ID: 1002021379

View in Genome Browser
Species Human (GRCh38)
Location 5:176366127-176366149
Sequence GACCGCAGGCGGGAGGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 231}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002021379_1002021391 -1 Left 1002021379 5:176366127-176366149 CCCATCCCCTCCCGCCTGCGGTC 0: 1
1: 0
2: 0
3: 11
4: 231
Right 1002021391 5:176366149-176366171 CGGGACTCCGAGACCGGTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 150
1002021379_1002021395 7 Left 1002021379 5:176366127-176366149 CCCATCCCCTCCCGCCTGCGGTC 0: 1
1: 0
2: 0
3: 11
4: 231
Right 1002021395 5:176366157-176366179 CGAGACCGGTGGAGGAAGCGGGG 0: 1
1: 0
2: 0
3: 5
4: 109
1002021379_1002021397 24 Left 1002021379 5:176366127-176366149 CCCATCCCCTCCCGCCTGCGGTC 0: 1
1: 0
2: 0
3: 11
4: 231
Right 1002021397 5:176366174-176366196 GCGGGGCGCGCGAGCGTTTAAGG 0: 1
1: 0
2: 0
3: 0
4: 26
1002021379_1002021389 -7 Left 1002021379 5:176366127-176366149 CCCATCCCCTCCCGCCTGCGGTC 0: 1
1: 0
2: 0
3: 11
4: 231
Right 1002021389 5:176366143-176366165 TGCGGTCGGGACTCCGAGACCGG 0: 1
1: 0
2: 0
3: 69
4: 819
1002021379_1002021392 5 Left 1002021379 5:176366127-176366149 CCCATCCCCTCCCGCCTGCGGTC 0: 1
1: 0
2: 0
3: 11
4: 231
Right 1002021392 5:176366155-176366177 TCCGAGACCGGTGGAGGAAGCGG 0: 1
1: 0
2: 0
3: 6
4: 149
1002021379_1002021394 6 Left 1002021379 5:176366127-176366149 CCCATCCCCTCCCGCCTGCGGTC 0: 1
1: 0
2: 0
3: 11
4: 231
Right 1002021394 5:176366156-176366178 CCGAGACCGGTGGAGGAAGCGGG 0: 1
1: 0
2: 0
3: 25
4: 111
1002021379_1002021390 -4 Left 1002021379 5:176366127-176366149 CCCATCCCCTCCCGCCTGCGGTC 0: 1
1: 0
2: 0
3: 11
4: 231
Right 1002021390 5:176366146-176366168 GGTCGGGACTCCGAGACCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002021379 Original CRISPR GACCGCAGGCGGGAGGGGAT GGG (reversed) Intronic
900343110 1:2197889-2197911 GCTGTCAGGCGGGAGGGGATTGG - Intronic
900354002 1:2251136-2251158 GAAGGCAGGCGGGAGGAGAAAGG - Intronic
900387945 1:2419163-2419185 GACCGCAGGTGGGAAGGGTCAGG - Intergenic
900576322 1:3384249-3384271 GAGGGCAGGGGGCAGGGGATGGG - Intronic
900602681 1:3509761-3509783 GACCCCAGGCAGGTGGGGGTGGG + Intronic
900757820 1:4449402-4449424 GACTGGAGGCGGGAGGACATGGG + Intergenic
901086623 1:6614894-6614916 GACCGCGGGCGGGTGGGGGAGGG + Intronic
902250997 1:15154073-15154095 GACCCCAGGCGGGAAGCGCTCGG - Intronic
902919963 1:19659855-19659877 GGCTGCAGGCGGGAGAGGATGGG + Intergenic
903670713 1:25033929-25033951 GCCCGTAGGCAGGAGGGGTTCGG + Intergenic
904625607 1:31800218-31800240 GACTGGAGGAGGGAGGGGCTGGG - Intronic
905789645 1:40783463-40783485 GGCCGCGGGCGGCAGGGGAAGGG - Intergenic
905883850 1:41481283-41481305 TCCCGCAGGCAGGTGGGGATGGG - Intronic
907736725 1:57120611-57120633 GACTGCAGGGAGGAGGGAATGGG - Intronic
911114975 1:94237501-94237523 GTCCGCAGGCCGTGGGGGATGGG - Exonic
914673323 1:149888516-149888538 GAGTGCAGGCGGGTGGGGGTGGG - Intronic
916989267 1:170224857-170224879 TACCGGAGGCTGGTGGGGATGGG + Intergenic
919846735 1:201647647-201647669 GAGCCCAGGAGGTAGGGGATGGG - Intronic
922809288 1:228406951-228406973 GCCCGCGGGCGGGACGGAATTGG + Intergenic
923024848 1:230196166-230196188 GACGGCAGGCAGGAGGTGAGGGG - Intronic
1063389792 10:5641724-5641746 GGCTGAAGGCTGGAGGGGATGGG + Intronic
1065202844 10:23331068-23331090 GAAGGGAGGAGGGAGGGGATAGG + Intronic
1067949016 10:50710827-50710849 GACCCTAGGAGGGTGGGGATTGG + Intergenic
1069755359 10:70771476-70771498 GACAGCAGGCAGGAGAGGACCGG + Intronic
1070520886 10:77252402-77252424 GACTGCAGGCTGAAGGGCATTGG + Intronic
1075627529 10:123973317-123973339 CTCCGCAGGCGGGAGGCCATGGG + Intergenic
1076735130 10:132455620-132455642 GACCGCAGCTGGGAGGGACTCGG - Intergenic
1076886960 10:133267409-133267431 GACCGGAGGCTGGAGGAGACAGG + Exonic
1077343225 11:2035279-2035301 GAATGCAGGCGGGATGGGGTGGG - Intergenic
1077413767 11:2415113-2415135 GACCGCAGGAGGGCGGTGAGCGG - Exonic
1078617886 11:12881919-12881941 GACCGCTGGCTGGATGGGGTAGG - Exonic
1078668990 11:13348409-13348431 GACCACAGTGGAGAGGGGATGGG + Intronic
1081028848 11:38051783-38051805 GAGAGCAGGTGGGAGGTGATTGG - Intergenic
1081673341 11:44954158-44954180 GGCCCCAGGGGGGTGGGGATGGG + Intergenic
1082828383 11:57597878-57597900 GGCCTGAGGCGGGAGGGGCTGGG - Intronic
1085296215 11:75433214-75433236 GACGCCAGGAGGGAGGGGAAGGG + Intergenic
1202826211 11_KI270721v1_random:90468-90490 GAATGCAGGCGGGATGGGGTGGG - Intergenic
1092211144 12:6647166-6647188 GGCCGCGGGCGGGGGGAGATGGG + Intronic
1096466124 12:51848511-51848533 GGCCGCGGGCGGGCCGGGATGGG - Intergenic
1099323533 12:81181359-81181381 GACGACAGGCTGGAGGGCATCGG - Intronic
1102564025 12:113782983-113783005 GGCCGCGGGAGGGAGGGGAGAGG - Intergenic
1102814619 12:115854667-115854689 GGTGGGAGGCGGGAGGGGATGGG - Intergenic
1104602336 12:130162281-130162303 GGCTGCAGGCCGGGGGGGATCGG + Intergenic
1107073600 13:36297887-36297909 GCCCGCAGGCGGCAGGGGGTGGG + Intergenic
1107531685 13:41288405-41288427 GGCTGCAGGTGGCAGGGGATGGG + Intergenic
1112356127 13:98676093-98676115 GCCTGCAGGCGGGAGGGGTCGGG - Intergenic
1116053912 14:39839598-39839620 TATTGCAGGTGGGAGGGGATGGG + Intergenic
1118474453 14:66103649-66103671 GACAGCACACAGGAGGGGATTGG - Intergenic
1119046171 14:71320668-71320690 TACCGCATGGGGGAGGGGACAGG - Intronic
1119538039 14:75419124-75419146 AAACGCTGGCGGGAGGAGATGGG + Intergenic
1121358012 14:93231283-93231305 GACAGGAGGCAGGAGGGGAGGGG + Intergenic
1122082507 14:99275068-99275090 GACAGCAGGCGGGGCGGGAGGGG + Intergenic
1122939282 14:104973981-104974003 GAGCCCAGGAGGCAGGGGATGGG - Intronic
1125398655 15:39276623-39276645 GACCCCAGGCAGACGGGGATGGG + Intergenic
1125475778 15:40047306-40047328 GAGAGCAGGAGGGAGGGCATAGG + Intergenic
1125520827 15:40347017-40347039 GATCGCAGGAGGCAGGGGAGTGG + Intergenic
1127606216 15:60591508-60591530 GGCCGGGGGCGGGAGGGGAGGGG - Intronic
1129791226 15:78341704-78341726 GGCCGAAGGCGGGAAGGGAGAGG - Intronic
1131094318 15:89646200-89646222 CAAAGCAGGCGGGAGGGGAGGGG - Intronic
1132252183 15:100342054-100342076 CTCGGAAGGCGGGAGGGGATTGG + Intergenic
1132400971 15:101505074-101505096 GACCCCAGGCGGGAGGCCACGGG + Intronic
1132584741 16:701191-701213 GCCCACAGGAGGGAGGGGACAGG + Intronic
1132856487 16:2047391-2047413 CACTGCAGGAGGGCGGGGATGGG + Intronic
1133231103 16:4367016-4367038 GTCGGCTGGCAGGAGGGGATGGG - Intronic
1133266384 16:4586905-4586927 GACAGCAGGCAGGTGGGCATGGG - Intronic
1134609803 16:15598934-15598956 GACGGCAGGCACGAGGGGACAGG + Exonic
1136064030 16:27746803-27746825 GAGCGCAGAGGGGAGGGGACAGG + Intronic
1136188378 16:28601165-28601187 GAGCGCAGGAGGGAGAGGAGGGG - Intergenic
1136366603 16:29811979-29812001 GACCGTTGGCGGGAGGGGCCGGG + Intronic
1136409100 16:30066064-30066086 GACCTCAGGCTGGAGGGGCCGGG - Intronic
1136462573 16:30420817-30420839 GTCAGCATGAGGGAGGGGATTGG + Intronic
1138955532 16:61966496-61966518 GTCCGCAGGCTGGAGGGCAGTGG - Intronic
1139506195 16:67399258-67399280 CATGGCAGGCGGGCGGGGATGGG - Intronic
1140347417 16:74227708-74227730 GACCCCAGGAGGCAGGGGCTGGG + Intergenic
1140914706 16:79483182-79483204 GACAGAAGGAGGGAGGGGAGGGG - Intergenic
1142133734 16:88442402-88442424 GACGGCGGGCGTGAGGGGAGGGG - Intergenic
1142247397 16:88976322-88976344 GGCCGCAGCCGGGAAGTGATGGG - Intronic
1144726721 17:17506007-17506029 GAGCGCAGGCGGGAGAGGGGAGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148551965 17:48555779-48555801 GTGCGCAGGAGGGAGGGGGTGGG + Intronic
1148851754 17:50559072-50559094 GGCCGATGGGGGGAGGGGATGGG - Intergenic
1149302913 17:55321190-55321212 GAGTGAAGGAGGGAGGGGATGGG - Exonic
1151659577 17:75511833-75511855 GAGGGCAGGCGGGAGGGGTTTGG - Intronic
1152088008 17:78231998-78232020 GGCGGCCGGCGGGAGGGGACGGG - Exonic
1152145658 17:78567240-78567262 GACCCCAGGCAGGAGGAGCTGGG + Intronic
1152154102 17:78621800-78621822 CAGCGCAGGCGGGAGGAGCTGGG - Intergenic
1152357924 17:79815510-79815532 GACCGCGGGCGGGACAGGAGGGG + Intergenic
1152378519 17:79930529-79930551 GACCGCACGAAGGAGGGGGTGGG + Intergenic
1152629198 17:81402184-81402206 GTCCGCAGGGGGGAGGAAATGGG - Intronic
1152639508 17:81443772-81443794 GACAGCAGACGGGAGAGGGTTGG - Intronic
1152659301 17:81535034-81535056 GACCCCTGGAGGGAGGAGATGGG - Exonic
1152874975 17:82781308-82781330 GGGGGCAGGCGGGGGGGGATGGG + Intronic
1155204235 18:23543816-23543838 GAACACAGGCGGCAGGGGACTGG + Intronic
1157692711 18:49697151-49697173 GACCCCAGGCGGGTGGGGGAGGG - Intergenic
1160585712 18:79912148-79912170 GACGGCAGCAGCGAGGGGATGGG + Intronic
1161196174 19:2987817-2987839 GACTCCAGGCGGGATGGGGTGGG + Intronic
1161681098 19:5680254-5680276 GGAAGCAGGAGGGAGGGGATTGG + Intronic
1161684457 19:5696026-5696048 GACAGCAGTGGGGAGGGGCTGGG + Intronic
1162012143 19:7823606-7823628 GAGCGGAGGAGGGAGGGGAGGGG + Intergenic
1162534219 19:11253537-11253559 GGCCACAGGAGGGAGGGGGTGGG + Intronic
1162757223 19:12867582-12867604 GCCGGCAAGCGGGAGGGGCTGGG + Exonic
1164636200 19:29793118-29793140 GACCGCAGAGGTGAGGGGACAGG + Intergenic
1166382175 19:42360906-42360928 GACAGCAGGCGGCAGGGGTCAGG - Exonic
1166538857 19:43592811-43592833 GAACGCAGGTGGAGGGGGATTGG - Exonic
1166985036 19:46654720-46654742 GACCGCAGGAGGGAGGGAAGTGG + Intronic
1167035617 19:46993586-46993608 GAACTCAGGAGGGAGGGGAGGGG - Intronic
1167037962 19:47005380-47005402 GGCCTCAGGCCGGAGGGGAGTGG - Intergenic
1167417996 19:49386979-49387001 GAAGGGAGGCGGGAGGGGAGGGG + Intergenic
926083938 2:10009646-10009668 GGCCGCAGCCTGGAGGGGACAGG + Intergenic
929444738 2:41992885-41992907 GACCCCAGGCAGGCGGGGCTGGG - Intergenic
930087753 2:47509963-47509985 GACAGCAAGGGGGAGGGGATTGG - Intronic
930358287 2:50347078-50347100 GTCCGAAGGAGGGAGAGGATGGG - Intronic
931768497 2:65477639-65477661 GAAGGCAGGTGGGAGGGGATTGG + Intergenic
934704891 2:96470614-96470636 GCCTGCAGGCTGGAGGGGAAGGG + Intergenic
937915906 2:127098584-127098606 GACAGCAGGTGGGGTGGGATTGG - Intronic
938402635 2:131005674-131005696 GTCCTCAGGTGGGAGGGGAGGGG + Intronic
938406967 2:131038220-131038242 GGCTGCAGGAGGGAGGGGCTGGG - Intronic
938406989 2:131038311-131038333 GGCTGCAGGAGGGAGGGGCTGGG - Intronic
938407046 2:131038524-131038546 GGCTGCAGGAGGGAGGGGCTGGG - Intronic
941848900 2:170159449-170159471 GACAGCAAGGGAGAGGGGATAGG - Intergenic
946315578 2:218909226-218909248 GGTCGCAGGAGGGCGGGGATGGG + Intergenic
948067010 2:235088203-235088225 GACCCCTGGCTGGAGGGGATGGG + Intergenic
948269723 2:236664975-236664997 TACAGCAGGAGGGAGGTGATGGG + Intergenic
948627779 2:239279733-239279755 GCCCGCAGGGGGCATGGGATGGG + Intronic
948923443 2:241078628-241078650 GACTGGAGGGTGGAGGGGATGGG + Intronic
1168948428 20:1780361-1780383 GACCTCAGGCAGGAAGGGCTTGG + Intergenic
1168965041 20:1894090-1894112 GAACGCAGGGGGAAGGGGAGAGG - Intergenic
1169218620 20:3807642-3807664 GCCCCCAGGCGGGTGGGGCTGGG + Intergenic
1173741442 20:45405453-45405475 GAGCCCAGGCGGGAGGTGGTGGG + Intronic
1176035899 20:63036315-63036337 GACCCCAGGCTGGAGGGGGCCGG - Intergenic
1176380641 21:6110829-6110851 GAGCGCAGGCGGGCGGGCCTCGG + Intergenic
1176547026 21:8206540-8206562 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176554931 21:8250749-8250771 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176565977 21:8389587-8389609 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176573852 21:8433774-8433796 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1179742831 21:43427411-43427433 GAGCGCAGGCGGGCGGGCCTCGG - Intergenic
1180014581 21:45074143-45074165 GACCGCAGGCGCCCGGCGATTGG - Intronic
1181567924 22:23751019-23751041 GGCCGCAGGCGGGCGGGGCGGGG + Exonic
1182119935 22:27779944-27779966 TACCACAGGTGGGAGGGCATGGG - Intronic
1183393740 22:37560386-37560408 GCCCGCGGGCGGGAGGAGACGGG + Intergenic
1183827177 22:40397682-40397704 GCCAGCAGGCTGGAGGGGCTGGG - Intronic
1184276550 22:43412163-43412185 GACCGGAGGCGGGCGGGGCGCGG + Intronic
1184350896 22:43943521-43943543 GACCCCAGGCAGAAGGGGAGGGG - Intronic
1184464557 22:44661163-44661185 GGGGGCTGGCGGGAGGGGATTGG - Intergenic
1185039498 22:48497176-48497198 CACCGCAGGCGGGGGCGGAACGG - Intronic
1185048239 22:48539903-48539925 GGCAGAAGGTGGGAGGGGATGGG + Intronic
1185245535 22:49771057-49771079 GACCGGAGCCGGCTGGGGATGGG - Intergenic
1203251901 22_KI270733v1_random:122825-122847 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203259952 22_KI270733v1_random:167908-167930 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
950144758 3:10641020-10641042 GACCCCAGGCAGGAGGGATTGGG + Intronic
951217840 3:20040880-20040902 GGCCCCAGGCGGGAGGCGAGAGG - Intronic
952901740 3:38115651-38115673 GACTGAAGGCAGGAGGGGAGGGG + Intronic
954200391 3:49020510-49020532 GCCCTCAGGCTGGAGGTGATGGG - Intronic
954361488 3:50124978-50125000 GGCCGCTGGCTGCAGGGGATGGG + Intergenic
954382346 3:50226414-50226436 GGCGGGAGGCGGGAGGGGAAAGG + Intronic
954401738 3:50322786-50322808 GATGGGAGGCGGGAGCGGATGGG - Intronic
954446103 3:50547696-50547718 GTCCACAGGCTGCAGGGGATAGG - Intergenic
961612764 3:128153682-128153704 GACCGCAGGCGCGCGGGCAGCGG - Exonic
963066955 3:141271690-141271712 GATGGCAGGAGGGAGGGGTTTGG + Intronic
965985969 3:174753603-174753625 GTCCACAGTGGGGAGGGGATGGG + Intronic
966213933 3:177481442-177481464 GACAGCAGGATGGAAGGGATTGG - Intergenic
968497691 4:927499-927521 GACCGCAGGTGAGCGGGGAGGGG - Intronic
968904830 4:3446361-3446383 GTCCGCAAGCGGGTGGGGACAGG - Intronic
969379396 4:6783624-6783646 GGCCGCAGGCGGGCGGGGCCGGG + Intronic
969640554 4:8395744-8395766 GACCACACACGGGAGGGGATGGG + Intronic
974702630 4:65471770-65471792 GAGAGCAGGTGGGAGGTGATTGG - Intronic
975674457 4:76812371-76812393 GGCCGAAGGCGGGAGGGAAAAGG - Intergenic
977574137 4:98658898-98658920 GACCGCAGGCGAGAGGGAGAAGG + Intergenic
982745674 4:159102920-159102942 GGCCGCTGGCGGGCGGGGAGCGG + Intergenic
985067025 4:186132596-186132618 AAAAGCAGGCTGGAGGGGATAGG + Intronic
986569519 5:9150652-9150674 GACCTCAGGCGGCGGGGGTTGGG - Intronic
989420010 5:41226606-41226628 GGCCGCAGGAGGGAGGTGATAGG - Intronic
990545157 5:56815345-56815367 GGCCGCAGGTGGGAGGGAGTGGG - Intergenic
993905711 5:93621239-93621261 GGGCGCAGGCGGGAGGGGCGGGG - Intronic
997845316 5:137280858-137280880 GAGCGCTGGGAGGAGGGGATTGG - Intronic
998143405 5:139712120-139712142 TGCCGCAGGGGGGTGGGGATGGG + Intergenic
999719915 5:154391986-154392008 GACTGCAGGAAGGTGGGGATGGG + Intronic
1002021379 5:176366127-176366149 GACCGCAGGCGGGAGGGGATGGG - Intronic
1002384273 5:178854599-178854621 GTCCTCAGGTGGGAGAGGATGGG + Intergenic
1002534758 5:179870046-179870068 GACTGCATGAGGGAGGGGAGCGG + Intronic
1005110919 6:22280589-22280611 CACAGCAGGCAGAAGGGGATGGG + Intergenic
1006183638 6:32168441-32168463 GAACCCTGGCTGGAGGGGATAGG - Exonic
1007099022 6:39231761-39231783 GACCGGAGGTGGGAGAGGAATGG - Intergenic
1007363284 6:41373395-41373417 GACCGCTGGGGGGAGGGGGCAGG - Intergenic
1007617885 6:43192821-43192843 GGCTGCAGAGGGGAGGGGATTGG + Intronic
1009536089 6:64888127-64888149 GACAGTAGGGGAGAGGGGATAGG + Intronic
1009575540 6:65453672-65453694 GACTGTAGGGGGGAGGGGAGAGG - Intronic
1010926581 6:81752544-81752566 GAGCGCAGGCGGCAGGGGTCTGG - Exonic
1012916791 6:105179653-105179675 GACCGGAGCCGGGAAGGGAGCGG + Intronic
1013075016 6:106763587-106763609 GACCAAATGTGGGAGGGGATGGG - Intergenic
1013155719 6:107490017-107490039 GAGCGCGGCCGGGAGGGGGTCGG - Exonic
1014205380 6:118651104-118651126 GGCCTGAGGCGGGAGGGGAGCGG + Intronic
1017235234 6:152111678-152111700 GACCACAGGCTGGAAGGGAGGGG + Intronic
1018613280 6:165662839-165662861 GGCCGCGGGCGGGAGGGGCGCGG + Intronic
1018773756 6:166995587-166995609 GATCCAAGGCGGGAAGGGATGGG - Intergenic
1019307083 7:340788-340810 CACCGGAGGCGGGAGGGGCCTGG - Intergenic
1019640039 7:2098466-2098488 GACCCCAGGCAGCAGGGGAGAGG - Intronic
1023022813 7:36026009-36026031 GACCGGAGGTGGGTGTGGATGGG - Intergenic
1023868124 7:44248511-44248533 GACCCCAGGCAGGTGGGCATCGG - Intronic
1026737814 7:72960154-72960176 GCCCGCTGCCTGGAGGGGATAGG - Exonic
1026788849 7:73318955-73318977 GCCCGCTGCCTGGAGGGGATAGG - Exonic
1027105920 7:75404914-75404936 GCCCGCTGCCTGGAGGGGATAGG + Exonic
1029374859 7:100171479-100171501 GACCGCGGCCGGGAGGGGCGGGG - Intronic
1029531496 7:101128330-101128352 GAAGACAGGCGGGAGGGGAGGGG - Intronic
1029987065 7:104931795-104931817 GAGCGCAGGGGGTAGGGGGTGGG + Intergenic
1032200719 7:129820884-129820906 GTCAGCAGGCTGGAGGGGAGAGG + Intergenic
1032534408 7:132649948-132649970 GTCCGCAGGAGGGATTGGATGGG + Intronic
1032587814 7:133163827-133163849 GATGGCAGGGGTGAGGGGATTGG + Intergenic
1033439633 7:141367078-141367100 GACAGCAGGGGGGAGGGGTGGGG + Intronic
1035247823 7:157576478-157576500 CGCCGCAGGGGGGAGGGGAAGGG - Intronic
1035634586 8:1134886-1134908 GAGACCTGGCGGGAGGGGATTGG - Intergenic
1036002786 8:4626607-4626629 GACCGCAGGGGGCAGGGTGTGGG + Intronic
1036561435 8:9903282-9903304 GGCCGCGGGCGCGAGGGGAGGGG - Intergenic
1037821591 8:22137720-22137742 GAGCACAGGCAGGAGGGGCTTGG - Intergenic
1039064752 8:33598766-33598788 GACCACAGGTGTGAGAGGATGGG - Intronic
1039843020 8:41307115-41307137 TCCCGCAGGCTGCAGGGGATGGG + Intronic
1040384644 8:46906128-46906150 GATCCCAGGCTGGAGGGGACAGG - Intergenic
1047749110 8:127866589-127866611 GGTCGCAGGGGGAAGGGGATAGG + Intergenic
1049253155 8:141599955-141599977 GACAGCGGGCTGGATGGGATCGG + Intergenic
1049440509 8:142607334-142607356 GAGGGCAGGGGGGAGGGGAGGGG + Intergenic
1049545879 8:143230288-143230310 GTCTGCAGGTGGGAGGGGAAGGG + Intergenic
1049614151 8:143568993-143569015 GACAGCAGGCGGGAGGGGCGGGG + Intronic
1051681416 9:19611467-19611489 GAGAGGAGGCGGGAGGGGAAAGG + Intronic
1057605330 9:96494762-96494784 GACGGGAGGGGGGAGGGGACGGG - Intronic
1058403959 9:104650401-104650423 AACCACAGGTGGGAGGAGATGGG + Intergenic
1058478396 9:105364769-105364791 GTCCGCAGGCTGGAGGGGAAGGG + Intronic
1059627288 9:116080776-116080798 AACCTCAGGCGGGCTGGGATGGG - Intergenic
1061102156 9:128500237-128500259 GGCCTCAGGCAGGAGGAGATCGG - Exonic
1061490036 9:130939516-130939538 GACCGCGGGCGCGAGGGCACGGG - Intergenic
1061816497 9:133200347-133200369 GCCCGCGGGCGGGAGGGGGCCGG + Intergenic
1062244962 9:135561536-135561558 GGCCTCAGGCGGGAGGGGCCTGG - Intergenic
1062344936 9:136110248-136110270 GATCGCACGCTGGAGGGGACAGG + Intergenic
1062345823 9:136114731-136114753 GACGGGAGGCGGGAGGGGGCTGG - Exonic
1062733642 9:138122427-138122449 GACCTCGGGACGGAGGGGATGGG + Exonic
1203468303 Un_GL000220v1:105976-105998 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203476124 Un_GL000220v1:149948-149970 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1187505440 X:19874986-19875008 GAAGGCAGGAGGGAGGAGATAGG + Intronic
1189382865 X:40514069-40514091 GAGTGAAGGAGGGAGGGGATGGG + Intergenic
1191902835 X:66056629-66056651 CACAGCAGGCGGGCGGGGGTGGG + Intergenic
1195342555 X:103919327-103919349 GAGCCGAGGCGGAAGGGGATGGG - Intronic
1195564079 X:106322130-106322152 GACCCCACAAGGGAGGGGATAGG + Intergenic
1198059725 X:133033083-133033105 GACAGCAGGCAGAAGGGGAAAGG + Intronic
1199765116 X:150935844-150935866 GACAGCTGGCAGGAGGGGGTTGG + Intergenic