ID: 1002015035

View in Genome Browser
Species Human (GRCh38)
Location 5:176314384-176314406
Sequence CAAGACCAACAGACTTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002015034_1002015035 3 Left 1002015034 5:176314358-176314380 CCACATAGCTTGAATGAGTTTTC 0: 1
1: 0
2: 4
3: 15
4: 153
Right 1002015035 5:176314384-176314406 CAAGACCAACAGACTTCCTTTGG 0: 1
1: 0
2: 2
3: 13
4: 121
1002015033_1002015035 21 Left 1002015033 5:176314340-176314362 CCAACAATGTGGCAGGCACCACA 0: 1
1: 0
2: 9
3: 67
4: 537
Right 1002015035 5:176314384-176314406 CAAGACCAACAGACTTCCTTTGG 0: 1
1: 0
2: 2
3: 13
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002015035 Original CRISPR CAAGACCAACAGACTTCCTT TGG Intronic
903898733 1:26626687-26626709 TAGGACCAACTGACTTCCATGGG + Intergenic
907413131 1:54296378-54296400 GAAGAAAAACAGACTGCCTTAGG - Intronic
908850962 1:68375267-68375289 CAGCTCCCACAGACTTCCTTCGG + Intergenic
908944970 1:69484610-69484632 CAATAGCAACAGACTTGCTGAGG - Intergenic
910328433 1:86039245-86039267 CAAGTCTAACAAACTTCTTTTGG - Intronic
911389719 1:97225659-97225681 CAAGATGAAAAGACTTCCTATGG - Intronic
918598472 1:186322550-186322572 CACGTCCTACAGACTGCCTTCGG + Exonic
920880612 1:209877002-209877024 CAGGACCACCAGTTTTCCTTGGG - Intergenic
921776972 1:219112315-219112337 CATCACCCACAGACTTCCATTGG + Intergenic
1064418713 10:15171867-15171889 AAAGACCAAAAGAAATCCTTAGG + Intergenic
1067260417 10:44685003-44685025 CAATACCAGCTGACTTCCTCAGG + Intergenic
1067454902 10:46412403-46412425 CATGACCAGCAGGCTGCCTTGGG + Intergenic
1067632302 10:47972231-47972253 CATGACCAGCAGGCTGCCTTGGG - Intergenic
1068313970 10:55318082-55318104 CAAGAACGACTGAATTCCTTTGG + Intronic
1069578601 10:69548589-69548611 CAAGACCACCAGGCTCTCTTTGG - Intergenic
1071083840 10:81844767-81844789 CAAAACAAACAGACTTCAATGGG - Intergenic
1071734746 10:88285939-88285961 AAGGACCAACAAGCTTCCTTGGG - Intronic
1073551288 10:104404146-104404168 CAAGACTAACAGGCAGCCTTAGG - Intronic
1077703004 11:4459013-4459035 CATGAACAACATATTTCCTTAGG - Intergenic
1079459477 11:20667855-20667877 CAAGGCAGACAGATTTCCTTTGG + Intergenic
1084940952 11:72613061-72613083 CAAGACCAACGCCCTTCCTGAGG + Intronic
1085887106 11:80533724-80533746 CAAGACAAATGGACTTCCTTAGG - Intergenic
1093096741 12:14980657-14980679 CAAGACCAGCAAATTTGCTTTGG + Intronic
1096514175 12:52147232-52147254 CGAGACCTCCAGGCTTCCTTGGG + Intergenic
1097778480 12:63675410-63675432 CAAGACCACCAGACTTGTTGGGG + Intergenic
1097887801 12:64747376-64747398 CATGACAAACAGAATTCCTGAGG + Intronic
1098031296 12:66257476-66257498 TAAGACCAGCAGAATTCCATGGG + Intergenic
1101553514 12:105785338-105785360 CAAGATCACCAGACTTACCTAGG + Intergenic
1103762961 12:123264751-123264773 ACAGACCCACACACTTCCTTGGG + Intronic
1105413782 13:20192655-20192677 CTGGACCAACACACGTCCTTGGG - Intronic
1108060553 13:46528907-46528929 GAAGACTAACAGAATTCCTTAGG - Intergenic
1108107842 13:47032044-47032066 TAAGAGCAACAGACTTCATGTGG - Intergenic
1110177735 13:72577804-72577826 CAGGACCAAGTGACTTGCTTTGG + Intergenic
1110760638 13:79226896-79226918 CAAGAGCAGCAGACTCCCTTTGG + Intergenic
1113158541 13:107352987-107353009 CAACCCCAAGAGACTTCCTGGGG + Intronic
1113651087 13:112034743-112034765 TAAGGCCAACGGACTTCTTTAGG - Intergenic
1114137523 14:19868711-19868733 CAAGCCCAACACACATTCTTCGG + Intergenic
1114997194 14:28369312-28369334 CAAGAACAACATACTTCTCTGGG + Intergenic
1118161310 14:63293365-63293387 CAAGATCAACTTACTTCCTGTGG - Intergenic
1120883860 14:89436342-89436364 CATGACCAAAAGTCTTCCTAAGG - Intronic
1125198860 15:37080731-37080753 CAAGACAAACTCCCTTCCTTTGG + Intronic
1125759786 15:42088669-42088691 CAAGGCCAACAGCCTTCCTTGGG - Intronic
1128680425 15:69647554-69647576 AAAGACAAACAGACTTCGTTAGG + Intergenic
1137731104 16:50691227-50691249 CAAAACCAACAGACTCACTCTGG + Intergenic
1139008066 16:62598099-62598121 CAAGACAAACAGACTTCATTAGG - Intergenic
1145767929 17:27472113-27472135 CAAGACCAAGAGACAGCCATGGG + Intronic
1146494829 17:33312400-33312422 GAAGAACAACAGACTACATTTGG - Intronic
1146773092 17:35587166-35587188 CCAGACCCAAAGATTTCCTTTGG - Intronic
1147554314 17:41466740-41466762 CAGGACAAAGAGACTTCCCTAGG - Intronic
1151294672 17:73176060-73176082 TAAGACAAGCAGATTTCCTTCGG - Intergenic
1152037658 17:77883333-77883355 CAAGGTCAAGAAACTTCCTTGGG + Intergenic
1154329150 18:13415504-13415526 CTATACAACCAGACTTCCTTTGG - Intronic
1154482268 18:14843518-14843540 TCAGAACAACAGATTTCCTTAGG - Intronic
1155589690 18:27412260-27412282 CAAGAGAAACAGACTTCATAAGG + Intergenic
1155642450 18:28035091-28035113 GAAGACCTACAAAGTTCCTTAGG + Intronic
1159182088 18:64921028-64921050 CAAAAGCAACAGATTTTCTTGGG + Intergenic
1167533905 19:50036823-50036845 CAAGGCCAACAGACTGCCTCTGG - Intronic
929091440 2:38221580-38221602 CCAGGACAACAGACATCCTTAGG - Intergenic
932653098 2:73581359-73581381 CAAAACAAACACAATTCCTTGGG + Intronic
933340440 2:81018518-81018540 CAAGACCAAAAATATTCCTTAGG - Intergenic
938646570 2:133337039-133337061 ATAGATCAACAGACTTCCTGTGG + Intronic
939498446 2:142950673-142950695 AAAGACCAACAGCCTTCATATGG - Intronic
944599494 2:201289120-201289142 CAAGACCATCAGACTCCCAGGGG + Intronic
944863998 2:203842963-203842985 TATGCCCAAGAGACTTCCTTGGG - Intergenic
945793862 2:214337600-214337622 TAAAACCAACAGACCTCCTATGG + Intronic
945828472 2:214753900-214753922 CAAGTCCAACAACCTTCCTCTGG + Intronic
1170145192 20:13165842-13165864 CAAGACCAACACACTTGTTTAGG + Exonic
1176798337 21:13393103-13393125 TCAGAACAACAGATTTCCTTAGG + Intergenic
1177377023 21:20284068-20284090 GAAGAGGAACAGACTTTCTTAGG - Intergenic
1177513523 21:22120523-22120545 CAAGAACCCCAGACTTCCTTTGG - Intergenic
1182133154 22:27873752-27873774 CAAGACCAAGAGAGGCCCTTTGG - Exonic
1182562427 22:31171011-31171033 AAAAAACAACAAACTTCCTTAGG - Intronic
1184193315 22:42909364-42909386 CAAGACCACAAGGCTTTCTTTGG + Intronic
1185340364 22:50288228-50288250 CAAGACCTCCAGGCTTCCCTGGG - Intronic
953535023 3:43770656-43770678 CAAGAGCAACAGACTTCTATAGG - Intergenic
954104541 3:48402897-48402919 CAAGACCAACATGGCTCCTTAGG + Intergenic
955780243 3:62476924-62476946 CAAGATCAAAATATTTCCTTAGG - Intronic
957412263 3:79857266-79857288 CAAGACCCACTGAGTTTCTTTGG - Intergenic
960031260 3:113057166-113057188 AAAGAGGACCAGACTTCCTTGGG - Intergenic
960826822 3:121795708-121795730 CAAGCCTAACATACCTCCTTTGG - Intronic
962022823 3:131517973-131517995 CAAGAGAACCAGATTTCCTTTGG + Intergenic
967201381 3:187075381-187075403 CAAGCCCAGCAGTGTTCCTTAGG - Intronic
967965395 3:194956542-194956564 CAAGACCACAAGCCTTCCTCGGG + Intergenic
979759450 4:124382920-124382942 ATAGACAAACAGACTTCATTTGG - Intergenic
980751469 4:137095531-137095553 CGACACCAACAGACTTACATAGG + Intergenic
981011645 4:139931331-139931353 CAAGAACGATAGACTTGCTTGGG - Intronic
981036687 4:140176812-140176834 CAAGAACTTCAGACTTCCTTGGG - Intergenic
982491641 4:156038031-156038053 CAAGAGCAATCTACTTCCTTCGG - Intergenic
984984224 4:185311920-185311942 CAACATCAACAGACTTCCTGTGG - Intronic
989502866 5:42189421-42189443 TAAGCACAAAAGACTTCCTTGGG + Intergenic
992877350 5:81070028-81070050 CCAGACTCACAGACATCCTTAGG - Intronic
993377985 5:87172450-87172472 CAAGACCCACAAACTGCATTAGG + Intergenic
994109553 5:95985606-95985628 CCAGAGAAACAGACTTCCTTAGG + Intergenic
994329543 5:98489403-98489425 AAAGTCCAACAGGCTTCTTTTGG + Intergenic
994865144 5:105259039-105259061 TATGGCCAACTGACTTCCTTGGG + Intergenic
995177768 5:109198450-109198472 CAGCACCATCAGCCTTCCTTGGG - Intergenic
996008087 5:118447866-118447888 AAAGACCAAAAGACATTCTTAGG + Intergenic
996639002 5:125730221-125730243 TAAGACCAACTGAGTTCCTGGGG + Intergenic
998422535 5:142000931-142000953 CCAGAGCAACAGACCACCTTGGG + Exonic
999476083 5:151900020-151900042 CTAGAGGACCAGACTTCCTTAGG - Intronic
1000378259 5:160604473-160604495 CAGGGCCAACACACTTCCCTCGG + Intronic
1002015035 5:176314384-176314406 CAAGACCAACAGACTTCCTTTGG + Intronic
1007284454 6:40737608-40737630 CAAGACCACCAGCCTTATTTGGG - Intergenic
1007390650 6:41547871-41547893 CACGCCAAACAAACTTCCTTGGG + Intronic
1009724380 6:67518617-67518639 CAAGAGCATCAAACTTCCTCTGG - Intergenic
1011628039 6:89299167-89299189 CAAGACTAACAGAGCACCTTTGG + Intronic
1011663418 6:89613396-89613418 TAAGACCAACAGCATTGCTTTGG - Intronic
1015167652 6:130216219-130216241 CAAGTCCATCAGAGGTCCTTTGG - Intronic
1015641709 6:135340524-135340546 CAAGAAAAACAGAAGTCCTTCGG + Intronic
1016542115 6:145177951-145177973 ACAGACCAACAGATTCCCTTGGG + Intergenic
1022937413 7:35193078-35193100 CAAGACCACCAGACTTGTTGGGG + Intergenic
1028372712 7:90112524-90112546 CAAGACCACCAGACTTGTTGGGG - Intergenic
1029833576 7:103285722-103285744 CAAGACCACCAGACTTGTTGGGG + Intergenic
1032626823 7:133600132-133600154 CAAGGCCAACAGATTTCTTGAGG - Intronic
1035700501 8:1635844-1635866 CCAAACCAACAGACGTCCTCTGG - Intronic
1038228844 8:25682104-25682126 CATGACCATCTGACTTGCTTTGG + Intergenic
1038855051 8:31321913-31321935 CAAGAACACAAGACTTCCTTTGG - Intergenic
1041703507 8:60818719-60818741 CAAGAACAACAAACTTTCTCTGG - Intronic
1042462019 8:69080714-69080736 CACGACCAACAGAATACCTAAGG - Intergenic
1042529569 8:69801052-69801074 CAGGAACAGCAGAATTCCTTAGG + Intronic
1043097832 8:75998023-75998045 CATGAAGAACAGACTTTCTTTGG - Intergenic
1044004083 8:86920613-86920635 CATTCCCAACAGACTTCCTTGGG - Intronic
1047390685 8:124448322-124448344 CAGGACCAACTGACTGACTTTGG - Intergenic
1048908516 8:139111726-139111748 CAAGGCCAAGAGACTTCCAATGG + Intergenic
1052669946 9:31543894-31543916 CTTGACCAACAGATTTCCTCAGG - Intergenic
1055469182 9:76594556-76594578 CAAGACCAGCAGACCAGCTTGGG - Intergenic
1056104358 9:83332411-83332433 CAAGAATAACAGAGTTCTTTGGG - Intronic
1061079972 9:128364119-128364141 CAAGTCAAACCCACTTCCTTAGG + Intergenic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1188622051 X:32237625-32237647 CATGACCACGTGACTTCCTTTGG + Intronic
1189168377 X:38884595-38884617 CAAGCCCAACAGAAAGCCTTTGG - Intergenic
1190251667 X:48731603-48731625 CTAGACCAGCAGGCTTCCCTGGG - Intergenic
1191015389 X:55804491-55804513 AAAGACCAACTTTCTTCCTTTGG - Intergenic
1194576918 X:95624615-95624637 CAAGAACAACTGACTTCCAAAGG + Intergenic
1197602149 X:128543417-128543439 CAAGCCCAACACACTTGCTGTGG - Intergenic
1200807585 Y:7448130-7448152 CAATCCCTACAGAATTCCTTGGG + Intergenic
1201562001 Y:15327840-15327862 GAAGACCAACACACTAACTTAGG - Intergenic