ID: 1002015041

View in Genome Browser
Species Human (GRCh38)
Location 5:176314426-176314448
Sequence AACAACCTTGTGAAATCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002015036_1002015041 14 Left 1002015036 5:176314389-176314411 CCAACAGACTTCCTTTGGTCTAT 0: 1
1: 0
2: 0
3: 19
4: 182
Right 1002015041 5:176314426-176314448 AACAACCTTGTGAAATCTAGGGG 0: 1
1: 0
2: 0
3: 13
4: 133
1002015037_1002015041 3 Left 1002015037 5:176314400-176314422 CCTTTGGTCTATTTCAATATTGT 0: 1
1: 0
2: 3
3: 37
4: 579
Right 1002015041 5:176314426-176314448 AACAACCTTGTGAAATCTAGGGG 0: 1
1: 0
2: 0
3: 13
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002015041 Original CRISPR AACAACCTTGTGAAATCTAG GGG Intronic
902954131 1:19913290-19913312 AACAATCTTGAGAGTTCTAGAGG - Intergenic
910633011 1:89376092-89376114 AACAACCTGGAGGAATCTAGAGG - Intronic
911537830 1:99121882-99121904 AATAACCTTGTGTGCTCTAGAGG + Intergenic
916483301 1:165235107-165235129 CCCAACCTTGAGAAATCTAAGGG - Intronic
918772154 1:188574668-188574690 ATCAACCTTGTGCCATGTAGTGG + Intergenic
919363713 1:196629705-196629727 AATAACATTTTGTAATCTAGTGG - Intergenic
920750312 1:208668627-208668649 AACCACCTTGCAAAAACTAGAGG + Intergenic
923936994 1:238773236-238773258 TACAACCTAGTGAAATACAGAGG + Intergenic
924044840 1:240017841-240017863 AACAACTGTGTGAAATCTTTAGG + Intronic
924381193 1:243466251-243466273 AACAACCTTGTGATGTATATAGG + Intronic
1064659292 10:17590267-17590289 AACAACTTTGTGAAATATCATGG - Exonic
1065675801 10:28173006-28173028 ACCAAACTTGTGATATCTATAGG - Intronic
1066166746 10:32796876-32796898 AATAACCTGGTGAAATTTACTGG + Intronic
1066483440 10:35820675-35820697 AGCAACCTTGTGAAGTACAGAGG + Intergenic
1068038608 10:51793382-51793404 AAAAAACTTGTGAAATTTATGGG + Intronic
1068473715 10:57498028-57498050 CACCACCTTCTGAAATATAGAGG + Intergenic
1072513740 10:96155272-96155294 AACAACCTTGTGAAAGACATAGG + Intronic
1075536873 10:123278766-123278788 AACAACCCTGTGAAATAGATAGG - Intergenic
1076106213 10:127825751-127825773 TACAAACTTGTGAAAGCCAGAGG - Intergenic
1078981735 11:16542803-16542825 AACAAACTTTTGAATTCTAATGG - Intronic
1079743741 11:24099083-24099105 AACACCAATCTGAAATCTAGTGG + Intergenic
1083132763 11:60641315-60641337 ATGATCCTTGTGAAATCAAGAGG + Intergenic
1087508940 11:99065606-99065628 AAGTAACTTTTGAAATCTAGAGG + Intronic
1087793369 11:102430506-102430528 AACAAGCTTGAGCAATCTAAAGG + Intronic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1089705270 11:120273176-120273198 AAGAATCATTTGAAATCTAGAGG + Intronic
1092452585 12:8616755-8616777 AACAACATTGATAAATCTGGAGG - Intergenic
1092568295 12:9693247-9693269 ATCAACCCTGTGAAATCAGGAGG - Intronic
1093071794 12:14713472-14713494 AACATCCTTGTGAAATAAAAGGG + Intergenic
1095821286 12:46481407-46481429 GCCAACCTTGAAAAATCTAGAGG + Intergenic
1097616418 12:61889388-61889410 ATGAACCCTGTTAAATCTAGTGG - Intronic
1097671249 12:62541538-62541560 AACAACTCTGTGAGATTTAGTGG + Intronic
1099947764 12:89264394-89264416 AACTACCTTTTTAAATATAGTGG + Intergenic
1103050518 12:117775485-117775507 AACAATCTTGTGAGATTGAGAGG + Intronic
1103633722 12:122285145-122285167 AACAACCCAGTGAAATATAATGG - Intronic
1104914182 12:132256331-132256353 AACAACGTGGTGAGATGTAGAGG - Intronic
1105892563 13:24691935-24691957 AAGAACCCTTTGAGATCTAGGGG + Intronic
1107804251 13:44139681-44139703 AACAACCTTGTGAAATAAGTGGG - Intergenic
1109994289 13:70103211-70103233 AACAACTTTGTGAGTTCCAGAGG + Intronic
1110290555 13:73801905-73801927 AACAAACTTTTGAAAACTAAAGG - Intronic
1112791491 13:103007366-103007388 AATAACCTTGTGAAATACACAGG + Intergenic
1113043229 13:106126774-106126796 AATAACCTTGTAAAATTTACAGG + Intergenic
1113468496 13:110528569-110528591 CACACTCTTGTGAAATCTGGTGG - Intronic
1117969947 14:61241661-61241683 ATCAACTTGGTGAAACCTAGAGG + Intronic
1120072871 14:80123190-80123212 ACGAATCTTCTGAAATCTAGGGG - Intergenic
1120129607 14:80789566-80789588 AAAATCCTTGAGAAATGTAGGGG + Intronic
1125176070 15:36823255-36823277 AACAACATTATGTAAACTAGAGG - Intergenic
1128633854 15:69290488-69290510 AAGAACCGTGTGAAACCTACTGG + Intergenic
1129816086 15:78555790-78555812 AACAACCTTGTAAACCCTTGAGG + Intergenic
1129935028 15:79440217-79440239 AACAGCCTTGTAAAATATGGGGG - Intronic
1132016406 15:98321059-98321081 AACATCCTTGTGAAAGTTAAAGG - Intergenic
1132223906 15:100125994-100126016 GACAACCTTGTGAAATCTCTAGG + Intronic
1136113108 16:28077421-28077443 AACAAACTTCTAAAACCTAGGGG + Intergenic
1140241512 16:73205222-73205244 AACAACCCTGTGAGATCTCAAGG - Intergenic
1140627344 16:76810250-76810272 AATAACTCTGAGAAATCTAGAGG + Intergenic
1142579185 17:930572-930594 AACAACCTTGACAAAGCTAAAGG + Intronic
1143371164 17:6440343-6440365 AACAAAGTTGTGTAATCTAAGGG + Intergenic
1144805850 17:17966853-17966875 CACAACCTTGTGAGATATACAGG - Intronic
1155288522 18:24317052-24317074 TACAGCCTTGTAAAATCTTGGGG - Intronic
1155643329 18:28046947-28046969 ATTACCTTTGTGAAATCTAGTGG + Intronic
1156220468 18:35046047-35046069 ATCAACCTTCTGAATTCCAGAGG - Intronic
1156762700 18:40612658-40612680 AACAACCATGTCAAATCTTGAGG - Intergenic
1158637607 18:59175333-59175355 AACAAACTTGTGAAATAGAGAGG + Intergenic
1159529037 18:69631823-69631845 AACAGGTTTGTGAAATCTAGAGG - Intronic
1161407975 19:4101107-4101129 AACATCCTCGTGAACTCTAGAGG - Exonic
1164374772 19:27675090-27675112 AACAGCCTTAGGAAATCTAATGG - Intergenic
1167468708 19:49663681-49663703 AAAAGCCTTTTGAAAACTAGAGG - Intronic
929697007 2:44126276-44126298 AACAGCCTTGTGAAATCAATAGG + Intergenic
931123314 2:59245250-59245272 TACAACCTGGTGAAATATAATGG - Intergenic
934232689 2:90199733-90199755 CACAGTCTTGTGAAATCCAGTGG + Intergenic
936382318 2:111997504-111997526 AACAACCTTGTCAATACCAGTGG - Intronic
938272613 2:129988111-129988133 AATAACCCTCTGAAATGTAGTGG - Intergenic
940066170 2:149632524-149632546 AAGAACCTTGTTAACCCTAGAGG - Intergenic
942857224 2:180563634-180563656 AACAACTTTTTAAAATGTAGTGG - Intergenic
942884671 2:180909042-180909064 ATCAACATTGTGGAATCCAGAGG + Intergenic
945717168 2:213372149-213372171 AAAAAGCTTATGAAATCTACTGG + Intronic
948310627 2:236983136-236983158 GCCAACCTTGTGAACTGTAGAGG - Intergenic
1170356786 20:15500989-15501011 AACAACCTTATGAAATCTCTAGG + Intronic
1175211503 20:57360251-57360273 GACAGCCTTATGAAATCTAAGGG - Intronic
1176179664 20:63743287-63743309 AACACCCTTGATAAATCTACGGG - Exonic
1178217669 21:30619270-30619292 AAGAAGCTTGGGAAATTTAGAGG + Intergenic
1178557506 21:33605956-33605978 AACAAACTAGTGCCATCTAGTGG + Intronic
1178605757 21:34035312-34035334 AACAAGTTTGAGAAATCTGGGGG - Intergenic
1178630732 21:34259087-34259109 AACAACAATGTTATATCTAGAGG + Intergenic
1181951344 22:26555995-26556017 AACCATCTGGTGAAATCTATGGG + Intronic
1182382933 22:29908116-29908138 AACAACCTTGTAAAACCTGGGGG + Intronic
950915346 3:16638927-16638949 CCCACCCTTGTGGAATCTAGTGG + Intronic
952250829 3:31651903-31651925 AACAAACTGGAAAAATCTAGAGG + Intergenic
952843669 3:37668950-37668972 AACAAGCTCATAAAATCTAGAGG - Intronic
955040197 3:55309100-55309122 AACAACCTAGTGCTATCTAGGGG + Intergenic
956095313 3:65710104-65710126 AAAAGGCTTGTGAAATCTTGGGG - Intronic
956928308 3:74013858-74013880 AACAACTTTGAGAAATAAAGAGG - Intergenic
960873965 3:122278102-122278124 AACAACTTTGTGAAATACATAGG - Intronic
963030186 3:140963255-140963277 AAAAACTTTCTGAAACCTAGAGG + Intronic
967618452 3:191602521-191602543 AATAAACTTGTGAGATCTAAGGG + Intergenic
971528054 4:27647122-27647144 AACAACATTGAGACATCAAGTGG - Intergenic
974067424 4:57092111-57092133 AAAAACTTTGTGAAATTTGGAGG - Intronic
976663933 4:87570289-87570311 ATCAGCCATGTGAAATGTAGTGG - Intergenic
977085612 4:92593958-92593980 AAAAACCTTGAGAATTATAGGGG + Intronic
978015525 4:103740451-103740473 AACAACCATGTGCAATGTATGGG + Intergenic
981490022 4:145329320-145329342 AACAACCTTGGAACATCCAGAGG + Intergenic
982176491 4:152710046-152710068 AAAGACCTTGCCAAATCTAGAGG + Intronic
983859407 4:172686570-172686592 AAGAAACTTGAGAAAACTAGAGG + Intronic
984162302 4:176268194-176268216 TACAACCTTCTGAAGTCTATGGG + Intronic
988370013 5:30356524-30356546 AACATCATTGAGAAATGTAGGGG - Intergenic
996932434 5:128906104-128906126 AAAAGCAATGTGAAATCTAGGGG - Intronic
997388637 5:133495704-133495726 GGCAACCTTGTGTAAACTAGTGG + Intronic
1001442385 5:171753772-171753794 AAAAACCTTGTCAAATAGAGAGG + Intergenic
1002015041 5:176314426-176314448 AACAACCTTGTGAAATCTAGGGG + Intronic
1002580172 5:180204024-180204046 AACAACAAAGTGAAATCTGGGGG + Intronic
1004479344 6:16003970-16003992 AACAGCCCTGTGAAATCGTGTGG - Intergenic
1006873843 6:37278172-37278194 AACAATCTTATTAAATCCAGAGG + Intronic
1016946818 6:149542674-149542696 AACAATCTTTTGAACTCTTGTGG - Intronic
1017307376 6:152934803-152934825 AATAGCCTTTTGAAATCTAGGGG - Intergenic
1017737359 6:157377628-157377650 AACAACCTGGAAAATTCTAGGGG - Intergenic
1020715576 7:11670982-11671004 ACCAAACTTGTGAAATCTTATGG - Intronic
1021829248 7:24587087-24587109 AACAACTTGCTCAAATCTAGGGG - Intronic
1022030715 7:26489724-26489746 AAGAACCTTGAGACAACTAGTGG + Intergenic
1022152679 7:27624826-27624848 AACAACCATGTGAAATAGACAGG - Intronic
1026540211 7:71273607-71273629 AATAACCTTGTGATGTCTATAGG - Intronic
1027937125 7:84621225-84621247 AGCAACCTTGTGAAATCACATGG + Intergenic
1031951723 7:127899611-127899633 AACCAGCTTGTGAAATCAAGTGG - Intronic
1032117183 7:129127109-129127131 AACATCCTCGTGAACTCTAGAGG + Intergenic
1033007487 7:137582976-137582998 AACATACTTTTGAAATCTTGAGG - Intronic
1035709767 8:1703851-1703873 ACCAACCCTGTGCAATGTAGTGG - Exonic
1036274211 8:7336119-7336141 AAAAACCTTGAGAAATCCAAAGG - Intergenic
1036347138 8:7974229-7974251 AAAAACCTTGAGAAATCCAAAGG + Intergenic
1036842454 8:12135006-12135028 AAAAACCTTGAGAAATCCAAAGG + Intergenic
1037407785 8:18562404-18562426 AACAGCCTTCTGAAATCCAAAGG + Intronic
1041135447 8:54753316-54753338 GACAGCCTTGTGAAAGCTTGTGG + Intergenic
1043662995 8:82769526-82769548 AACAACCTTATGTAATATTGGGG - Intergenic
1045426270 8:102068600-102068622 AACAGACTGGTGGAATCTAGAGG - Intronic
1051159704 9:14192987-14193009 AACAAACACGTGAAATCTATTGG - Intronic
1051413743 9:16817336-16817358 GACAACTTTGTAAAATCTAAAGG + Intronic
1188460320 X:30418383-30418405 AACATCATTGTGAAATATATTGG - Intergenic
1189457501 X:41206598-41206620 AAACACCTTATGAGATCTAGAGG + Intronic
1189504789 X:41601587-41601609 AATGGCCCTGTGAAATCTAGTGG + Intronic
1190104492 X:47549632-47549654 AAAAATGTTGTGTAATCTAGAGG + Intergenic
1191011584 X:55765181-55765203 AACAATCTTGTGAAATGGATAGG + Intergenic
1191601364 X:63012985-63013007 ACCAAGCTTGTGAAATGTGGTGG - Intergenic
1191938156 X:66448023-66448045 AACTACCTTATGAAGTCTAAGGG - Intergenic
1193584552 X:83304787-83304809 AACAACGTGGATAAATCTAGAGG + Intergenic
1194619661 X:96154720-96154742 AATAATCTTGTTAAATCTACTGG - Intergenic
1196583893 X:117407957-117407979 AACAACATTGTGTGATGTAGGGG - Intergenic
1198202032 X:134431359-134431381 AAAAAAATTGAGAAATCTAGAGG - Intergenic
1199112129 X:143947302-143947324 ATACATCTTGTGAAATCTAGGGG - Intergenic
1199457558 X:148045373-148045395 AACAACCTTGTGACTTTTTGGGG + Intergenic