ID: 1001996008

View in Genome Browser
Species Human (GRCh38)
Location 5:176159110-176159132
Sequence CAGGTCAAAACCACCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001996004_1001996008 -3 Left 1001996004 5:176159090-176159112 CCTCCTTGCACAGGGTCAGTCAG 0: 1
1: 0
2: 3
3: 16
4: 164
Right 1001996008 5:176159110-176159132 CAGGTCAAAACCACCTTTGTGGG 0: 1
1: 0
2: 3
3: 6
4: 121
1001996001_1001996008 27 Left 1001996001 5:176159060-176159082 CCACGTGCTTATGCTGGTGAGGA 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1001996008 5:176159110-176159132 CAGGTCAAAACCACCTTTGTGGG 0: 1
1: 0
2: 3
3: 6
4: 121
1001996006_1001996008 -6 Left 1001996006 5:176159093-176159115 CCTTGCACAGGGTCAGTCAGGTC 0: 1
1: 0
2: 2
3: 8
4: 155
Right 1001996008 5:176159110-176159132 CAGGTCAAAACCACCTTTGTGGG 0: 1
1: 0
2: 3
3: 6
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001996008 Original CRISPR CAGGTCAAAACCACCTTTGT GGG Intergenic
900014218 1:137550-137572 CAGCTCCCAACCGCCTTTGTAGG - Intergenic
900044081 1:492752-492774 CAGCTCCCAACCGCCTTTGTAGG - Intergenic
900065491 1:727658-727680 CAGCTCCCAACCGCCTTTGTAGG - Intergenic
902268844 1:15288730-15288752 CAGATCAATACCACGTCTGTGGG + Intronic
902464376 1:16606869-16606891 CAGGTAAAAACCATCTGGGTGGG + Intronic
905437630 1:37968512-37968534 CAGGTCAGCATCATCTTTGTAGG + Intronic
906627296 1:47335144-47335166 TAGGTCAAAAAAACTTTTGTTGG - Intronic
911471490 1:98324210-98324232 CAGAGCAAAACCACATTTATTGG - Intergenic
914934086 1:151962648-151962670 CATGTCAAAAGCAACTTTGCAGG - Intergenic
919815547 1:201436268-201436290 CAGGTCCAAAGCAACTATGTTGG - Intergenic
922734371 1:227971532-227971554 CAGCTCCCAACCGCCTTTGTAGG + Intergenic
922734660 1:227972664-227972686 CAGCTCCCAACCGCCTTTGTAGG + Intergenic
924162759 1:241251035-241251057 CAGGTCAAAGCCATCTTTCACGG + Intronic
924717220 1:246587712-246587734 CAGGTCAAAAGCCTCATTGTGGG - Intronic
1064189352 10:13192226-13192248 CAGGTCAACACCAGCTTTAGAGG - Intronic
1070764247 10:79047441-79047463 GAAGTCAAAGCCTCCTTTGTTGG + Intergenic
1071785056 10:88890215-88890237 CTGGTCAGACCCAGCTTTGTGGG + Intronic
1072323555 10:94274186-94274208 CACGACAAACCCACCTGTGTAGG + Intronic
1074846024 10:117398658-117398680 CAGTTCAAAACCACCTTCTAAGG - Intergenic
1076970416 11:129227-129249 CAGCTCCCAACCGCCTTTGTAGG - Intergenic
1078065920 11:8079593-8079615 CAGGTCAGATCCATCTCTGTCGG - Intronic
1079955180 11:26853241-26853263 CATGTCCTAACCACGTTTGTGGG - Intergenic
1080776333 11:35390430-35390452 CAGGCCAAAACCAATTTAGTGGG - Intronic
1083491618 11:63018294-63018316 CAAGTCAAATCCACCTTATTGGG + Intergenic
1084672543 11:70615810-70615832 CAGGTCTAAGCCACCTTGGCCGG + Intronic
1085694285 11:78690692-78690714 CAGGGCAAAACCAGTTTTGGGGG - Intronic
1087140056 11:94756241-94756263 CAGGCCAAAAGCAGCTTTTTGGG + Intronic
1090261391 11:125323222-125323244 CAGGTCAAAATCACCATGGCTGG + Intronic
1091423639 12:366075-366097 CATTTCAAAACCTCCTTTGCTGG + Exonic
1091921138 12:4305845-4305867 CAGGCCACAACTACCTTTGCTGG + Intergenic
1100228769 12:92586244-92586266 CAGGTAAAAACAACTTGTGTAGG + Intergenic
1100268211 12:92998917-92998939 TAGGTCTATACCAGCTTTGTGGG - Intergenic
1101302594 12:103496522-103496544 CAGATGAGAACGACCTTTGTTGG - Intergenic
1104196477 12:126543848-126543870 CAGAACAAGATCACCTTTGTTGG - Intergenic
1108460494 13:50662402-50662424 CAGGTCCACTCCACCTTGGTGGG + Intronic
1116031594 14:39579415-39579437 AAGTTCAACACCAACTTTGTAGG - Intergenic
1116645773 14:47527061-47527083 CATGTCTTAATCACCTTTGTAGG - Intronic
1118533310 14:66731257-66731279 AAAGTCACAACCACCTTTTTGGG - Intronic
1120654737 14:87176406-87176428 CAGCTTAAAACCTCTTTTGTAGG - Intergenic
1120980193 14:90282551-90282573 CAGGTTAAAACCTCATTTTTAGG - Intronic
1129862199 15:78871785-78871807 CTGTTCAAAAACAACTTTGTTGG - Intronic
1131459153 15:92606372-92606394 CAGGTCAAACAAACCTTTGGTGG - Intergenic
1132482563 16:173749-173771 CAGGTAAACACCTCCATTGTTGG - Intergenic
1136529631 16:30859338-30859360 CAGGTGTAAACCACCATGGTGGG - Intronic
1138077116 16:54053474-54053496 CTGCTCTAAACCACCTTTGGTGG + Intronic
1141256103 16:82403914-82403936 CAGGACAGAAGCACCTCTGTGGG + Intergenic
1142449834 16:90168255-90168277 CAGCTCCCAACCGCCTTTGTAGG + Intergenic
1142457252 17:63591-63613 CAGCTCCCAACCGCCTTTGTAGG - Intergenic
1143300191 17:5903168-5903190 CAGCTGAAAACCACATTTGCTGG - Intronic
1149012856 17:51875309-51875331 CAGGTCAAAACTGCCTTTCTAGG - Intronic
1151388007 17:73767174-73767196 CAGGGCAAAACCACCTTGTTAGG - Intergenic
1152160613 17:78666366-78666388 CAGGACACGCCCACCTTTGTTGG + Intergenic
1154283483 18:13029748-13029770 CAGATCAAAACCACCTCTATTGG - Exonic
1156847737 18:41688236-41688258 CTGGTCAAATCAACTTTTGTGGG + Intergenic
1157131351 18:45010150-45010172 CATGTCAAAACAAGCTTCGTGGG - Intronic
1157539315 18:48488393-48488415 CAGGTCAGGACCACCTGTGCCGG + Intergenic
1160647612 19:200696-200718 CAGCTCCCAACCGCCTTTGTAGG - Intergenic
1164255069 19:23520855-23520877 CATATCACAACCACCTTAGTGGG + Intergenic
1167896768 19:52588042-52588064 CAAGTCAAAATTACCCTTGTAGG + Intergenic
1167921845 19:52788580-52788602 CAGGTCAAAATTGCCCTTGTAGG - Intronic
1167942114 19:52956265-52956287 CGGGTCAAAATTACATTTGTAGG - Intronic
1168557137 19:57352495-57352517 CAGGTCTTAATTACCTTTGTTGG + Intronic
933738880 2:85517349-85517371 CAGGTCCCAACCACCTTTCAGGG - Intergenic
937868791 2:126773011-126773033 GAGGTCAGTACCTCCTTTGTTGG + Intergenic
940247854 2:151638639-151638661 CAGGTCAAAAACCTATTTGTGGG + Intronic
945668350 2:212770409-212770431 CAGGTCACAACCAGCTTTCACGG - Intergenic
947604054 2:231472448-231472470 CAGGACTAAACCACCTTCCTGGG + Intronic
1170791562 20:19513165-19513187 CAGGTCAAATCCTCTTTTGGAGG + Intronic
1171059155 20:21939391-21939413 CACGTCAAAACTCCCTGTGTTGG - Intergenic
1172830838 20:37833104-37833126 CAGGTCCAAAGTACCTTTGTGGG - Intronic
1173518476 20:43681987-43682009 CAGGGCAAATGGACCTTTGTAGG + Intronic
1174864730 20:54124786-54124808 CAGGTCTTAACCATTTTTGTAGG + Intergenic
1179146493 21:38773083-38773105 CAGGTCTGCACCACCTTTGAGGG - Intergenic
949808310 3:7978730-7978752 CAGGCCAAAAGCAACTTTTTGGG + Intergenic
950247429 3:11434157-11434179 CAAATCAAAACCAGCTGTGTGGG - Intronic
950517399 3:13476336-13476358 CAGGTCAACAAGACCTTTGCAGG + Intergenic
951615108 3:24533535-24533557 CTGGTCAAATCCACTTTAGTAGG + Intergenic
952225668 3:31373147-31373169 CTGGTCAAAACCAGCACTGTTGG + Intergenic
953856196 3:46500805-46500827 CATGCCAAAACCACATCTGTAGG + Exonic
954005055 3:47583989-47584011 CAGGCCCAAACCTCCTTTGTTGG - Intergenic
956801441 3:72763152-72763174 TAAGTAAAAAACACCTTTGTAGG + Intronic
957375508 3:79352037-79352059 CTGTTCAAAATTACCTTTGTTGG - Intronic
957715441 3:83923997-83924019 CAGTTTAGAAACACCTTTGTGGG - Intergenic
960661526 3:120065339-120065361 TAGGTGCAAACCACCATTGTTGG - Intronic
961033776 3:123628443-123628465 CATGTCAACACCACCCTTCTTGG + Intronic
965941823 3:174193454-174193476 CAGTTCAAAACCTACTTTTTTGG - Intronic
966266451 3:178050721-178050743 TAAGTCAAAACCACATTTTTTGG - Intergenic
967466261 3:189809446-189809468 CCAGTTAAAACCAACTTTGTAGG - Intronic
968370235 3:198219419-198219441 CAGCTCCCAACCGCCTTTGTAGG + Intergenic
971168881 4:24212992-24213014 CAGGACAAAATCAGCCTTGTTGG + Intergenic
978629600 4:110728694-110728716 TATGTCACAACCTCCTTTGTTGG - Intergenic
982699088 4:158639290-158639312 GAGGTCTAAACATCCTTTGTTGG - Exonic
982981491 4:162141977-162141999 CAGGACAAAATTACCTTTGGTGG - Intronic
984699542 4:182809737-182809759 CAGGGCAAAACCACCAATATGGG - Intergenic
992347083 5:75890437-75890459 CAGGTAAGCACCACCTTTGAAGG - Intergenic
996917308 5:128727665-128727687 CAAGTCAAAACCAACAATGTAGG + Intronic
998284495 5:140846037-140846059 CAAGTTAACACCACCTATGTGGG + Intronic
1000364688 5:160479839-160479861 CAGAGCAAAACCACCTAAGTTGG + Intergenic
1001996008 5:176159110-176159132 CAGGTCAAAACCACCTTTGTGGG + Intergenic
1002729762 5:181326177-181326199 CAGCTCCCAACCGCCTTTGTAGG + Intergenic
1006381964 6:33704220-33704242 CAGTTCAGAACCACCCTGGTGGG + Intronic
1007914596 6:45549309-45549331 CTTCTCAAACCCACCTTTGTAGG + Exonic
1011739461 6:90345602-90345624 CAGGTCAGAGCTACCATTGTGGG - Intergenic
1018038933 6:159904748-159904770 CAGGTCCAAACGGGCTTTGTGGG - Intergenic
1023400987 7:39792961-39792983 CAGCTCCCAACCGCCTTTGTAGG + Intergenic
1024648645 7:51387816-51387838 CAGCTCCCAACCGCCTTTGTAGG - Intergenic
1025130173 7:56370877-56370899 CAGCTCAAAACCGCCTTTGTAGG - Intergenic
1025130493 7:56372175-56372197 CAGCTCAAAACCGCCTTTGTAGG - Intergenic
1025130812 7:56373469-56373491 CAGCTCAAAACCGCCTTTGTAGG - Intergenic
1025226444 7:57168832-57168854 CAGGTCAAATCCGCATTCGTAGG - Intergenic
1025863863 7:65361533-65361555 TAGACCAAAAGCACCTTTGTGGG + Intergenic
1030617432 7:111752907-111752929 CAGGACAAAAACACTTTTTTTGG + Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1039921105 8:41895424-41895446 TAGGTCAGAAACACCTTTGATGG - Intronic
1040357799 8:46636587-46636609 CATATCAAAACCTCCTTTATGGG - Intergenic
1040378457 8:46849297-46849319 CATATCAAAACCCCCTCTGTGGG - Intergenic
1041641433 8:60207009-60207031 CAGGTCGCAGCCACCTTGGTGGG - Intronic
1044024367 8:87150206-87150228 CAGGTAGAAAACAGCTTTGTAGG + Intronic
1044828904 8:96225892-96225914 CAGCTAAAAACCACCAGTGTAGG - Intergenic
1045106044 8:98893690-98893712 CAGAGGAAAACCACCTTTCTTGG - Intronic
1048531376 8:135253372-135253394 CAGGCCAAAAGCAACTTTTTGGG - Intergenic
1050626769 9:7512263-7512285 GAGATAAAAACCACCTTTGAGGG + Intergenic
1061643293 9:131977286-131977308 CAGGTCAAAGCCTGGTTTGTGGG + Intronic
1062754174 9:138278689-138278711 CAGCTCCCAACCGCCTTTGTAGG + Intergenic
1185982932 X:4799229-4799251 CAGGCCAAAAGCAACTTTTTGGG + Intergenic
1188677503 X:32960378-32960400 CAGGTCAAAGCCACCTCTCTAGG + Intronic
1190053720 X:47170222-47170244 CAGGGCAAAAACCCCTTTGGTGG + Intronic
1197204550 X:123778385-123778407 CTGGTCAAAAAGATCTTTGTGGG - Intergenic
1197704012 X:129620766-129620788 CAGGGCAAGACTACCTATGTTGG - Intergenic
1200969009 Y:9130006-9130028 TAGTTCAAAGCCAGCTTTGTAGG + Intergenic
1201632130 Y:16080549-16080571 TGGGTCAACGCCACCTTTGTGGG + Intergenic