ID: 1001995539

View in Genome Browser
Species Human (GRCh38)
Location 5:176154510-176154532
Sequence GGTAAGGAAGACGAAGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001995536_1001995539 22 Left 1001995536 5:176154465-176154487 CCTAGCTGAAATAATCACAAAAC 0: 1
1: 0
2: 11
3: 32
4: 268
Right 1001995539 5:176154510-176154532 GGTAAGGAAGACGAAGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001995539 Original CRISPR GGTAAGGAAGACGAAGCCGC AGG Intergenic
No off target data available for this crispr