ID: 1002018559

View in Genome Browser
Species Human (GRCh38)
Location 5:176346689-176346711
Sequence CTTGCAGCTAGTTCTTCATG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 111}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002018559_1002018564 11 Left 1002018559 5:176346689-176346711 CCACATGAAGAACTAGCTGCAAG 0: 1
1: 0
2: 3
3: 19
4: 111
Right 1002018564 5:176346723-176346745 TTAGGTCTGCCAAAAAGCAGGGG 0: 1
1: 1
2: 2
3: 12
4: 122
1002018559_1002018562 9 Left 1002018559 5:176346689-176346711 CCACATGAAGAACTAGCTGCAAG 0: 1
1: 0
2: 3
3: 19
4: 111
Right 1002018562 5:176346721-176346743 CATTAGGTCTGCCAAAAAGCAGG 0: 1
1: 1
2: 2
3: 7
4: 123
1002018559_1002018560 -7 Left 1002018559 5:176346689-176346711 CCACATGAAGAACTAGCTGCAAG 0: 1
1: 0
2: 3
3: 19
4: 111
Right 1002018560 5:176346705-176346727 CTGCAAGACAGTGATCCATTAGG 0: 1
1: 0
2: 2
3: 5
4: 141
1002018559_1002018567 20 Left 1002018559 5:176346689-176346711 CCACATGAAGAACTAGCTGCAAG 0: 1
1: 0
2: 3
3: 19
4: 111
Right 1002018567 5:176346732-176346754 CCAAAAAGCAGGGGGACTCAAGG 0: 3
1: 1
2: 0
3: 18
4: 181
1002018559_1002018563 10 Left 1002018559 5:176346689-176346711 CCACATGAAGAACTAGCTGCAAG 0: 1
1: 0
2: 3
3: 19
4: 111
Right 1002018563 5:176346722-176346744 ATTAGGTCTGCCAAAAAGCAGGG 0: 1
1: 1
2: 1
3: 15
4: 132
1002018559_1002018565 12 Left 1002018559 5:176346689-176346711 CCACATGAAGAACTAGCTGCAAG 0: 1
1: 0
2: 3
3: 19
4: 111
Right 1002018565 5:176346724-176346746 TAGGTCTGCCAAAAAGCAGGGGG 0: 1
1: 1
2: 1
3: 17
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002018559 Original CRISPR CTTGCAGCTAGTTCTTCATG TGG (reversed) Exonic
902559354 1:17267364-17267386 ATTGCAGCTCATTCTCCATGGGG - Intronic
905372000 1:37487290-37487312 CTTCCAGCTAGTTCCTGAAGGGG + Intergenic
908069760 1:60445972-60445994 CTTGAAAATAGTACTTCATGAGG - Intergenic
910018705 1:82558326-82558348 CTTGCAGAGACTTGTTCATGAGG + Intergenic
911699074 1:100929390-100929412 CTTGCAAATAGTTCTTTATCAGG - Intronic
912925652 1:113910845-113910867 CTTGTAGATAGTACTTCTTGAGG + Intronic
915339799 1:155170627-155170649 CTTGGATCTACTTCTTCATGGGG + Intronic
922035275 1:221841620-221841642 CTTGCAGCTGCTCCCTCATGGGG - Intergenic
922075480 1:222239345-222239367 CTTGAAGCTAGTTAGACATGGGG + Intergenic
922964096 1:229673718-229673740 CTTGCAGCTACATGGTCATGTGG + Intergenic
922965558 1:229688181-229688203 CCTGCAGCCAGTTCTTCATGTGG - Intergenic
923423450 1:233843941-233843963 CTTGGAGCCACTTCCTCATGAGG + Intergenic
1062954409 10:1530538-1530560 CTTGCGGCCTGCTCTTCATGCGG + Intronic
1066088365 10:31993510-31993532 CATGCAGCTAGTTACTCAGGAGG + Intergenic
1066806920 10:39265947-39265969 CTTCCAGCTAGTTTTTATTGTGG + Intergenic
1067562159 10:47311715-47311737 CTTGCAGCTGGTTGGCCATGCGG + Intronic
1067685747 10:48465277-48465299 CTGGCAGCAAGTTCATCAAGAGG - Intronic
1071388400 10:85145013-85145035 CTTGGAGCTAGATATTCATGTGG + Intergenic
1075451087 10:122552471-122552493 CATGGAGCTCGGTCTTCATGTGG + Intergenic
1075602536 10:123780995-123781017 CCTGAGGCTAGTTCTTCTTGAGG - Intronic
1076157503 10:128215079-128215101 CTTGCACCTGGTTCTGCAAGAGG + Intergenic
1078673023 11:13381773-13381795 CTTATAGCAAGCTCTTCATGAGG - Intronic
1079320630 11:19448543-19448565 CTGGCACGTGGTTCTTCATGGGG + Intronic
1084560374 11:69902119-69902141 TTTTCAGCTTGTTCTTCTTGAGG + Intergenic
1087526339 11:99318684-99318706 CTGACAGCTGGTTCTTCATGGGG - Intronic
1087714806 11:101595477-101595499 CCTGCAGCCAGTTCTTCATGTGG + Intronic
1091704768 12:2686248-2686270 CTTGCATCTGGTTCATCATCAGG + Exonic
1091711336 12:2742587-2742609 CTTGCATCTGGTTCATCATCAGG + Intergenic
1097852033 12:64421387-64421409 GTTGCAGCTACTAATTCATGAGG + Exonic
1099156752 12:79186679-79186701 CTGGCAGCTAGTCTTTGATGTGG - Intronic
1115941751 14:38617964-38617986 CCTGCACCAAGTTCTTCATGTGG - Intergenic
1118478359 14:66140236-66140258 CTTGCAGCCTGTTCGTCATTTGG - Intergenic
1118636767 14:67755124-67755146 CTTGGAGGTAGATCTTCAGGTGG + Exonic
1120337766 14:83179974-83179996 CTTGCAGCAAGTTCTCACTGTGG - Intergenic
1120462040 14:84809760-84809782 CTTGTAGCTGCATCTTCATGAGG - Intergenic
1124429970 15:29598470-29598492 TTTGCAGCTAGTTTTGCTTGAGG + Intergenic
1127122033 15:55780144-55780166 CTAGCAGCTAGGTCTTCTTTTGG - Intergenic
1128714043 15:69893956-69893978 CATGCAGCAAGTTCTCCCTGGGG + Intergenic
1130313367 15:82773467-82773489 CCTGCATCTAGTGCTTCCTGAGG - Intronic
1132537991 16:492810-492832 CTTGGAGCTAGTTCTCAATGTGG - Intronic
1133907012 16:10031646-10031668 CCTGCAGCCAGTTCTCCACGTGG + Intronic
1135307089 16:21376679-21376701 CTTGCAGCTCGTGCTTGTTGAGG - Intergenic
1136303835 16:29355818-29355840 CTTGCAGCTCGTGCTTGTTGAGG - Intergenic
1138943814 16:61822817-61822839 CGTGCTGCTAGTCCTACATGGGG + Intronic
1146585104 17:34075606-34075628 GTTGTAGCTTCTTCTTCATGTGG - Intronic
1150013818 17:61532971-61532993 TTTGCAGGTAGCTCTTCATGAGG - Intergenic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1153945706 18:10015450-10015472 CTTGCAGCTAGTTCCGCCTCTGG + Intergenic
1162043261 19:7983108-7983130 CGTGCAGTTAGTTCTGCATGGGG + Intronic
1167430146 19:49449474-49449496 CTTGCATCCAGTTCTGCATGAGG + Exonic
927063952 2:19450762-19450784 ATTGCAGCTACCTTTTCATGGGG - Intergenic
927162604 2:20282089-20282111 CTGGCAGCTTTTACTTCATGAGG - Intronic
929698541 2:44141320-44141342 CTTGGAGCCAGTTATTCCTGAGG - Intergenic
932209770 2:69917114-69917136 CTTGCAAGGAGTTATTCATGAGG - Intronic
935330495 2:101974092-101974114 CTTGCAGATTCTTCTTCATAGGG + Intergenic
937577693 2:123444068-123444090 TTTCCAGCTCCTTCTTCATGAGG - Intergenic
937726015 2:125167580-125167602 CATGGAGCTAGTTCCTCATGGGG + Intergenic
942224350 2:173802313-173802335 CTTGAAGCTAGTTGGTCCTGGGG - Intergenic
942944428 2:181657208-181657230 CTTGCAGCTGGGTCTTTTTGTGG - Intronic
943780681 2:191820331-191820353 CTGGCAGCTTTTTCTTCATGCGG + Intergenic
948658427 2:239491521-239491543 CTTTCAGGAAGTTCTTCAGGTGG - Intergenic
1170530571 20:17287367-17287389 CTTGCAAATATTTATTCATGAGG + Intronic
1172347469 20:34214847-34214869 GTTGCAGCTACTAATTCATGAGG - Intronic
1173190571 20:40872621-40872643 GTTACAGCTGGTTCTTGATGGGG - Intergenic
1173927272 20:46790191-46790213 CTTGAAGCTAGTTCTACTTCTGG - Intergenic
1174422703 20:50410487-50410509 CTTGCAGCTAGGTGTCCATGTGG + Intergenic
1175305394 20:57972509-57972531 GGAGCAGTTAGTTCTTCATGGGG + Intergenic
1177631137 21:23729559-23729581 CTTTGAGCTAGATCATCATGGGG - Intergenic
1178685135 21:34704756-34704778 CTGGCAGCTACTTCTTTAGGGGG - Intronic
1185310473 22:50151551-50151573 CTTGCGGGTAGTCCCTCATGAGG - Intronic
952803963 3:37328362-37328384 CTTGCAGCTTGTTCTTTGTGTGG + Intronic
953440490 3:42911945-42911967 ATTGCAAATAGTTATTCATGAGG - Intronic
953903258 3:46855065-46855087 CTTGCAGGTAGTCCTTGATCTGG + Intergenic
957578256 3:82036460-82036482 CTTGCTGCTTTTTGTTCATGGGG - Intergenic
958917166 3:100062497-100062519 CTTGCAGCCAGTCCCTCATACGG + Intronic
960810449 3:121622862-121622884 CTTGCAACAAATTCTTCAGGAGG + Exonic
962625461 3:137221460-137221482 GTTGCAGCAACTTCTTCATATGG - Intergenic
963235324 3:142950307-142950329 CTTGCAGAAATTTCTTCTTGTGG + Intronic
965002378 3:162971053-162971075 CTTGCAGCTATTTAGACATGTGG - Intergenic
967385545 3:188907348-188907370 CTTGTAGCAAGATCTTGATGGGG - Intergenic
968643760 4:1728354-1728376 CCTGCAGCCACTTCTTCCTGAGG - Exonic
970021755 4:11577282-11577304 CTTGCAACTTGTTCTGCAAGAGG - Intergenic
971834904 4:31750069-31750091 CTTTCATCTACTTCTTCTTGAGG - Intergenic
975903614 4:79183031-79183053 CTTGCATCTGATTCTTCTTGGGG + Intergenic
976228469 4:82815977-82815999 CTTGCAGCCATTTCTCTATGTGG - Intergenic
978631621 4:110753516-110753538 CTGGCAACTTGTTCTTTATGAGG - Intergenic
979494420 4:121368519-121368541 CCTGCAACCAGTTCTTCATGTGG - Intronic
981004406 4:139860344-139860366 CTTCCAGAAAGTTCTCCATGAGG + Intronic
981491685 4:145346622-145346644 CTTCCAGAAAGTTCTCCATGAGG + Intergenic
982270908 4:153587071-153587093 CTTACAGCTAGTTAAGCATGAGG - Intronic
983838322 4:172421693-172421715 GTTTCAGGTAGTTCTCCATGAGG + Intronic
984738796 4:183138839-183138861 CTGGCATCTAGTCCTTCATGTGG + Intronic
986983817 5:13478271-13478293 CTTCCAGCTAGCTCCTTATGAGG + Intergenic
989219924 5:38946491-38946513 CTTGCACCTCGATCATCATGTGG + Exonic
989423522 5:41268948-41268970 CCTGCAGCTAGTTCATCTTTTGG + Intergenic
992008751 5:72506689-72506711 CTTGGAAATAGTTCTGCATGTGG - Intronic
997474880 5:134137049-134137071 CCTGCAGCCAGGTCTTCCTGGGG + Intronic
1002018559 5:176346689-176346711 CTTGCAGCTAGTTCTTCATGTGG - Exonic
1003980912 6:11388942-11388964 CTTCCAGCTGGGTCTGCATGTGG - Intergenic
1005269611 6:24149071-24149093 ATTGCTGCTATTTCTTGATGTGG - Intronic
1008247347 6:49194269-49194291 CTTGCAGTTTGGTGTTCATGAGG - Intergenic
1008374081 6:50771600-50771622 TTTCCAGCTACTTCTTAATGAGG + Intronic
1008428670 6:51389055-51389077 CTTGCAGCTGGTTCTTCATATGG - Intergenic
1010508507 6:76688897-76688919 CTTGCACCTAAGGCTTCATGGGG + Intergenic
1013506912 6:110809828-110809850 TTTGCAGCTAGTAATTTATGAGG + Intronic
1016828731 6:148412692-148412714 AGGGCAGCAAGTTCTTCATGAGG + Intronic
1017329732 6:153182329-153182351 ACTGCAGCTAGATGTTCATGTGG + Intergenic
1018646077 6:165949608-165949630 TTTTCAAGTAGTTCTTCATGTGG - Intronic
1020990233 7:15186490-15186512 TTTGCAGCCATTTGTTCATGTGG - Intergenic
1022437832 7:30407157-30407179 CTTGCCCCTACTTGTTCATGCGG + Intronic
1023091881 7:36625100-36625122 CTTGCAGCTCCCTCTTCATTAGG - Intronic
1023609983 7:41963030-41963052 CATGCAGTTAGTCCTTAATGTGG - Exonic
1025119573 7:56289227-56289249 GTTGCAGCTACTAATTCATGAGG + Intergenic
1025248122 7:57332983-57333005 CTTGCAGCTAGGTGTCCATGTGG - Intergenic
1028235061 7:88351183-88351205 TTAGCAGAGAGTTCTTCATGTGG + Intergenic
1028670097 7:93392110-93392132 CATGGTGCTACTTCTTCATGTGG + Intergenic
1029975216 7:104827196-104827218 CCTGCAGCCAGTTCTCCATGTGG + Intronic
1030857211 7:114574636-114574658 CTTGCAGATAGGTGTTAATGAGG - Intronic
1031602457 7:123727249-123727271 CTTTCAGATAGTTCTCCAAGTGG - Intronic
1035337856 7:158141574-158141596 ATTGAAGCTGGTTCTTCAGGGGG + Intronic
1037587129 8:20284953-20284975 CTTACAACTACTTCCTCATGGGG + Intronic
1044389605 8:91633931-91633953 ATTGCAGCTTGTTCTTCAGCAGG + Intergenic
1049264770 8:141661711-141661733 CGTCCAGCTATTTCTTTATGAGG - Intergenic
1051713333 9:19956038-19956060 CCTGCAGCCAGTTCTTAATGTGG - Intergenic
1054877287 9:70110338-70110360 ATTGAAGCTAGTTCTGCATATGG + Intronic
1060010261 9:120037617-120037639 GGTGTAGCTAGTTCTTCCTGAGG + Intergenic
1187033322 X:15510910-15510932 CTTTCATCTATTTCATCATGTGG - Intronic
1188411026 X:29872086-29872108 CTTGCAGATGGTTCTTCAAATGG - Intronic
1191239826 X:58177026-58177048 TTTGCATCTAGTTTTTCATGTGG - Intergenic
1194566646 X:95496784-95496806 ATTGCAGCTAGCTCTTCATCAGG + Intergenic
1194728019 X:97421423-97421445 CTTGCAGCACGTTCTTAATCTGG + Intronic
1197462335 X:126757656-126757678 CTTGCATCTAGTTCTCTCTGGGG + Intergenic
1197988947 X:132296439-132296461 CTTGCAGCTATGGCCTCATGGGG - Intergenic
1198012054 X:132567236-132567258 TCTGCAGCTACTTCTTCATTTGG - Intergenic