTGTGTGTTTGTATGTTGG - Intergenic
1130851841 15:87802544-87802566 ATGTGTATGGGTGTGTATGTGGG + Intergenic
1131334651 15:91536423-91536445 AGCTGTATGTGCAAGGATGTGGG + Intergenic
1131641779 15:94300935-94300957 ATGTGTGTCTGGAAGGGTGTGGG + Intronic
1132395606 15:101471588-101471610 ATGTGTATGTTGAAGTCTTTAGG - Intronic
1134598880 16:15517853-15517875 GTGTGTGTGTGGATGTGTGTGGG + Intronic
1135387554 16:22056788-22056810 ATGTGTCTTGGGGAGTATGTTGG - Intronic
1135897971 16:26427187-26427209 ATGTGTATGTGCATATATATGGG + Intergenic
1137273086 16:46915841-46915863 ATGTGTCTGTGTATGTGTGTAGG - Intronic
1137366956 16:47868712-47868734 ATGTGTATGTGTAAGTAGGTAGG - Intergenic
1138027432 16:53533123-53533145 ATGTGAATGTGAACTTATGTGGG + Intergenic
1138163899 16:54781707-54781729 ATGTGGATGTGGGAGTAGGAAGG - Intergenic
1138586563 16:57974163-57974185 AGGTGTATGTGGAAGCTTCTAGG + Intergenic
1138752248 16:59437942-59437964 ATATGTGTGTTGAAGTATATAGG + Intergenic
1138754816 16:59470554-59470576 TTGTGCATGAGAAAGTATGTTGG - Intergenic
1139091754 16:63657168-63657190 ATATGTATGTGGAGGTGTTTGGG + Intergenic
1140036666 16:71376508-71376530 GGTTGTATGTGGATGTATGTGGG - Intronic
1140046700 16:71444286-71444308 CTGTGTATGTGGAGGTCTATGGG + Intergenic
1140722940 16:77787863-77787885 CTGTGTATGTGCATGCATGTTGG + Intergenic
1140927041 16:79593201-79593223 ATGTGAATACGGAAGTAAGTTGG + Intronic
1141257145 16:82412824-82412846 ATGTGTATGTGTATGTACATAGG - Intergenic
1141928858 16:87187020-87187042 ATGTGTGTGTGCATGTGTGTGGG + Intronic
1141982479 16:87559099-87559121 ATTTGCATGTGGAAGTATTTAGG - Intergenic
1143508431 17:7382338-7382360 GTGTGTGTGTGGCAGCATGTGGG + Intronic
1144380085 17:14686422-14686444 ATGTGTTTGTGAAAATATATGGG + Intergenic
1144507713 17:15846860-15846882 ATGTGTAGGTGTATGTGTGTAGG - Intergenic
1144835044 17:18152221-18152243 AAGTATATGAGGAAGTCTGTGGG + Intronic
1145171837 17:20664477-20664499 ATGTGTAGGTGTATGTGTGTAGG - Intergenic
1145977974 17:28995328-28995350 CTGTGTGTGTGCATGTATGTGGG + Intronic
1146007720 17:29171527-29171549 ATATGTATGTTAAAGTATTTGGG + Intronic
1146584676 17:34071908-34071930 ATGTCTAAGTGGAAGGATGAAGG + Intronic
1146733021 17:35212150-35212172 CTGTGTATGAGCAAGTGTGTTGG + Intergenic
1147055848 17:37834308-37834330 GTGTGGATGTGGATGTGTGTGGG - Intergenic
1147418172 17:40308605-40308627 ATGTGTATCTGGGAATGTGTGGG - Intergenic
1147601534 17:41749093-41749115 ATATGTTTGTGTATGTATGTTGG - Intergenic
1147717487 17:42518219-42518241 ATGTGTATGTGGAATTCGCTAGG - Intronic
1147766850 17:42842692-42842714 TTGTGTATGTGGAAATGTGCTGG + Exonic
1151206443 17:72511583-72511605 GTGTGTAAGTGTACGTATGTGGG + Intergenic
1151636954 17:75356189-75356211 ATATGTATATTGAAGTATTTAGG - Intronic
1152158841 17:78654355-78654377 GTGTGTATGTGTATGTATGTGGG - Intergenic
1152575453 17:81138517-81138539 ACGTGTATGTGCACGTGTGTGGG - Intronic
1152582010 17:81170010-81170032 ATGTGTATGTGCATATGTGTAGG + Intergenic
1153629453 18:7055482-7055504 ATGTGTATGTGTGTGTACGTGGG - Intronic
1154248075 18:12717524-12717546 AGATGTGTGCGGAAGTATGTAGG - Intronic
1155473818 18:26217703-26217725 ATGTATATATTGAAGTATTTAGG + Intergenic
1155767933 18:29659150-29659172 GTGTGTATGTGTATGTATGGGGG + Intergenic
1156966514 18:43100685-43100707 AACTGGATGTGGAAGTATGAAGG + Intronic
1156974419 18:43200196-43200218 ATGTGTTTGTGCAGGTATTTGGG + Intergenic
1157078167 18:44491339-44491361 ATGATTAGGTGGAAGTTTGTGGG - Intergenic
1158109199 18:53921071-53921093 ATGTGTATGTGCATGGGTGTGGG + Intergenic
1158283844 18:55856641-55856663 ATGTGTATATGTAACTGTGTAGG - Intergenic
1159625939 18:70694489-70694511 ATATGTATATGAAAGTGTGTGGG - Intergenic
1160288847 18:77572023-77572045 ATGTGCATGTAGAAGGATGGAGG + Intergenic
1161090362 19:2357152-2357174 ATGGGTGTGTGGATGGATGTTGG - Intergenic
1161347723 19:3776504-3776526 ATGGGTATGTGGATGGATGATGG + Intergenic
1161933406 19:7356119-7356141 ATGTGTGTGTGTATGTGTGTTGG - Intronic
1162015287 19:7842819-7842841 ATGTGTGTGTGAAGGTATATAGG + Intronic
1163913305 19:20215642-20215664 GTGTGTGTTTGGGAGTATGTGGG + Intergenic
1165076032 19:33280380-33280402 ATGTGTGTGTGTATGTGTGTTGG - Intergenic
1165153886 19:33776280-33776302 ATGAGTATGTGGGTGTGTGTGGG + Intergenic
924991865 2:319353-319375 ATGTGTGTGTGGGTGTGTGTGGG + Intergenic
925309617 2:2873285-2873307 GTGTGTGTGTGGGAGTGTGTGGG + Intergenic
925329288 2:3045908-3045930 ATGTGTACGTGTGTGTATGTAGG + Intergenic
925572749 2:5329354-5329376 AGGTGTATGTGGATGTGTGTGGG + Intergenic
926293316 2:11548383-11548405 ATGTGTATGTGTATGTATGTGGG - Intronic
926405372 2:12546749-12546771 TTGTGCATGTGAAAGTATTTTGG + Intergenic
926555024 2:14347573-14347595 GTGTGTATGTGTGTGTATGTGGG - Intergenic
926705260 2:15833100-15833122 ATGTGTGTGTTTATGTATGTGGG + Intergenic
926888336 2:17617860-17617882 ATGTGCATGTGCATGTATGCAGG - Intronic
927338787 2:21956216-21956238 ATATGTAAGGGGAAGTATTTTGG + Intergenic
927845789 2:26472148-26472170 ATGTGTGTGTGCATGTATGTGGG - Intronic
928135054 2:28681809-28681831 TTATGTATGTGTATGTATGTAGG - Intergenic
928407027 2:31022577-31022599 ATGTGTATGTGGAGCTAAGGGGG + Intronic
928503025 2:31917673-31917695 ATGGGTATGTGAGTGTATGTGGG - Intronic
929259236 2:39845962-39845984 GTGTGTGTGTGTATGTATGTGGG + Intergenic
929778255 2:44941906-44941928 GTGTGTGTGTGGATGTGTGTGGG + Exonic
929810963 2:45188928-45188950 ATGTGTTTGTGTGAGTGTGTTGG - Intergenic
931463621 2:62468557-62468579 GTGTGTATGTGGGTGCATGTGGG + Intergenic
931937523 2:67215023-67215045 ATGTGTGTGTGGAGGGATATGGG - Intergenic
931987416 2:67755305-67755327 ATGTGTATGTGCGTGTGTGTTGG + Intergenic
932048428 2:68374170-68374192 AGATGTATGTTGAAGTATTTTGG - Intronic
932172441 2:69569428-69569450 ATATGTATGCTGAAGTATTTAGG - Intronic
932852842 2:75203097-75203119 CTGTGTATGTGCAAATATATGGG - Intergenic
932881423 2:75505498-75505520 ATATGTATGTGTACGTATGTGGG + Intronic
933309473 2:80642513-80642535 ATGTGTAGATGGAAAAATGTAGG + Intronic
933517030 2:83317444-83317466 ATGTGTGTGTGTGTGTATGTAGG + Intergenic
933605030 2:84373744-84373766 ATGTGTTTGTGTATGTAAGTTGG - Intergenic
934124002 2:88868569-88868591 ATGTGTATATGTATGTATGTAGG + Intergenic
934578790 2:95421416-95421438 ATATGTATGTGCATGCATGTGGG - Intergenic
934581464 2:95444239-95444261 ATGTGTAAGTGAAAGTGGGTGGG - Intergenic
934597986 2:95632475-95632497 ATGTGTAAGTGAAAGTGGGTGGG + Intergenic
934600657 2:95655287-95655309 ATATGTATGTGCATGCATGTGGG + Intergenic
934946450 2:98546022-98546044 CTTTGTATGTGCAAGTTTGTGGG - Exonic
935715500 2:105935856-105935878 GTGTTTATGTGGATGTGTGTTGG - Intergenic
935715526 2:105936021-105936043 GTGTTTATGTGGATGTGTGTTGG - Intergenic
935734529 2:106096194-106096216 GTGTGTGTGTGTATGTATGTGGG + Intronic
936500329 2:113061610-113061632 ATGTGTGAGTGCAGGTATGTAGG + Intronic
936534025 2:113297411-113297433 ATATGTATGTGCATGCATGTGGG + Intergenic
937503777 2:122513366-122513388 GTGTGTATGTGGATGTGTGTAGG + Intergenic
937581328 2:123492414-123492436 GTGTGTGTGTGCATGTATGTGGG + Intergenic
938235806 2:129706094-129706116 TTGTGTGTGTGTAAATATGTGGG + Intergenic
938937848 2:136143296-136143318 GTGTGTGTGTGCAAGTGTGTGGG + Intergenic
939294395 2:140240811-140240833 ATGTGCATGTGAAAGTATCAAGG + Intronic
939614456 2:144346899-144346921 ATGTGTATGTGAAAGAAAGAGGG - Intergenic
939825163 2:147006460-147006482 ATTTGTCTTTGGAATTATGTAGG - Intergenic
939853993 2:147334761-147334783 CTGTGTGTGTGAGAGTATGTGGG + Intergenic
940415922 2:153419651-153419673 ATGTGTGTGTGCATGTATTTAGG - Intergenic
941020743 2:160406267-160406289 AAGTGTATTTGCAAGTATTTTGG - Intronic
941532171 2:166683902-166683924 ATGGGTATGTGTATGTATATAGG - Intergenic
943118561 2:183705858-183705880 AAGTGTGTGTGTAGGTATGTGGG + Intergenic
943250986 2:185521354-185521376 ATATGTGTGTGGGAGTATGAAGG - Intergenic
943354180 2:186831341-186831363 ATGTGTATGTATACGTGTGTGGG + Intronic
943638576 2:190333709-190333731 ATGTGTATGAGGGAGTAGGGGGG + Intronic
943860440 2:192855328-192855350 ATGTGTATGTGTATGTGTGTGGG - Intergenic
944513407 2:200486642-200486664 ATCTGTATTTGGTAGGATGTTGG - Intergenic
945008072 2:205430982-205431004 ATATGCCTTTGGAAGTATGTAGG + Intronic
946165326 2:217860052-217860074 CTGTGTCTGTGGAAGCATTTTGG - Intronic
946707925 2:222477117-222477139 ATGTGTATGTGTGTGTATATAGG + Intronic
946846678 2:223865164-223865186 ATCTGTGTGTGCAGGTATGTAGG + Intronic
947248190 2:228073420-228073442 ACGGATATGTGCAAGTATGTGGG + Intronic
947558149 2:231117273-231117295 AAGTCTTTGTGGAAGTATATTGG - Intronic
948271002 2:236673125-236673147 ATGTGAATATGGAAGTGTGAGGG + Intergenic
948585705 2:239018350-239018372 ATGTGTGTGTGTAAGCATGTGGG + Intergenic
1168914249 20:1473451-1473473 ATGTGTGTGTGCACCTATGTGGG - Intronic
1169258092 20:4114026-4114048 TTGTGTGTGTGGCTGTATGTTGG + Intergenic
1169833362 20:9850586-9850608 ATGTATATGTATATGTATGTAGG - Intergenic
1171161830 20:22932738-22932760 CAGTGTATGTGAAAGTGTGTGGG + Intergenic
1173064150 20:39693429-39693451 ATGTGTATGTGTGTGTGTGTTGG + Intergenic
1173082920 20:39886923-39886945 GAGTGATTGTGGAAGTATGTTGG - Intergenic
1173164770 20:40679847-40679869 ATGTTTGTGTGCATGTATGTGGG + Intergenic
1173547404 20:43909452-43909474 GTGTGTGTGTGTATGTATGTAGG + Intergenic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1174125635 20:48303088-48303110 ATGTGCATATGGAAGGATGATGG - Intergenic
1175757083 20:61536698-61536720 ATGTGTATATGTATGTATGTAGG - Intronic
1176889471 21:14296872-14296894 ATGTGTGTGTGTGAGTGTGTGGG + Intergenic
1177013888 21:15760211-15760233 TTTTGTAAGTGGAAGTTTGTAGG + Intronic
1177251995 21:18604668-18604690 ATATATATGTGGGACTATGTGGG + Intergenic
1177887751 21:26766321-26766343 ATGTGTGTGTGTATGTGTGTGGG - Intergenic
1178575729 21:33788270-33788292 GTGTGTGTGTGGAAGGAGGTGGG - Intronic
1178928761 21:36798210-36798232 ATGTGTGTGTGCAGGTATTTGGG + Intronic
1179731280 21:43369026-43369048 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1180080398 21:45484510-45484532 ATGTGTATGTGCACATATGCTGG - Intronic
1180597265 22:16986304-16986326 ACGTGCATGTGAAAGTATGAAGG + Intronic
1180761569 22:18213644-18213666 GTGTGTATGTGTATGTGTGTGGG - Intergenic
1180774098 22:18410966-18410988 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181070207 22:20329979-20330001 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181193201 22:21157916-21157938 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181216244 22:21334685-21334707 GTGTGTATGTGTATGTGTGTGGG - Intergenic
1181401474 22:22652532-22652554 GTGTGTATGTGTGAGTGTGTGGG + Intergenic
1181655114 22:24290820-24290842 ATGTATATGTTGAAGAATATAGG + Intronic
1181840425 22:25653986-25654008 ATGTGTACGTTAAAGAATGTGGG - Intronic
1184201588 22:42973076-42973098 ATGTGTTTGCTGCAGTATGTGGG - Intronic
1184239835 22:43206251-43206273 GTGTGTATGTAGGGGTATGTAGG - Intronic
1184337895 22:43865467-43865489 AGGTACATGTGGAAGTATTTGGG + Intergenic
1184491727 22:44813772-44813794 ATGTGTGTGTAGGTGTATGTAGG - Intronic
1184917467 22:47580138-47580160 ATGTGTATGTGTGTGTGTGTGGG + Intergenic
950591902 3:13942500-13942522 ATGTGTGTGTGTGTGTATGTAGG - Intronic
950627063 3:14255024-14255046 ATGTGTGTGTTGGAGTATGTGGG + Intergenic
952942584 3:38455143-38455165 ATGTGTGTTTGGGGGTATGTGGG + Intronic
953169267 3:40492759-40492781 ATGTGTGTGTGTGTGTATGTGGG + Intergenic
953182021 3:40604774-40604796 ATGTGTATGTGGGGGGATGGAGG - Intergenic
953784447 3:45900277-45900299 ATGTGTATGTGGGTGTATGCTGG + Intronic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
954908673 3:54085151-54085173 AAGAGTATGTGGGAGTATGTGGG - Intergenic
956812153 3:72873960-72873982 ATGTGTATGTGGAATATTTTTGG - Intergenic
957255271 3:77827788-77827810 GTGTGAATATGGTAGTATGTTGG + Intergenic
957938155 3:86970086-86970108 ATGGGTTTGAGGAAGTATTTTGG + Intronic
958854561 3:99368868-99368890 ATGTGTCTGCAGAGGTATGTTGG + Intergenic
959190976 3:103111004-103111026 GTGTGTGTGTGTAAGTATATGGG + Intergenic
959327790 3:104958775-104958797 AGGTGTATGTGTAAGTAATTTGG - Intergenic
959370953 3:105525018-105525040 ATTTGTATGTGGATATATATGGG - Intronic
959782092 3:110246173-110246195 GTCTATATGTGTAAGTATGTTGG - Intergenic
960175156 3:114509155-114509177 ATGTGGATGTGGAAATAAGTAGG - Intronic
960633925 3:119764391-119764413 ATATGTTTGTGAAAGTAGGTGGG - Intronic
961114324 3:124315664-124315686 ATGAGTATGTGTAAGTGGGTGGG - Intronic
961477165 3:127155593-127155615 TTGTGTGTGTGTAAGTCTGTGGG + Intergenic
961666237 3:128494642-128494664 GTGTGTATGTGCATGTATCTAGG + Intergenic
962506753 3:136054178-136054200 AGGTGTATGTGTATGTGTGTAGG - Intronic
963005341 3:140721881-140721903 GTGTGTATGTGTATGTGTGTTGG - Intergenic
963999968 3:151758829-151758851 ATGAGTATGTGCATGTGTGTGGG + Intronic
965485489 3:169273411-169273433 ATTTCTATGTGGAAGCATGATGG - Intronic
965515469 3:169616824-169616846 ATCTGTATGTGGAAGTTGGTAGG - Intronic
966078094 3:175963533-175963555 ATGTGCATGTGTATGTATATAGG + Intergenic
967290364 3:187913918-187913940 ATGTGTTTGTGTATGCATGTAGG + Intergenic
967878978 3:194285830-194285852 TTGGGTGTGTGTAAGTATGTGGG + Intergenic
968168641 3:196490062-196490084 CTGTGTATGTGGAAGGGTATTGG - Intronic
968523055 4:1042977-1042999 ATGTGTGTGTGTCAGTGTGTGGG - Intergenic
968840471 4:3001121-3001143 ATGTGTATGTGTATATATATAGG + Intronic
969410886 4:7027410-7027432 CTGTGTATGTGTAGGTGTGTGGG - Intronic
969800890 4:9564367-9564389 GTGTGTGTGTGCATGTATGTAGG - Intergenic
970025770 4:11622516-11622538 ATGTGTATGTGTATGCATGATGG - Intergenic
970076384 4:12226059-12226081 ATGTTTATGTGTATGTATATTGG + Intergenic
971097235 4:23421280-23421302 GTGTGTGTGTGGATGTGTGTGGG + Intergenic
971133110 4:23835498-23835520 GTGTGTGTGTTGGAGTATGTGGG + Intronic
972019790 4:34297633-34297655 TTGTGTATGTGTATGTGTGTGGG + Intergenic
972223313 4:36981740-36981762 ATGTTTAAGTGTATGTATGTTGG - Intergenic
972940522 4:44189638-44189660 GTGTGTGTGTGCATGTATGTTGG - Intronic
974138960 4:57858824-57858846 GTGTGTATGTGTGTGTATGTAGG - Intergenic
974165515 4:58196337-58196359 TTGTGTATGTGTGTGTATGTAGG + Intergenic
975293021 4:72699474-72699496 GTGTGTGTGTGTATGTATGTTGG - Intergenic
975340600 4:73235426-73235448 ATGTGTACTTGGGTGTATGTGGG - Intronic
975408252 4:74017164-74017186 TTGTGTGTGTGGATGTATATAGG + Intergenic
976715790 4:88121359-88121381 ATGTGTATGTGTGTGTCTGTTGG + Intronic
976997678 4:91455817-91455839 GTGTGTATGTGGAGGAATGGGGG + Intronic
977658512 4:99554170-99554192 ATCAGTGTGTGGAAGTAGGTTGG - Intronic
978290966 4:107139834-107139856 ATGTTTATGTGTATATATGTGGG - Intronic
978392597 4:108242867-108242889 GTGTATGTGTGGAAGTATGGCGG + Intergenic
978723799 4:111946458-111946480 ATGTGTTTGATCAAGTATGTGGG - Intergenic
978725156 4:111960871-111960893 ATGTGTTTGATCAAGTATGTGGG + Intergenic
978994302 4:115131037-115131059 ATGTGTGTGTCTAAGTATGTAGG - Intergenic
979176711 4:117674018-117674040 ATTTGTATTTTGAAGTTTGTAGG - Intergenic
979324039 4:119358168-119358190 GTGTGTATGTGCATGTATGAAGG + Intergenic
979418403 4:120472567-120472589 ATGTGCATGTTGAAATATGTAGG + Intergenic
979436030 4:120692070-120692092 ATGAATATGTGGAAGTGGGTAGG - Exonic
979535420 4:121814425-121814447 TTGTGTGTGTGTATGTATGTGGG + Intronic
979991869 4:127384333-127384355 ATGTGTATGTATATGTATATAGG - Intergenic
980882086 4:138721523-138721545 ATGTATGTGTGTAAATATGTAGG - Intergenic
981141619 4:141276094-141276116 ATGAGAATGGAGAAGTATGTAGG - Intergenic
981284946 4:143005724-143005746 ATGTGTATGTGCATGAAAGTAGG - Intergenic
983241877 4:165242854-165242876 GTGTGTATGTGCATGTATGAAGG + Intronic
983432379 4:167667623-167667645 ATGTGTATGTGTATGTACATAGG - Intergenic
983550957 4:169017037-169017059 ATGTGTTTGTGAGAGTGTGTAGG + Intergenic
983710462 4:170709502-170709524 ATGTGTATCTGGAAGTTTATGGG - Intergenic
984376006 4:178930898-178930920 ATCTGTGTGTGTATGTATGTGGG - Intergenic
984592970 4:181636982-181637004 GTGTGTAAGTGGAAGTTTCTCGG - Intergenic
984963452 4:185120496-185120518 GTGTGTATGTGGGTGTATGTAGG + Intergenic
985010442 4:185577147-185577169 GTGTGTGTGTGGAAGGATGTCGG + Intergenic
985833777 5:2255885-2255907 ATGTGTATGTGCATGTGTGTGGG + Intergenic
985842162 5:2315633-2315655 ATGTATGTGTGTATGTATGTAGG + Intergenic
986019212 5:3785485-3785507 ATGTGAATGTGGATGTGAGTTGG - Intergenic
986019258 5:3785896-3785918 ATGTGAATGTGGATGTGAGTTGG - Intergenic
987761288 5:22165473-22165495 ATGTGTATGTGTATGTGTGTTGG - Intronic
988163792 5:27556387-27556409 ATGTGTATGTGTATGTATCTGGG + Intergenic
988700723 5:33671889-33671911 GTGAGTATGTGGATGTGTGTGGG - Intronic
988700740 5:33672128-33672150 ATGTGTGTGTGTATGTATGTGGG - Intronic
990055000 5:51563485-51563507 ATTTGCAGGTGTAAGTATGTTGG + Intergenic
990281833 5:54259223-54259245 ATGAGTATGTGTGTGTATGTGGG - Intronic
990315474 5:54578935-54578957 AAGTGTAGGTGTAAGTATGAGGG - Intergenic
991395659 5:66202519-66202541 ATGTGTATGTGCACGTGTGTGGG - Intergenic
991454929 5:66792859-66792881 ATGTGTGTGTTCAAGTATGGGGG + Intronic
991896079 5:71398927-71398949 ATGTGTATGTGTATGTGTGTTGG - Intergenic
991905199 5:71502862-71502884 ATGTATGTATGTAAGTATGTGGG - Intronic
993511771 5:88779567-88779589 ATGTATATGTGAATATATGTAGG + Intronic
993547947 5:89236057-89236079 GTGTGTATGTGTATGTGTGTGGG + Intergenic
993848605 5:92977416-92977438 ATGTGGATTTGAAAGGATGTGGG + Intergenic
994131056 5:96227887-96227909 ATGTGTAAGGGCAAGTATGGTGG + Intergenic
994384851 5:99119265-99119287 ATGTATGTGTGTAAATATGTAGG - Intergenic
994588892 5:101748690-101748712 ATGTGTGTGTGTAAGTAGGTAGG - Intergenic
994766847 5:103929176-103929198 ATGTGTATGTGGCAGAAAGGAGG + Intergenic
995017575 5:107328473-107328495 ATATGCATGAGAAAGTATGTGGG + Intergenic
995303541 5:110615169-110615191 ACTTGTATTTGGAAGTTTGTGGG - Intronic
995397228 5:111699780-111699802 ATGTGTATGTATATGTTTGTGGG + Intronic
995461758 5:112410842-112410864 ATTTGTATATGGCAATATGTAGG - Intronic
995731454 5:115246970-115246992 GTGTTTATGTGTAAGTATGCAGG + Intronic
996313675 5:122137141-122137163 ATGTGTATGTGCATGTGTATGGG + Intronic
996596919 5:125214529-125214551 ATGTGTATGTGTAAGTAACTTGG - Intergenic
997018280 5:129963874-129963896 ATGTGTATGTGTATATGTGTAGG + Intronic
997306228 5:132838697-132838719 ATGTGCATGTGGATGAATTTTGG + Intergenic
998682022 5:144478915-144478937 ATGTGTATGTGTATGTGTATGGG + Exonic
998715329 5:144877145-144877167 TTGTGTATGTGTGTGTATGTAGG + Intergenic
998811270 5:145968480-145968502 ATGTGTTTGTGCATGTATGTGGG + Intronic
998996888 5:147875755-147875777 ATATGTATGTGGATATTTGTGGG + Intronic
999679933 5:154047338-154047360 ATGTCTATGGGGCAGTAGGTAGG + Intronic
999826480 5:155278260-155278282 ATGTGTGTGTGGGTGTGTGTAGG - Intergenic
1000165339 5:158642816-158642838 ATGTGTATGTGTGTGTATTTTGG - Intergenic
1000577426 5:162991596-162991618 ATATGTATTTGGAATTATGTAGG - Intergenic
1000869268 5:166555602-166555624 ATATGTAAGTGGAGATATGTTGG + Intergenic
1001521011 5:172393048-172393070 AAGTGTATGTGGAAATATAAAGG - Intronic
1001987868 5:176091018-176091040 ATGTGTATGTGGAAGTATGTTGG + Intronic
1002229004 5:177747123-177747145 ATGTGTATGTGGAAGTATGTTGG - Intronic
1002266342 5:178036660-178036682 ATGTGTATGTGGAAGTATGTTGG + Intronic
1002394947 5:178945472-178945494 GTGTGTATGTGGAGGGATATGGG + Intronic
1002394969 5:178945639-178945661 GTGTGTATGTGGAAGGGTATGGG + Intronic
1003006651 6:2389049-2389071 ATGTGGAGGTGTAGGTATGTGGG - Intergenic
1003258382 6:4493912-4493934 ATGTGCATTTGCAAGTATTTTGG - Intergenic
1003348553 6:5294327-5294349 ATGTGTATGTGGTGGTGTGTAGG + Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003490813 6:6619975-6619997 ATGAGTATGTGGAAGGCTGGTGG + Intronic
1003603309 6:7538647-7538669 GTGTGTATGTGCATGTGTGTGGG + Intergenic
1003893902 6:10588851-10588873 GTGTGTATGTGTATGTGTGTGGG + Intronic
1004127047 6:12883971-12883993 TTGTGTATGTGTGTGTATGTGGG - Intronic
1004127051 6:12884065-12884087 TTGTGTATGTGTGTGTATGTGGG - Intronic
1004648580 6:17586593-17586615 ATGTATATGTGTAAATATATGGG - Intergenic
1005078872 6:21936730-21936752 ATATGTATATGGAATTATGATGG + Intergenic
1006256239 6:32834906-32834928 AAGTGTATGTGAAGGTATGGGGG - Intronic
1006415699 6:33902646-33902668 ATGTAAATGTGGAAGTACATCGG + Intergenic
1007278633 6:40693720-40693742 ATTTTTATATGGGAGTATGTTGG - Intergenic
1008378815 6:50820421-50820443 GTGTATGTGTGGAGGTATGTAGG + Intronic
1009015059 6:57890406-57890428 ATGTGTAGGTGGTTGTTTGTTGG + Intergenic
1009552354 6:65115121-65115143 ATGTATTTGTGGAAGTTTGCAGG - Intronic
1011960692 6:93085643-93085665 ATGTTTATGTGTAAATGTGTGGG - Intergenic
1012835550 6:104261108-104261130 ATGTGTATATGGATGTCTGGAGG + Intergenic
1013114893 6:107095366-107095388 ATAGGTATGTGGTAGTATCTTGG - Intronic
1013294915 6:108750442-108750464 ATGTGTGTGTGCACGTGTGTTGG + Intergenic
1013917266 6:115355956-115355978 ACATGTATGTGAAAGTATGCTGG + Intergenic
1013941188 6:115665030-115665052 ATGTCTATATGTATGTATGTAGG + Intergenic
1013995145 6:116299598-116299620 GTGTGTATATGTATGTATGTAGG + Intronic
1014121734 6:117733877-117733899 ATGTGTGTGAGGAAGAATGGGGG - Intergenic
1014320565 6:119923889-119923911 ATGTCTGTGTGGAAGTCTGTTGG - Intergenic
1014975149 6:127871284-127871306 ATGTGTATGTGTATGTATATAGG - Intronic
1015422988 6:133032638-133032660 AAATGTATGTGAAAGCATGTGGG - Intergenic
1015608801 6:134991260-134991282 GTGTGTAAGAGGAAGTGTGTAGG - Intronic
1016866788 6:148775534-148775556 ATGTGTATGTGTGTGCATGTGGG + Intronic
1017048977 6:150372686-150372708 ATGTGTGTGTGGGGGTGTGTTGG + Intronic
1017623469 6:156324197-156324219 ATGTGTATTCTGCAGTATGTAGG + Intergenic
1017876897 6:158532229-158532251 ATGTGTATGTGTGAGTGGGTGGG - Intergenic
1018085658 6:160299453-160299475 ATGTATATATGTAAGTATATGGG - Intergenic
1018853651 6:167660153-167660175 ATATGTATGTGTGTGTATGTGGG - Intergenic
1019075050 6:169380199-169380221 GTGTGTATGCGTATGTATGTAGG + Intergenic
1019127869 6:169852879-169852901 ATGTGCATGTGCACGTGTGTGGG + Intergenic
1019902368 7:4030998-4031020 ATGTGAATGTGTATGTATGGGGG - Intronic
1020875065 7:13683385-13683407 ATATGTATATGTATGTATGTGGG + Intergenic
1022134665 7:27436084-27436106 ATGTGTGGGTGGATGTAGGTGGG - Intergenic
1022682235 7:32559632-32559654 AAGTCTATGGGGAAGTATATAGG + Intronic
1022796862 7:33738672-33738694 AGGTGTATGTGGATGTCTATTGG + Intergenic
1022846175 7:34212282-34212304 GTGTGCATGTGGAAGTGTGGAGG - Intergenic
1023091533 7:36622094-36622116 ATGTGAATGTGTATGTATGGGGG + Intronic
1023743699 7:43302928-43302950 ATGTGTGTGTGCACGTGTGTGGG - Intronic
1023921072 7:44630321-44630343 GTGGGTATGTGGAAGTCTGATGG + Intronic
1024019618 7:45354372-45354394 TGGTGTGTGTGGATGTATGTAGG - Intergenic
1024822603 7:53350694-53350716 AAGTGTATGGGGAAATATGGAGG + Intergenic
1025920233 7:65905054-65905076 ATATGTGTGTGTATGTATGTAGG - Intronic
1026268647 7:68817487-68817509 ATGTGTCTGTGAAAGTACCTTGG + Intergenic
1027618008 7:80448018-80448040 GTATGTATGTGTATGTATGTAGG - Intronic
1028035842 7:85980938-85980960 ATGTGTGTGTGGGTGTGTGTGGG - Intergenic
1031124377 7:117756723-117756745 ATGTGTTTGTTGACTTATGTAGG + Intronic
1031194397 7:118593566-118593588 GTGTGTATGTGCATGCATGTTGG - Intergenic
1031490392 7:122380741-122380763 ATGTGAATGTGGAATTTTCTGGG + Intronic
1031599997 7:123695770-123695792 AACTGTATGTGGAAATGTGTTGG - Intronic
1032086716 7:128887616-128887638 ATGTGTGTGTGGCTGTGTGTGGG - Intronic
1032841250 7:135715241-135715263 ATGTGTATGTGTATGAGTGTGGG + Intronic
1033082212 7:138309006-138309028 ATGTGTGTGTGTAAGTATCTGGG - Intergenic
1033117376 7:138637529-138637551 GTGTGTGTGTGTATGTATGTAGG - Intronic
1033638053 7:143230915-143230937 GTGTGTATGTGAATGTGTGTTGG - Intergenic
1034986926 7:155522072-155522094 CTGTGTGTGTGGATGCATGTGGG - Intronic
1035288320 7:157820629-157820651 ATGTGTGTGTGCACGTGTGTAGG - Intronic
1035291153 7:157839682-157839704 ATGTGTATGTGCAACTGTGTGGG + Intronic
1035336436 7:158131316-158131338 ATGTGTATGAGTGTGTATGTGGG - Intronic
1035690904 8:1558840-1558862 ATGTGTGTGTGCAGGTATATGGG - Intronic
1036490788 8:9223666-9223688 ATTGGTATGTGGATGAATGTGGG + Intergenic
1037315068 8:17592905-17592927 GTGTGTGTGTGCATGTATGTGGG - Intronic
1038333656 8:26629307-26629329 ATGTGTATGTGTGTGTGTGTAGG - Intronic
1038333747 8:26630087-26630109 ATGTGTATGTGAAAATACGTGGG - Intronic
1039442394 8:37604214-37604236 ATGTGTGTGTGCATGTGTGTTGG - Intergenic
1041088391 8:54278895-54278917 GTGTGAGTGTGGAAGTGTGTGGG - Intergenic
1041132905 8:54721939-54721961 ATGTTTATGTAAAAGTTTGTAGG + Intergenic
1042677148 8:71333986-71334008 ATGTATATGTGTATATATGTGGG - Intronic
1043771691 8:84209823-84209845 ATGTGTATGTGTACATGTGTGGG + Intronic
1044689646 8:94864036-94864058 AGATGTATGTGGAAGTATTTAGG + Intronic
1044752113 8:95426349-95426371 ATGTGTATGTGGGAATATTAGGG + Intergenic
1044898757 8:96921869-96921891 GTGACTATGTGGAAGTATCTTGG + Intronic
1045092613 8:98762117-98762139 ATAGATATGGGGAAGTATGTGGG - Intronic
1045143939 8:99317664-99317686 ATGTGTATGTGGATTTACCTTGG + Intronic
1045744677 8:105404658-105404680 AAGTGTATGTGTATGTATGTTGG - Intronic
1045914418 8:107449377-107449399 ATGTGTGTGTGTGAGTGTGTGGG - Intronic
1046141190 8:110094971-110094993 ATGTGATTGTGTATGTATGTGGG - Intergenic
1046478177 8:114777355-114777377 TTTTGTATGTGGTAATATGTAGG - Intergenic
1046995930 8:120522434-120522456 ATGTATATGTGTATGTATTTTGG + Intronic
1047143792 8:122173620-122173642 ATGTGTGTGTGTACGTGTGTTGG - Intergenic
1047230856 8:122996639-122996661 ATGTGTGTGTGGAGGGCTGTGGG - Intergenic
1048955897 8:139535768-139535790 ATGTATGTATGGAAGTATGATGG - Intergenic
1049305526 8:141900953-141900975 CTGTGTATGTGTAAGTGTGTGGG + Intergenic
1049730461 8:144175018-144175040 ATGTATATGAGGAAGTTTGAGGG - Intronic
1050756093 9:9005350-9005372 ATGTGTAAGTGGAAGTAGCATGG + Intronic
1051247783 9:15128958-15128980 ATGTGTATCTAGAAGTTTTTTGG - Intergenic
1051517053 9:17941674-17941696 ATATGTATGTGTAAGTGTGTGGG + Intergenic
1051773624 9:20609342-20609364 ATGTATGTATGCAAGTATGTTGG + Intronic
1051844687 9:21438253-21438275 ATGTGGATGTGGAGGCATGAGGG + Intronic
1052133650 9:24883363-24883385 ATGTGTTTCTGTAAGTGTGTGGG + Intergenic
1052235744 9:26211953-26211975 ATGTGTCTGTGTATGTGTGTTGG + Intergenic
1052662387 9:31450683-31450705 ATGTATATGTGTATGCATGTAGG - Intergenic
1053189565 9:36050905-36050927 ATGTGTGTGTGGAAGTGAGTGGG - Intronic
1055164785 9:73177840-73177862 TTGTGAATGTGGAAGAATGAAGG - Intergenic
1055395591 9:75870569-75870591 ATGTGTGTGTGTAGGTAGGTAGG + Intergenic
1055916572 9:81408196-81408218 ATGTGTGTGTGTATGTGTGTGGG - Intergenic
1056926830 9:90842485-90842507 GTGTGTATGTGTATGTGTGTGGG + Intronic
1057299401 9:93868847-93868869 ATGTGAATGTGTATTTATGTGGG + Intergenic
1057526285 9:95805209-95805231 ATGTGTGTGTGCATGCATGTTGG + Intergenic
1057917123 9:99065472-99065494 ATGTGGAGGTGGAAGTCTGGTGG + Intronic
1058532695 9:105922415-105922437 ATGTGTATGTGTAGTTTTGTGGG + Intergenic
1059316885 9:113433341-113433363 ATGTGTAGGTCGAGGTATGGGGG + Intergenic
1060444360 9:123674103-123674125 ATGTTTATGTGGGAGCATGGTGG - Intronic
1061739659 9:132691834-132691856 ATGTTAATGTTGAAGTATGCAGG + Exonic
1062451307 9:136616877-136616899 ATGAGTGTGTGGAAGGATGTCGG + Intergenic
1185693450 X:2175452-2175474 ATGTGTATGTGGATGAGCGTGGG - Intergenic
1185754145 X:2639905-2639927 ATGTGTTTGTGTATGTGTGTAGG - Intergenic
1185776535 X:2807604-2807626 ATGTGCATGTGTGTGTATGTGGG + Intronic
1185964280 X:4582644-4582666 ATGCATTTGTGTAAGTATGTGGG + Intergenic
1186068828 X:5795542-5795564 ATGTGTTTGTGGAAGCAAGGAGG - Intergenic
1186878519 X:13840814-13840836 ATGTGTGTGTGTGTGTATGTAGG + Intronic
1187248552 X:17575803-17575825 ATGTCTATTTGGAAGCATGAAGG + Intronic
1189368624 X:40410079-40410101 AGGTGTATGTAGAAGTATTTAGG - Intergenic
1189891157 X:45603873-45603895 ATGTGTATGTTGAGGGAGGTTGG + Intergenic
1190160440 X:48028153-48028175 ACGTCTATGTGGAGATATGTGGG + Intronic
1191693621 X:63965616-63965638 ATGTGTATGTGCAAATTAGTCGG - Intergenic
1191994754 X:67080951-67080973 AGGTGTATGTTGAATTATTTAGG + Intergenic
1192361991 X:70445962-70445984 ATATGTGTGTGTATGTATGTTGG + Intronic
1192897363 X:75458640-75458662 TGGGGTATGTGGAACTATGTAGG + Intronic
1193232970 X:79070358-79070380 ATCTGAAATTGGAAGTATGTAGG + Intergenic
1193598851 X:83483287-83483309 ATGTGTTTGTGGAGGTATGAGGG + Intergenic
1193909969 X:87292173-87292195 ATGGGGATGTGTATGTATGTGGG + Intergenic
1194620554 X:96165533-96165555 ATGTGTAAGTTGATGTAGGTAGG - Intergenic
1194691331 X:96989648-96989670 TAGTGCATGTGGAAGTATATTGG + Intronic
1194853619 X:98900584-98900606 GTGTGTATGTGCAAATATTTCGG - Intergenic
1195029599 X:100913367-100913389 GTGTGTATGTGTATGTGTGTAGG - Intergenic
1195320911 X:103721419-103721441 ATATGTGTGTGCATGTATGTGGG - Intronic
1195568179 X:106368335-106368357 ATGAGTATATGTATGTATGTGGG + Intergenic
1196172447 X:112604625-112604647 ATGTGTGTGTGTATGTGTGTTGG - Intergenic
1196737396 X:118991968-118991990 AGTTGTATGTTAAAGTATGTGGG + Intronic
1196819298 X:119690332-119690354 GTGTGTATGTGTATGTATGTGGG - Intronic
1196981598 X:121220277-121220299 ATATGCATGTTGAAGTATTTCGG + Intergenic
1198828579 X:140724744-140724766 ATGTGTCTGTGTGTGTATGTAGG - Intergenic
1200052219 X:153440198-153440220 ATGTGTGTGTGCAAGTGTGGGGG + Intergenic
1200814850 Y:7521006-7521028 ATGTGTATTTCTAAGTATATAGG - Intergenic
1201293441 Y:12443856-12443878 GTGTGTATGTGGGGATATGTGGG - Intergenic
1201293444 Y:12443866-12443888 ATGTGCATGTGTGTGTATGTGGG - Intergenic
1202278610 Y:23152100-23152122 ATGTGTGTTTGAAAATATGTAGG - Intronic
1202286128 Y:23249509-23249531 ATGTGTGTTTGAAAATATGTAGG + Intronic
1202286593 Y:23256664-23256686 ATGTGTGTTTGAAAATATGTAGG + Intronic
1202431434 Y:24783440-24783462 ATGTGTGTTTGAAAATATGTAGG - Intronic
1202431737 Y:24788197-24788219 ATGTGTGTTTGAAAATATGTAGG - Intronic
1202432040 Y:24792953-24792975 ATGTGTGTTTGAAAATATGTAGG - Intronic
1202438228 Y:24869965-24869987 ATGTGTGTTTGAAAATATGTAGG + Intronic
1202438531 Y:24874722-24874744 ATGTGTGTTTGAAAATATGTAGG + Intronic