ID: 1002015989

View in Genome Browser
Species Human (GRCh38)
Location 5:176323232-176323254
Sequence GCATTTGGACAGATTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 376}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002015989 Original CRISPR GCATTTGGACAGATTGAGGA AGG Intronic
901450579 1:9334330-9334352 GCACTTTGACAGGTTGAGGCGGG - Intronic
901942127 1:12670785-12670807 GCATTTTGGGAGACTGAGGAGGG - Intergenic
902140321 1:14348296-14348318 GCATTTGGAGAGGCTGGGGAGGG - Intergenic
902902198 1:19525581-19525603 GCATTTTGGGAGATTGAGGCAGG - Intergenic
902942022 1:19807407-19807429 GCATTTTGAGAGACTGAGGCGGG + Intergenic
903271372 1:22190452-22190474 GCATCTGGGCAGATGGAGGACGG + Intergenic
904378213 1:30094951-30094973 GCATTTGAACAGAAACAGGAGGG - Intergenic
905476901 1:38235390-38235412 GCATTTGGCAAGATTAAAGAGGG + Intergenic
905934418 1:41812323-41812345 GCATTTGGGGAGGCTGAGGAGGG + Intronic
906036887 1:42756227-42756249 GCATTTGGACAGATAAAGCCGGG + Intronic
906078861 1:43070464-43070486 GCATTTTGACATATGGAGGTGGG + Intergenic
906172637 1:43740537-43740559 GCACTTTGAGAGACTGAGGAGGG + Intronic
906998075 1:50819366-50819388 GCACTTTGGGAGATTGAGGAAGG + Intronic
907358064 1:53892675-53892697 GCATTTTGAGAGATCAAGGAAGG + Intronic
907464326 1:54624834-54624856 GCACTGGGACAAAGTGAGGATGG + Intronic
907628749 1:56058612-56058634 GCATTTGGGGAGAGTGAGGAGGG + Intergenic
909181654 1:72431689-72431711 GCATATGGATATATTTAGGAGGG + Intergenic
909731481 1:78896982-78897004 GCATTTAAACAGAGTGATGAGGG - Intronic
910246387 1:85143081-85143103 GCATTTGGACAGGTCAAGGCAGG - Intergenic
910526236 1:88181860-88181882 GCATTTGGCTAAATTGAGTATGG + Intergenic
910900865 1:92119530-92119552 GCACTTGGGGAGATTGAGGCAGG - Intronic
915394211 1:155569681-155569703 GCACTTTGGGAGATTGAGGAGGG - Intergenic
915981123 1:160420476-160420498 GGACTTGGGCAGGTTGAGGAGGG - Exonic
916036232 1:160924804-160924826 GCACTTTGACAGACTGAGGCAGG + Intergenic
917150662 1:171941233-171941255 GCATATGTTCAAATTGAGGATGG + Intronic
917780928 1:178396171-178396193 GAATTACCACAGATTGAGGAGGG - Intronic
919206745 1:194427896-194427918 GCATTTTGGGAGATTGAGGCAGG + Intergenic
919830409 1:201536898-201536920 GCATATGGACAGGTTGAGGGAGG - Intergenic
920109494 1:203577096-203577118 GCATCTGGAAAGATACAGGAGGG + Intergenic
922451552 1:225741757-225741779 GCATTTTGAGAGACTGAGGTAGG + Intergenic
922506038 1:226126223-226126245 GCATTTTGGAAGATTGAGGTGGG + Intergenic
922535126 1:226373869-226373891 GCATTTGGGGAGACTGAGGTGGG + Intronic
923215303 1:231843407-231843429 GCACTTGGACAGATTTAAGCAGG + Intronic
923648786 1:235852163-235852185 ACATTGGGACAGCTTCAGGAAGG + Intronic
923706686 1:236349863-236349885 GCATTTTGGAAGATTGAGGCAGG + Intronic
924123874 1:240829683-240829705 GCATTTGGAGAGGCTGAGGTGGG + Intronic
924515773 1:244764501-244764523 GCACTTTGACAGGCTGAGGAGGG - Intergenic
924939934 1:248806092-248806114 GCAGTTTGACAGTTTGAGAAGGG + Intergenic
1064226033 10:13486123-13486145 GCATTTTGGCAGGCTGAGGAGGG - Intronic
1064919710 10:20503237-20503259 GCATTTGGGCAGATATAGGCAGG + Intergenic
1065305067 10:24360577-24360599 GCATTTGGAGAGGATGAAGATGG + Intronic
1065779011 10:29149466-29149488 GCATTTTGGGAGACTGAGGAGGG - Intergenic
1065892396 10:30132301-30132323 GCACTTTGAGAGGTTGAGGAGGG + Intergenic
1067578341 10:47421590-47421612 TCACTTGAAAAGATTGAGGATGG + Intergenic
1068982795 10:63079020-63079042 GCATTTGGGGAGGTTGAGGCAGG + Intergenic
1069510048 10:69035412-69035434 GCATTTTGAGAGGTTGAGGCAGG + Intergenic
1069980206 10:72247255-72247277 GCATTTTGGTAGACTGAGGAGGG - Intergenic
1069999904 10:72368508-72368530 GCAGTTGGAAATATCGAGGAAGG - Intronic
1070007849 10:72442632-72442654 GCATTTGTACAAATAGATGAAGG - Intronic
1070359437 10:75672816-75672838 GCACTTTGAGAGATTGAGGTGGG - Intronic
1072828097 10:98628801-98628823 TCATGTGGACATATTGAGGGAGG + Intronic
1073221353 10:101876959-101876981 GCATTTGGATAGGCTGAGGTGGG + Intronic
1073803887 10:107074103-107074125 GCATTTGGACAAATTTATAATGG + Intronic
1074272491 10:111968484-111968506 AGATTTGGAAAGATTGAAGAGGG - Intergenic
1075855286 10:125624634-125624656 GTATTTGGTCATCTTGAGGAAGG - Intronic
1076554804 10:131314167-131314189 TCATTTGTACATCTTGAGGATGG + Intergenic
1076655583 10:132021558-132021580 CCAATGGGATAGATTGAGGAGGG - Intergenic
1078117796 11:8472173-8472195 GCATTTTGAAAGGCTGAGGAAGG - Intronic
1078208151 11:9248227-9248249 GCATTTTGGGAGACTGAGGAAGG - Intronic
1078357944 11:10646859-10646881 GGACATGGACACATTGAGGAAGG - Intronic
1081021837 11:37957506-37957528 CCAGTTGGAGAGATTGAGTAAGG - Intergenic
1081603692 11:44513297-44513319 GCATTGGGGGAGAGTGAGGAGGG + Intergenic
1084843488 11:71878746-71878768 GCATTTGGGGAGTTTGAGGTGGG + Intronic
1085689707 11:78655135-78655157 GCAGGAGGACAGCTTGAGGAGGG + Exonic
1085947964 11:81295129-81295151 CCATTTGGAGAAATTGAGAAAGG + Intergenic
1086907737 11:92436386-92436408 GCATTTTGAAAGACTGAGGCAGG - Intronic
1087051348 11:93889312-93889334 GCATTTTGAGAGGATGAGGAGGG - Intergenic
1087296154 11:96376672-96376694 GCATTTTGGGAGACTGAGGAGGG - Intronic
1087838536 11:102898809-102898831 GCATTTGGGGAGACTGAGGCAGG + Intergenic
1088119447 11:106350950-106350972 GCATTGGTACAGTTTGATGATGG + Intergenic
1089010009 11:115124446-115124468 GGGTTTGGGAAGATTGAGGAGGG + Intergenic
1089826162 11:121280232-121280254 GCAGTTTGGGAGATTGAGGAGGG - Intergenic
1090062169 11:123473517-123473539 GCATTTTGGGAGGTTGAGGAAGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091760197 12:3082246-3082268 GCATTTCAACAGAAGGAGGAAGG + Intronic
1092070533 12:5627844-5627866 GCATTTGGAGAGGCTGAGGCAGG + Intronic
1092725169 12:11477854-11477876 GCATTTTGGGAGATTGAGGCAGG - Intronic
1093783614 12:23166822-23166844 CTATTTAGAAAGATTGAGGAAGG + Intergenic
1094267098 12:28571696-28571718 CCATTTGGACAAGTGGAGGAGGG + Intronic
1094727503 12:33135311-33135333 GCATTTGGATAGCTTGAGCCTGG - Intergenic
1095262493 12:40112831-40112853 GCTTTTGGATATATTGAGGTTGG - Intergenic
1095424185 12:42057393-42057415 GCTTTTAGTCAGATGGAGGAGGG + Intergenic
1095885175 12:47181229-47181251 GCATTTTGAGAGACTGAGGTGGG - Intronic
1095907139 12:47390073-47390095 GCATTTGGAGAGGCTGAGGCGGG - Intergenic
1098880518 12:75912746-75912768 GCATTTGGGGAGACTGAGGCAGG - Intergenic
1101998517 12:109542013-109542035 GCACTTGGACAGATTGTTCAGGG + Intergenic
1102694780 12:114790331-114790353 GCACTTTGACAGGTTGAGGCAGG - Intergenic
1103461023 12:121105367-121105389 GCATTTTGATAGACTGAGGCAGG + Intergenic
1103741508 12:123094646-123094668 GCATCTGTGCAGATGGAGGACGG - Intronic
1104583601 12:130029444-130029466 GCTGTTGGAAAGAGTGAGGAGGG - Intergenic
1105954504 13:25268121-25268143 GTATGTGGACTGATGGAGGAGGG - Intronic
1107012617 13:35683331-35683353 GCATTTTGAGAGGCTGAGGAGGG - Intergenic
1107878510 13:44812213-44812235 GCATTTTGACAGGCTGAGGTGGG - Intergenic
1108156324 13:47589010-47589032 GCATTTTGGGAGACTGAGGAAGG + Intergenic
1108372456 13:49784004-49784026 GCATTTTGGGAGATTGAGGAGGG + Intronic
1108415152 13:50190552-50190574 GCATTTTGAGAGGTTGAGGCAGG - Intronic
1110113048 13:71775036-71775058 GCACTTTGAGAGATGGAGGAAGG + Intronic
1110398206 13:75057403-75057425 GCATTTTGGGAGATTGAGGTGGG + Intergenic
1110441960 13:75536385-75536407 GCATGTGGACATATTTGGGAGGG - Intronic
1112023946 13:95395459-95395481 GCTTTGGGAGAGATGGAGGAGGG + Intergenic
1112498574 13:99924972-99924994 GCATTTTGAGAGACTGAGGTGGG - Intergenic
1112706890 13:102080445-102080467 GTATTTGGAGGAATTGAGGATGG - Intronic
1113036695 13:106057521-106057543 GCATTTGGGGAGGCTGAGGAGGG + Intergenic
1114827857 14:26103519-26103541 GCATTTGAACAGTTTGTGAATGG + Intergenic
1115328504 14:32168358-32168380 GCATTTGGAGAGACTAGGGATGG + Intergenic
1115514501 14:34172029-34172051 GCATTTGTATAGATTGTTGAGGG + Intronic
1115588307 14:34837483-34837505 GCACTTGGAGAGACTGAGGCAGG - Intronic
1116000368 14:39236819-39236841 GCATTTGGAAACATATAGGATGG + Intronic
1117694585 14:58346679-58346701 GCATTTTGGGAGATTGAGGCGGG + Intronic
1117844982 14:59901413-59901435 GCATTTGAAGATATTTAGGAAGG + Intergenic
1118656264 14:67953237-67953259 GAATTTGGACAGATTAAGATGGG + Intronic
1118903771 14:70008383-70008405 GCATTTGGAAAGGCTGAGGCAGG - Intronic
1118993241 14:70814462-70814484 GCATTTGAAGAGATGGAGGCAGG - Intergenic
1119482639 14:74968168-74968190 GCATTTTGAGAGACTGAGGTGGG + Intergenic
1119672933 14:76533335-76533357 GCATTGGGCCAGGTTGAAGAGGG + Intergenic
1120123384 14:80710673-80710695 CCATTTGGACAGGTTGATGTAGG - Intronic
1120465356 14:84849557-84849579 GCACTTGGACTGTTTGAAGAAGG - Intergenic
1120489268 14:85155963-85155985 TCATTTTGTCAGATTGAGGAAGG - Intergenic
1121287021 14:92743907-92743929 GCACTTGGAAAGGTTGAGGTGGG + Intronic
1121638493 14:95469813-95469835 CCATTTGCACACATTGGGGAAGG - Intronic
1122100108 14:99401802-99401824 CAACTTGGGCAGATTGAGGAAGG - Intronic
1202831842 14_GL000009v2_random:43012-43034 GCATGCAGACACATTGAGGAGGG + Intergenic
1123993947 15:25705192-25705214 GCACTTAGACAGACTGAGGCAGG + Intronic
1124423338 15:29541150-29541172 GCATTTGGACATAATGTGGATGG + Intronic
1124715793 15:32060370-32060392 GCATATGGACTGATTTATGAAGG + Intronic
1125951371 15:43755077-43755099 GCACTTTGACAGGCTGAGGAGGG + Intronic
1126404525 15:48310192-48310214 GCATTTGGGGAGGTTGAGGTGGG - Intergenic
1126619177 15:50619466-50619488 GCATTTCGGCAGGTTGAGGCTGG - Intronic
1126641110 15:50828024-50828046 GCATTAGGATTGATTGAGGGAGG - Intergenic
1128666446 15:69541658-69541680 GCACTTGGAGAGATCGAGGCAGG - Intergenic
1129195410 15:73962157-73962179 GCATTTTGGGAGATTGAGGCAGG - Intergenic
1130615236 15:85400151-85400173 GCATTTTGAGAGGTTGAGGTGGG + Intronic
1131484693 15:92809918-92809940 GCATTTGGACAGGGCGGGGAAGG - Intergenic
1131707370 15:95012765-95012787 GCATTTGGGGAGACTGAGGTGGG + Intergenic
1131901724 15:97095059-97095081 GCTTTTGGACATATTGAGGCAGG + Intergenic
1132010912 15:98276080-98276102 GCTTTTGGACAGATTGAACCTGG - Intergenic
1132821680 16:1875741-1875763 GCATTTTGACAGACTGAGGCGGG + Intronic
1133860668 16:9592002-9592024 GCATCTGGACAAGTTGATGAGGG + Intergenic
1134309553 16:13063250-13063272 GCATTTGGGGAGACTGAGGTGGG - Intronic
1134790063 16:16981703-16981725 GCATTTTGGGAGACTGAGGAGGG + Intergenic
1134901083 16:17938639-17938661 GCAATTCCACAGATTAAGGAGGG - Intergenic
1135349563 16:21717188-21717210 GAATTTGGACAGGCTGAGGCAGG + Intronic
1135525200 16:23208846-23208868 GCATTTTGGGAGACTGAGGAGGG - Intronic
1135827043 16:25738148-25738170 GCATTTGGGCAGGCCGAGGAGGG - Intronic
1136149955 16:28340878-28340900 GCATTTGGAGAGGCTGAGGTAGG + Intergenic
1136166189 16:28454682-28454704 GCATTTGGAGAGGCTGAGGTAGG + Intergenic
1136196782 16:28660338-28660360 GCATTTGGAGAGGCTGAGGTAGG - Intergenic
1136213122 16:28774461-28774483 GCATTTGGAGAGGCTGAGGTAGG - Intergenic
1136459713 16:30402132-30402154 GCATTTTGAGAGGTTGAGGCAGG + Intergenic
1137622837 16:49887630-49887652 GCATTTTGGCAGAGTGAGGAGGG + Intergenic
1137845871 16:51687449-51687471 GGATTTGGGGAGGTTGAGGAGGG + Intergenic
1138725658 16:59135998-59136020 GCATTTGGAGAGGCTGAGGTGGG + Intergenic
1139485424 16:67253767-67253789 GCACTTTGACAGGTTGAGGTGGG - Intronic
1140345998 16:74213641-74213663 GCACTTTGACAGGTTGAGGTAGG + Intergenic
1141775913 16:86122430-86122452 GGATTCGGACAGAGTAAGGAGGG - Intergenic
1142641380 17:1287982-1288004 GCCTGTGGACAGAGTGGGGAGGG - Intronic
1143006481 17:3838570-3838592 CCATTAGGACTGACTGAGGAGGG + Intronic
1144730438 17:17522917-17522939 GCACTTGGGCAGAGGGAGGAGGG - Intronic
1148481696 17:47963837-47963859 GCATTTTGGGAGGTTGAGGAAGG - Intergenic
1149903241 17:60501375-60501397 GCATTTGGTGACATTGAGGCGGG - Intronic
1150580463 17:66469116-66469138 GAATGTGGACAGAAAGAGGAAGG - Intronic
1150729156 17:67676892-67676914 GCATTTGGACAAACCCAGGAAGG - Intronic
1153873084 18:9338950-9338972 GCACTTTGAGAGATTGAGGCAGG + Intronic
1155068094 18:22286038-22286060 GAATTTTAAAAGATTGAGGAGGG + Intergenic
1155470557 18:26187390-26187412 GCATTTGGGGAGACTGAGGCAGG + Intronic
1155890008 18:31255818-31255840 GCCTTTGGACAGATTAATAAGGG - Intergenic
1157633406 18:49124256-49124278 GCATTTGGGGAGACTGAGGCAGG + Intronic
1157715431 18:49882381-49882403 GCATTTTGAGAGACTGAGGTGGG + Intronic
1157893502 18:51441698-51441720 GCATTTGGACAAAGTTATGAGGG - Intergenic
1161375021 19:3935129-3935151 GCATTTGGAGAGGCTGAGGCAGG - Intronic
1163088097 19:14997513-14997535 GCATTGGGGCAGATTAAGGCGGG + Intronic
1163953539 19:20613119-20613141 GCATTTGCACAGCTTGAGCATGG - Intronic
1164272255 19:23683664-23683686 GCATTTTGAAAGACTGAGGTGGG - Intronic
1165179783 19:33957708-33957730 GCATTTGGGGAGGCTGAGGAAGG - Intergenic
1166160186 19:40946910-40946932 GCACTTTGAGAGACTGAGGAAGG - Intergenic
1166692611 19:44832650-44832672 GCACTTTGGCAGATTGAGGCAGG - Intergenic
1166973053 19:46583258-46583280 GCATTTTGAGAGGCTGAGGAAGG + Intronic
1168399120 19:56073613-56073635 GCACTTGGAGAGACTGAGGCAGG + Intergenic
1202640846 1_KI270706v1_random:84740-84762 GCATGCAGACACATTGAGGAGGG - Intergenic
925191929 2:1892094-1892116 GCGCGTGGACAGGTTGAGGATGG + Exonic
925568040 2:5277863-5277885 GAATTTGTCCAGATGGAGGAAGG - Intergenic
927173165 2:20387339-20387361 GCATTTGGGGAGGTTGAGGTGGG - Intergenic
927350612 2:22108678-22108700 GCATTTTGAGAGACTGAGGTGGG + Intergenic
929194542 2:39171840-39171862 GTATTTGGACAGCATCAGGAAGG + Intergenic
929585121 2:43108813-43108835 GCATTTTGGGAGACTGAGGAAGG + Intergenic
929593617 2:43162279-43162301 GCATCGGGACAGAATGAGGTGGG + Intergenic
932479560 2:72031078-72031100 GCATTGGTAAAGAGTGAGGATGG + Intergenic
933829797 2:86197698-86197720 GCATTTTGGCAGACTGAGGTGGG + Intergenic
935140353 2:100347970-100347992 GCATTGTGAGAGACTGAGGAGGG + Intergenic
936828512 2:116610978-116611000 GCATTTGGAAAGCCTGAGGTTGG - Intergenic
937242985 2:120474450-120474472 TCATTTGGAGAGACTGGGGAAGG - Intergenic
938660337 2:133480242-133480264 GAATTTGGATAAATAGAGGATGG + Intronic
938779509 2:134572618-134572640 GCATTTAGACCTATTGATGATGG - Intronic
939331828 2:140773216-140773238 ACATTTTGAGAGACTGAGGAGGG + Intronic
939541746 2:143502824-143502846 GCATTTGGGGAGGTTGAGGTGGG - Intronic
940651607 2:156446340-156446362 GCACTTGGAGAGGTTGAGGCGGG - Intronic
940974859 2:159931281-159931303 GCACTTTGACAGGGTGAGGAGGG + Intergenic
942072230 2:172326341-172326363 GCACTTTGAGAGGTTGAGGAGGG + Intergenic
942301094 2:174563323-174563345 GCACTTTGAGAGGTTGAGGAGGG + Intronic
942472996 2:176281917-176281939 TCATATGGAAAGATTGAGGATGG + Intronic
943371408 2:187021161-187021183 GCATTTGGAGAGGCCGAGGAAGG + Intergenic
944807417 2:203296014-203296036 GCACTTCGAGAGATTGAGGCAGG + Intronic
945039436 2:205731733-205731755 GCTATTGGCCAGATCGAGGATGG + Intronic
945080276 2:206081504-206081526 GCACTTGGAAAGACTGAGGCAGG + Intronic
945856344 2:215073689-215073711 GCATCTGTTCTGATTGAGGAGGG + Intronic
946836345 2:223776430-223776452 GGAGTTTGACAAATTGAGGAGGG - Intronic
947262189 2:228235730-228235752 ACATTTGGACAGCTTTAGTAAGG + Intergenic
947504153 2:230694158-230694180 GCATTTTGGGAGATTGAGAAGGG - Intergenic
947622037 2:231597065-231597087 GCATTTTGGGAGACTGAGGAGGG - Intergenic
1169223539 20:3841457-3841479 GCATTTTGGCAGATTGAAGCAGG - Intergenic
1169466550 20:5846205-5846227 TGATTTGGACAGATTGTGGGAGG + Intronic
1170069258 20:12346076-12346098 GCACTTTGAGAGACTGAGGAGGG - Intergenic
1170682484 20:18538957-18538979 GCATTTTGGGAGATTGAGGCAGG + Intronic
1172636497 20:36413663-36413685 GCATTTTGGGAGATCGAGGAGGG - Intronic
1173863330 20:46298140-46298162 GCAGCTAGACAGATTGAGGTTGG - Intronic
1174232661 20:49059306-49059328 GAATCTGGTCAGATTCAGGAAGG - Intronic
1175072091 20:56343443-56343465 GCTTTGGGATACATTGAGGAGGG - Intergenic
1178954893 21:37013052-37013074 GCATTTTGGGAGATTGAGGCGGG - Intronic
1180361106 22:11897122-11897144 GCATGCAGACACATTGAGGAGGG + Intergenic
1182403825 22:30106528-30106550 ATATTTGGACAGATTGAGAGGGG + Intronic
1183669657 22:39264911-39264933 AGATTTGGTCAGATGGAGGAGGG - Intergenic
949262733 3:2121161-2121183 GCATTTGGTAAGAGGGAGGAAGG - Intronic
949549035 3:5096974-5096996 GCATTTTGAGAGACTGAGGCTGG + Intergenic
950251445 3:11468932-11468954 GTGTGTGGGCAGATTGAGGATGG + Intronic
950453100 3:13076509-13076531 GCATTTGGGAAGAGGGAGGACGG + Intergenic
950745117 3:15081900-15081922 GCATTTGGACAAACTTAGAAGGG + Intronic
950769113 3:15296941-15296963 GCATTTTGGGAGATTGAGGTGGG - Intronic
951752278 3:26050246-26050268 CCATTTGGACAGATTCATGCTGG + Intergenic
954640767 3:52096495-52096517 GCATTTGGACCGTTTGAAGTTGG - Intronic
955370650 3:58348662-58348684 GCACTTTGGCAGGTTGAGGAGGG + Intronic
955624102 3:60898333-60898355 GCATTTGAACAAATTCATGAAGG - Intronic
956189372 3:66594156-66594178 GCTTTTAGAAAGAATGAGGAAGG + Intergenic
960139370 3:114137598-114137620 GCACTTGGAGAGGTTGAGGTGGG + Intronic
960532453 3:118780344-118780366 CCAATTGGACATATTTAGGAGGG - Intergenic
960536346 3:118818699-118818721 GATTTTGGACAGTTTGGGGATGG - Intergenic
961173056 3:124812822-124812844 GTATTTGGCCAGGCTGAGGAGGG - Intronic
962067576 3:131998073-131998095 GCATTTAGCTAGATTGAGAAAGG + Intronic
963428232 3:145160062-145160084 GCAAGTGAAGAGATTGAGGACGG - Intergenic
966388485 3:179427155-179427177 ACATTTGGGCAGATTTAGTAAGG - Intronic
966698161 3:182814559-182814581 GCACTTTGGGAGATTGAGGAAGG + Intronic
966859541 3:184222187-184222209 GCATTTGGAAAGGCTGAGGCAGG + Intronic
966866846 3:184262850-184262872 TAATTTGGCCAGATTAAGGAAGG - Intronic
967344811 3:188443047-188443069 ACATGTGGACAGGTTGATGAAGG + Intronic
968238234 3:197051125-197051147 GCATTTTGACAGGCTGAGGCAGG + Intronic
968384950 4:127507-127529 GCATTTGGGCAAAGGGAGGAGGG - Intronic
968463195 4:736292-736314 GCATTTGGGGAGACTGAGGCGGG - Intronic
968496464 4:920063-920085 GCACTTTGGCAGACTGAGGAGGG + Intronic
968990393 4:3907341-3907363 GCATTTGGGGAGGTTGAGGCAGG - Intergenic
969716167 4:8869299-8869321 GCACTTGCCCAGATTGAAGAGGG + Intronic
969720424 4:8890497-8890519 GCATTTTCACAAATTGAGGTAGG + Intergenic
970098163 4:12488438-12488460 GCATTTTGAGAGACTGAGGCAGG + Intergenic
970421113 4:15906287-15906309 GAATTTGGAAAGAATGAGAAAGG + Intergenic
970848591 4:20574198-20574220 GCACTTGGGGAGATTGAGGCGGG - Intronic
971370361 4:26014300-26014322 GCATAAATACAGATTGAGGAAGG - Intergenic
971385511 4:26137777-26137799 GTATTTTGACAGATGGAGGGAGG - Intergenic
971547929 4:27910699-27910721 GCATCAGGACAGACTGATGAAGG + Intergenic
971600564 4:28586255-28586277 GCATGTTTAAAGATTGAGGAAGG - Intergenic
972276488 4:37562968-37562990 GCACTTGGAAAGACTGAGCACGG - Intronic
973145987 4:46826860-46826882 GCATGTGGAGGGATGGAGGAGGG + Intronic
973384362 4:49495271-49495293 GCATGCAGACACATTGAGGAGGG - Intergenic
973628407 4:52795200-52795222 GCATTTTGACAGGCTGAGGTGGG + Intergenic
974362978 4:60907007-60907029 TCATTTGGAAAGATGGAGGAAGG + Intergenic
975204730 4:71631700-71631722 GCATTTTGAGAGGCTGAGGAGGG + Intergenic
976995940 4:91433999-91434021 GCATTGAGACCGCTTGAGGAAGG + Intronic
977480635 4:97570458-97570480 GCTTTTAGGCAAATTGAGGACGG - Intronic
977782507 4:100995724-100995746 GAAATTGGACAGGTTGGGGAGGG + Intergenic
978034118 4:103973573-103973595 ACATTTGAACACATTGTGGAAGG + Intergenic
978724642 4:111955956-111955978 GGATTTTGAGAGCTTGAGGAGGG - Intergenic
979350608 4:119640530-119640552 GTATTTGAACAGATGGAGAAAGG - Intergenic
979478456 4:121185976-121185998 TCATTTGGACAGAGTGGTGAAGG + Intronic
981585260 4:146294333-146294355 GCATTTGGCATGATTAAGGATGG - Intronic
982448011 4:155517237-155517259 GCATTTTGGGAGATTGAGGCAGG - Intergenic
984184051 4:176520714-176520736 GCACTTTGACAGATTAAGGCAGG + Intergenic
984206914 4:176796102-176796124 GCATTTGGGGAGGCTGAGGAAGG + Intergenic
984281626 4:177677894-177677916 GCATTTGGGGAGACTGAGGCAGG - Intergenic
1202768213 4_GL000008v2_random:170595-170617 GCATGCAGACACATTGAGGAGGG - Intergenic
986160396 5:5222405-5222427 AGACTTGGACAGATTCAGGAAGG + Intronic
986451047 5:7865951-7865973 TCATTTGGACACATTGAGTCGGG - Exonic
986526547 5:8684827-8684849 GCACTTTGACAGGCTGAGGAGGG + Intergenic
987041153 5:14064135-14064157 GCATTTCGAGAGACTGAGGCAGG + Intergenic
987457270 5:18163115-18163137 GCATTTTGAGAGACTGAGGTGGG + Intergenic
988093712 5:26574594-26574616 GCATTTGGGGAGGCTGAGGAGGG + Intergenic
988411680 5:30894035-30894057 GCATTTTGGGAGACTGAGGAGGG + Intergenic
990130114 5:52571180-52571202 GCATTTTGATAGGTGGAGGATGG + Intergenic
990570223 5:57071036-57071058 GCTTTTAGGCAGATGGAGGAAGG + Intergenic
991592801 5:68272002-68272024 GCATTTTGAGAGATTGAGGTGGG + Intronic
991923651 5:71682859-71682881 GCATTTTGGGAGATTGAGGCAGG + Intergenic
992446317 5:76837448-76837470 GCATTTTGAGAGGCTGAGGAGGG - Intergenic
993826280 5:92690932-92690954 GCATTTTGGGAGATTGAGGCTGG + Intergenic
994431359 5:99666050-99666072 GGATTTGGGCAGATTGAGGTTGG + Intergenic
995626372 5:114081475-114081497 TCATTTGAACATATTTAGGAGGG - Intergenic
996239492 5:121178154-121178176 GCATTTTGGCAGACTGAGGCAGG + Intergenic
996732314 5:126727898-126727920 GCATTTAGACAGACAGAGGTTGG - Intergenic
996908152 5:128625515-128625537 GCATTTGGGGAGGTTGAGGTGGG + Intronic
997022766 5:130020808-130020830 GCATCTCGACAGACTGAGTAGGG - Intronic
997407271 5:133660774-133660796 TAATTTTGATAGATTGAGGAAGG + Intergenic
998638851 5:143986928-143986950 GTTATTGTACAGATTGAGGAAGG - Intergenic
998801072 5:145869801-145869823 GCACTTGGGGAGACTGAGGAGGG - Intronic
999110564 5:149116982-149117004 GCATTTTGAGAGACTGAGGCGGG + Intergenic
999385262 5:151149728-151149750 GCACTTTGAGAGACTGAGGAGGG - Intronic
999692995 5:154165111-154165133 GCACTTTGAGAGGTTGAGGAGGG - Intronic
1000083018 5:157865121-157865143 GCACTTTGAGAGATTGAGGTGGG + Intergenic
1000114438 5:158139969-158139991 GCATTTTGGGAGATGGAGGAGGG - Intergenic
1002015989 5:176323232-176323254 GCATTTGGACAGATTGAGGAAGG + Intronic
1002144930 5:177172710-177172732 GCATTTTGAGAGGTTGAGGTGGG + Intronic
1002288428 5:178181165-178181187 GCACTTTGACAGACTGAGGTGGG - Intergenic
1003632822 6:7803246-7803268 GCAGTGGGACAGGTTGGGGAGGG + Intronic
1004771118 6:18783475-18783497 GCATTTGGAGAGATTGATGGAGG - Intergenic
1005010629 6:21332138-21332160 GCATTGGGGCAGATTAAAGAGGG - Intergenic
1005095411 6:22109661-22109683 GCTTGAGGAGAGATTGAGGATGG + Intergenic
1005395680 6:25379453-25379475 GAATTTGGATAGATGGAAGAAGG + Intronic
1005773917 6:29108232-29108254 GAATGTGGACAGATACAGGAAGG + Intergenic
1006898083 6:37483432-37483454 GGATTTGGGCAGATTAAGAAGGG - Intronic
1008745954 6:54669715-54669737 GCACTTTGAGAGGTTGAGGAGGG + Intergenic
1012465640 6:99514279-99514301 GCATTTTCACTGATGGAGGAAGG - Intronic
1014108872 6:117598110-117598132 GCATTTCGAGAGGTTGAGGCAGG + Intronic
1014440699 6:121470543-121470565 GCACTTTGGGAGATTGAGGAAGG + Intergenic
1015595561 6:134863179-134863201 GCATTTTGGGAGATTGAGGCCGG - Intergenic
1017168953 6:151437798-151437820 GCTGTGGAACAGATTGAGGAAGG - Intronic
1017265518 6:152440810-152440832 GCATTTTGGGAGACTGAGGAGGG - Intronic
1017277337 6:152584647-152584669 GCATTTTGAGAGGGTGAGGAGGG - Intronic
1018601713 6:165551183-165551205 GCTTTTGGACAAATAAAGGAAGG - Intronic
1018804861 6:167250594-167250616 GCACTTTGAGAGGTTGAGGAGGG + Intergenic
1019047771 6:169161574-169161596 GAGTTTGGACAGCTGGAGGATGG - Intergenic
1019418884 7:940225-940247 GCATTTTGGGAGATTGAGGTAGG + Intronic
1021065385 7:16166524-16166546 GCATTTTGAGAGATTGAGGGGGG - Intronic
1021799587 7:24290884-24290906 GCACTTGGGCAGGCTGAGGAGGG - Intronic
1022681971 7:32557297-32557319 GCATTTTGGGAGATTGAGGCAGG - Intronic
1024478754 7:49842112-49842134 GCATTTTGGGAGGTTGAGGAGGG - Intronic
1025959908 7:66210715-66210737 GAGTTTGGGCAGATTGAGGTGGG + Intronic
1026711554 7:72745268-72745290 GCATTTGGAGAGGCTGAGGTGGG - Intronic
1026817848 7:73526047-73526069 GCACTTTGACAGGCTGAGGAGGG - Intergenic
1027337105 7:77163028-77163050 GAATTTGTACAGATTCAGCATGG + Intronic
1028231537 7:88311518-88311540 ACATGTGGTCAGAATGAGGAAGG + Intergenic
1028691237 7:93653586-93653608 GAATTTGGATAGGTTAAGGAGGG + Intronic
1029778694 7:102708082-102708104 GAATTTGTACAGATTCAGCATGG - Intergenic
1030606822 7:111646554-111646576 GAATTAGGACAGCTTGAGTATGG - Intergenic
1030638601 7:111978476-111978498 GCACTTGGGCAGACTGAGGCAGG - Intronic
1031185922 7:118480273-118480295 GCATTTGGAGAGGCTGAGGCAGG - Intergenic
1033031019 7:137826946-137826968 GCTTTGGGAAAGATTGAGTAAGG - Intronic
1034090623 7:148361052-148361074 GCATTTTGAGAGGTTGAGGTGGG - Intronic
1035370154 7:158374667-158374689 GCAAGTGGACAGATGGAGGCTGG + Intronic
1036834450 8:12049310-12049332 GCATTTGGGGAGTTTGAGGTGGG - Intergenic
1036856293 8:12295874-12295896 GCATTTGGGGAGTTTGAGGTGGG - Intergenic
1037347176 8:17913058-17913080 ACATTAGGAAAGAATGAGGATGG - Intergenic
1038153254 8:24961461-24961483 TCATTTGAATAGATTAAGGATGG + Intergenic
1038376658 8:27046810-27046832 GCACTTTGGGAGATTGAGGAGGG + Intergenic
1038991547 8:32873748-32873770 GCATTTGCACAGATGCAGCAGGG + Intergenic
1039654886 8:39393344-39393366 GCATTTGGAAGTATTGATGATGG + Intergenic
1039824059 8:41158012-41158034 GAGTTTGGAAAGAGTGAGGAAGG - Intergenic
1039826705 8:41180476-41180498 GTGTTTGGGCAGAGTGAGGATGG - Intergenic
1039925350 8:41926397-41926419 GCATTTGGAAAGGCTGAGGTGGG + Intergenic
1040017796 8:42714012-42714034 CCATTTGCACAGATTGAGTTTGG + Intronic
1040291125 8:46125385-46125407 GCATTTGCATAGCTTGAGCATGG - Intergenic
1040683180 8:49838190-49838212 GCTTTTAGACAGATGGGGGAGGG + Intergenic
1041391927 8:57354580-57354602 GCATTTTGAGAGACTGAGGCGGG + Intergenic
1042230157 8:66546383-66546405 GCACTTTGAGAGACTGAGGAAGG - Intergenic
1043979356 8:86620134-86620156 GCATTGGGACAGTTTGAGCACGG - Intronic
1044199911 8:89422250-89422272 TCACTGGGACAGACTGAGGAGGG - Intergenic
1045048716 8:98303346-98303368 GAATTTGGATAGATGGAGGTGGG + Intergenic
1045571764 8:103374994-103375016 ACAGTTTGACAGATTGTGGATGG + Intronic
1047516058 8:125556019-125556041 GCACTTTGAGAGGTTGAGGAGGG - Intergenic
1047775287 8:128065430-128065452 GCATTTTGGAAGATTGAGGTGGG - Intergenic
1047940093 8:129821315-129821337 GCATTTTGGGAGACTGAGGAAGG - Intergenic
1048361507 8:133700975-133700997 GCTTTTGGACAGGTTGTGCAAGG + Intergenic
1049050621 8:140191997-140192019 GGATTTGAAAAGATTGTGGATGG + Intronic
1050534526 9:6620108-6620130 GCAAGGGGACAGATGGAGGATGG + Intronic
1050748289 9:8904423-8904445 GCATTTTGAGAGACTGAGGTGGG + Intronic
1051073529 9:13202747-13202769 GCATTATGCCAGTTTGAGGAAGG + Intronic
1051512650 9:17896141-17896163 GTATTTGGAAATATTTAGGAAGG + Intergenic
1052833400 9:33233407-33233429 ACTTTTGGACATATTGAGAAGGG + Intronic
1052867729 9:33475431-33475453 GCATTTTGGGAGACTGAGGAGGG - Intergenic
1057418286 9:94885100-94885122 GCACTTGGAGAGGATGAGGAGGG + Intronic
1058575921 9:106401225-106401247 GCATTTGGACAGGTCAAGGCAGG - Intergenic
1058808221 9:108613533-108613555 CCAGGTGGACTGATTGAGGAAGG + Intergenic
1059713073 9:116887404-116887426 GCTTTTGGACAGAGGGAGAAAGG + Intronic
1060847703 9:126850331-126850353 GCATTTGGGCAGGCTGAGGTGGG + Intergenic
1203692616 Un_GL000214v1:59502-59524 GCATGCAGACACATTGAGGAGGG - Intergenic
1203556801 Un_KI270744v1:6394-6416 GCATGCAGACACATTGAGGAGGG - Intergenic
1203643679 Un_KI270751v1:44689-44711 GCATGCAGACACATTGAGGAGGG + Intergenic
1186382123 X:9071829-9071851 GCATTGGGACAGGTTGCAGAGGG - Intronic
1188795122 X:34454905-34454927 GCATTTTGGGAGGTTGAGGATGG + Intergenic
1188921060 X:35978054-35978076 GCATTTCAATAGATTGAGGCAGG - Intronic
1189169036 X:38891265-38891287 GCATTTGGAGAGGCTGAGGCGGG + Intergenic
1190739340 X:53279246-53279268 CCAGTTGGATAGACTGAGGAAGG - Intronic
1192087028 X:68110368-68110390 GCCTTTGGGCAGATAGAGGCAGG + Intronic
1192940438 X:75905781-75905803 GCACTTTGGGAGATTGAGGAAGG - Intergenic
1193020812 X:76790849-76790871 GCATTTTGAAAGACTGAGGTGGG + Intergenic
1193165574 X:78276810-78276832 GAAAGTGGACAGATGGAGGATGG + Intronic
1193629601 X:83866519-83866541 GCAAATGGACAGAGAGAGGAAGG - Intronic
1194514284 X:94830955-94830977 GCTTTTGAAGAGATTGAGTATGG - Intergenic
1196305972 X:114103818-114103840 GCATTTAGGCAGATGGGGGAGGG - Intergenic
1197608835 X:128615979-128616001 GCATTTGGGCAGAGTGTGGAGGG + Intergenic
1197955158 X:131938708-131938730 GCATTTTGAGAGGTTGAGGCAGG - Intergenic
1199031485 X:143005439-143005461 GCATATGGAAACATTGAGGGAGG + Intergenic
1201369592 Y:13247441-13247463 GCATTTGGGGAGACTGAGGAAGG + Intergenic