ID: 1002021368

View in Genome Browser
Species Human (GRCh38)
Location 5:176366089-176366111
Sequence AGTGCACCCCGCCCGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002021358_1002021368 -5 Left 1002021358 5:176366071-176366093 CCCCTCCGGCGCCTGCGCAGTGC 0: 1
1: 0
2: 2
3: 16
4: 131
Right 1002021368 5:176366089-176366111 AGTGCACCCCGCCCGGGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 70
1002021352_1002021368 22 Left 1002021352 5:176366044-176366066 CCCGGGGCCCAGCCGGGTCGGCT 0: 1
1: 0
2: 0
3: 22
4: 205
Right 1002021368 5:176366089-176366111 AGTGCACCCCGCCCGGGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 70
1002021359_1002021368 -6 Left 1002021359 5:176366072-176366094 CCCTCCGGCGCCTGCGCAGTGCA 0: 1
1: 0
2: 3
3: 10
4: 65
Right 1002021368 5:176366089-176366111 AGTGCACCCCGCCCGGGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 70
1002021353_1002021368 21 Left 1002021353 5:176366045-176366067 CCGGGGCCCAGCCGGGTCGGCTC 0: 1
1: 0
2: 1
3: 26
4: 215
Right 1002021368 5:176366089-176366111 AGTGCACCCCGCCCGGGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 70
1002021361_1002021368 -10 Left 1002021361 5:176366076-176366098 CCGGCGCCTGCGCAGTGCACCCC 0: 1
1: 0
2: 1
3: 25
4: 207
Right 1002021368 5:176366089-176366111 AGTGCACCCCGCCCGGGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 70
1002021360_1002021368 -7 Left 1002021360 5:176366073-176366095 CCTCCGGCGCCTGCGCAGTGCAC 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1002021368 5:176366089-176366111 AGTGCACCCCGCCCGGGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 70
1002021354_1002021368 15 Left 1002021354 5:176366051-176366073 CCCAGCCGGGTCGGCTCGCGCCC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1002021368 5:176366089-176366111 AGTGCACCCCGCCCGGGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 70
1002021356_1002021368 10 Left 1002021356 5:176366056-176366078 CCGGGTCGGCTCGCGCCCCTCCG 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1002021368 5:176366089-176366111 AGTGCACCCCGCCCGGGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 70
1002021355_1002021368 14 Left 1002021355 5:176366052-176366074 CCAGCCGGGTCGGCTCGCGCCCC 0: 1
1: 0
2: 1
3: 8
4: 129
Right 1002021368 5:176366089-176366111 AGTGCACCCCGCCCGGGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002021368 Original CRISPR AGTGCACCCCGCCCGGGGGT GGG Intronic
901822003 1:11836226-11836248 AGTCCACCCCAGCCAGGGGTGGG - Intronic
903225562 1:21892583-21892605 ACTGCACCCAGCCCGGGGGCTGG - Intronic
904466865 1:30713489-30713511 AGGGAAGCCAGCCCGGGGGTGGG - Exonic
915355852 1:155254988-155255010 AGGGGACCCAGCCAGGGGGTGGG - Exonic
916662703 1:166936776-166936798 AGTGCACCCTGCCCTGGAGGTGG - Intronic
916788593 1:168104855-168104877 AGTGCACCTCGGCGTGGGGTGGG + Exonic
917965800 1:180177764-180177786 AGTGCACCCCGCTGGGGTGGAGG - Intronic
918317316 1:183332819-183332841 AGTGCACCCCGACCTGGGCGAGG - Intronic
918494219 1:185115312-185115334 AGTGCACCCTGCCAAGGGATGGG + Intergenic
922196351 1:223363622-223363644 AGTGCACCCGGCTCGGGGGAAGG - Exonic
1076549780 10:131270995-131271017 AGTGCACTCGGCCCCAGGGTGGG - Intronic
1076637430 10:131891548-131891570 AGTGTACCCAGCCCGGCGGGGGG + Intergenic
1077432502 11:2522776-2522798 AGGGCTCCAGGCCCGGGGGTTGG - Intronic
1078679618 11:13463326-13463348 GGTGCTCTCCGCCCAGGGGTGGG + Intergenic
1081596576 11:44463610-44463632 AGGGCACCCCTCCCTGTGGTGGG + Intergenic
1083640817 11:64144377-64144399 TGTGCACCACGCCGTGGGGTGGG - Intronic
1084486209 11:69449774-69449796 AGTGGACCCGGCCCGGTGGCTGG - Intergenic
1101771982 12:107760689-107760711 CGTGCACCCCGCCACGGGTTGGG + Exonic
1103749963 12:123151524-123151546 CGAGCACCGCGCCCGGGGCTGGG - Intergenic
1104896864 12:132168965-132168987 AGTGCACTCCGCCAGAGGGCCGG - Intergenic
1104916766 12:132269518-132269540 AGGCCACCCCGCCCTGGGCTCGG - Intronic
1106304001 13:28494692-28494714 CGTGCACCCCGCCCTGGCCTCGG + Intronic
1107818069 13:44262044-44262066 AGTGCACCCAGCTCAGGGGAGGG + Intergenic
1108227350 13:48303510-48303532 AGTGCACCCCGGCCTGGAGGGGG + Intergenic
1111220945 13:85205185-85205207 AGCGCCCCCCGCCCCGTGGTGGG + Intergenic
1112570413 13:100588676-100588698 AGGACACCCCGCCTGGGGGGCGG + Intronic
1119514991 14:75240938-75240960 AGGGCAACCCGCCCGTGGGATGG - Intronic
1122819181 14:104332740-104332762 AGTGCACCCAGCTCTGGGTTCGG - Intergenic
1122887593 14:104717296-104717318 AGCGCGCCCTGCCCGGGGGGGGG - Intronic
1125727733 15:41876691-41876713 AGTGCACCTCGTGCTGGGGTGGG - Intronic
1132892115 16:2209610-2209632 AGTGGACCCCGCCCAGGCGGGGG - Exonic
1137787992 16:51152643-51152665 TGGGCACCCCGCCCTGGGGAGGG + Intergenic
1144512218 17:15886935-15886957 AGTGGACCCAGCCAGGGGGCAGG + Intergenic
1144955383 17:19016520-19016542 AGGGCACCCATCCTGGGGGTGGG + Intronic
1145123596 17:20282037-20282059 AGTGGACCCAGCCAGGGGGCAGG + Intronic
1145969981 17:28950965-28950987 AGAGCACCCAGCCCGGGAGGTGG - Exonic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1150802078 17:68290775-68290797 AGTGCCCCCTGCCCCGGGTTGGG - Intronic
1164574570 19:29398173-29398195 AGTGCAGCCCGCCCAGGGTCAGG - Intergenic
1164826728 19:31289632-31289654 AGTGCCCCACTCCCAGGGGTGGG + Intronic
1167048720 19:47066523-47066545 TGTGCACCCCGGGCTGGGGTGGG + Exonic
937359298 2:121217858-121217880 AGTCCACCCCGCCTCGTGGTGGG - Exonic
938373349 2:130787945-130787967 AATGCACACCTCCCCGGGGTGGG - Intergenic
947791598 2:232872131-232872153 AGAGCTCCCAGCCCAGGGGTGGG - Intronic
1174189280 20:48728658-48728680 AGTGCAGGGCGCCTGGGGGTGGG + Intronic
1175186575 20:57182943-57182965 ACTGCACCCGGCCAGGTGGTAGG - Intronic
1176012629 20:62907617-62907639 TGTGCACCCCTCTCGAGGGTGGG + Intronic
1176110402 20:63408209-63408231 AAGGCACCCAGGCCGGGGGTGGG + Intronic
1179949498 21:44701819-44701841 AGTGGTCCCCGTCCCGGGGTTGG + Intronic
1180965198 22:19784569-19784591 AGTGCTGCCCGCCCGCGGATGGG + Exonic
1184149164 22:42628537-42628559 AGTGCATCCAGCCCTGGAGTTGG - Intronic
1184453802 22:44597943-44597965 AGGGCACCCCGTCCAGGGGAAGG + Intergenic
1184514435 22:44953220-44953242 AGTGCATCCTGCCCAGGGCTTGG - Intronic
1184790350 22:46696137-46696159 AGTGTGCACCGCCCAGGGGTGGG + Intronic
950638851 3:14335019-14335041 ACTGCACCCAGCCCTGGGCTTGG - Intergenic
954210356 3:49093737-49093759 AGCGCACCCCGCCCTGTGGATGG - Intronic
968568683 4:1328188-1328210 ACTGCACGCCGCCCTTGGGTCGG - Intronic
976812455 4:89111447-89111469 AGCGCACGCGGCCCGGGGGAGGG - Intergenic
985666524 5:1184058-1184080 GGTGCACACGGCCCTGGGGTGGG + Intergenic
988565251 5:32315570-32315592 ACTGCACCCTGCCTGGGGCTAGG - Intergenic
995650147 5:114361262-114361284 TCGGCACCCCGGCCGGGGGTGGG - Intronic
1002021368 5:176366089-176366111 AGTGCACCCCGCCCGGGGGTGGG + Intronic
1007373782 6:41443125-41443147 AGACCAGCCCGCCCTGGGGTGGG - Intergenic
1016416940 6:143843194-143843216 AGTACAGCCCGCCCAGGGGTGGG + Intronic
1019498063 7:1349704-1349726 ACTGACCCCCGCCCGGGGCTGGG - Intergenic
1029606508 7:101602360-101602382 AGTGCACACTGCCTGGGGCTCGG + Intergenic
1042532881 8:69833040-69833062 AGTGCACCCTGCGCCGGGGGTGG + Exonic
1045614089 8:103885899-103885921 AGTGGACTCCTCCTGGGGGTAGG - Exonic
1053296922 9:36922001-36922023 AGTGCACCCAGGCCTGAGGTGGG - Intronic
1060938592 9:127530309-127530331 ACTGCAACCCGCCCGGTGGAGGG - Intronic
1061924436 9:133799022-133799044 AGGGCACCCGGCCTGGGGCTCGG + Intronic
1062020451 9:134316911-134316933 AGTGCAGCCTGCCTGGGGGAGGG + Intergenic
1185831814 X:3310208-3310230 CCTGCACCCCTCCCGGGGCTGGG - Exonic
1186788481 X:12974947-12974969 AGTGGACCCCGGGTGGGGGTGGG + Intergenic