ID: 1002023822

View in Genome Browser
Species Human (GRCh38)
Location 5:176383508-176383530
Sequence GAGGCCCCCAACCTGGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002023822_1002023826 -3 Left 1002023822 5:176383508-176383530 CCAGAAGCCAGGTTGGGGGCCTC 0: 1
1: 0
2: 0
3: 20
4: 189
Right 1002023826 5:176383528-176383550 CTCGGATTCACTTCAGACCGAGG 0: 1
1: 0
2: 0
3: 0
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002023822 Original CRISPR GAGGCCCCCAACCTGGCTTC TGG (reversed) Intronic
900114669 1:1023415-1023437 GTGGTCCCCAAGCTGCCTTCAGG + Intronic
900958859 1:5906699-5906721 GAGCCCGCCATCCTGGCTTCAGG - Intronic
901440103 1:9272553-9272575 GAGGCCCGCAGGCTGACTTCAGG - Intergenic
902571167 1:17347865-17347887 CATGCCCCCATCCTGGCGTCGGG + Intronic
902635095 1:17729739-17729761 GAGGCCCCCAACATGACTCAGGG + Intergenic
902739277 1:18423504-18423526 GAGCCACCCAGCCTGGCCTCAGG - Intergenic
904013710 1:27404982-27405004 GCGGCCCCTCACCTGACTTCAGG - Exonic
906276893 1:44523399-44523421 GAGGCTCCCAACTAGGGTTCAGG - Intronic
907865735 1:58397520-58397542 GTGGCCTTCAACCTGGTTTCAGG - Intronic
911178725 1:94842723-94842745 GCGGACCCCACACTGGCTTCAGG + Intronic
913202410 1:116505631-116505653 GAGCCACCGCACCTGGCTTCTGG + Intergenic
913660810 1:121004857-121004879 GGGACCCCCAATCTGGCTTCGGG - Intergenic
914012173 1:143788013-143788035 GGGACCCCCAATCTGGCTTCGGG - Intergenic
914165657 1:145173121-145173143 GGGACCCCCAATCTGGCTTCGGG + Intergenic
914650804 1:149696676-149696698 GGGACCCCCAATCTGGCTTCGGG - Intergenic
917452091 1:175155771-175155793 GAAGCTCCCAGGCTGGCTTCAGG - Intergenic
922022170 1:221716347-221716369 TATGCCCACAACCTGTCTTCAGG - Intronic
923038968 1:230306102-230306124 GAGCCACCGTACCTGGCTTCAGG + Intergenic
924568547 1:245218133-245218155 GGGGCCCCCACCATGGCCTCTGG - Intronic
1062768390 10:82074-82096 GAGGGCCCCTCCCTGGGTTCTGG - Intergenic
1063329993 10:5148066-5148088 GAGGCCTCACACCTGGCTACTGG - Intergenic
1065047125 10:21754563-21754585 GGGGCCCCCAGCCTGGCATATGG + Intergenic
1066616714 10:37302216-37302238 GAGGCCCCCAGCATAGTTTCTGG + Intronic
1068159709 10:53248323-53248345 GAGGCCCACTAACTGGGTTCTGG + Intergenic
1069725564 10:70575644-70575666 GAGGCTCCCAGCCTCGCTGCAGG - Intergenic
1070765223 10:79052593-79052615 GAGCTCTCCAACCTGGCTGCTGG + Intergenic
1071699864 10:87919648-87919670 CAGTCCCCAAACCTGGTTTCAGG + Intronic
1072321552 10:94254961-94254983 GGGTCCCCCAACTTGGCTGCCGG + Exonic
1072740467 10:97906100-97906122 GGGGGCCCCACCCTGCCTTCTGG - Intronic
1074962173 10:118456579-118456601 GAGGCCCCCAGCCTGGTACCTGG - Intergenic
1076092524 10:127700160-127700182 GCGGCACCCAATCTGGCATCAGG + Intergenic
1077326714 11:1967126-1967148 CAGGCACCCTGCCTGGCTTCAGG + Intronic
1077888487 11:6402941-6402963 AGGGCCCCCAACCTGGCTGTTGG + Intronic
1079719970 11:23798255-23798277 CAGGCACCCAATCTGGCTTGGGG - Intergenic
1080682005 11:34486093-34486115 CAGGCCCCCACCCCAGCTTCTGG - Intronic
1081834843 11:46144868-46144890 GCAGCCCCCAATCTGCCTTCTGG + Intergenic
1082810088 11:57474411-57474433 GAGGCCTCCGACCAGGCTCCTGG + Intronic
1083173635 11:60936629-60936651 GAGGCCCCTACCCTGGCCCCTGG + Exonic
1084409544 11:68998575-68998597 GAGGCTCCCAGCCTGGCAGCCGG - Intergenic
1087944381 11:104140549-104140571 GAGTCCCCCAACTTTCCTTCAGG + Intronic
1089453518 11:118612566-118612588 GTGGGCCCCAGCCTGGGTTCCGG + Intronic
1090910975 11:131118975-131118997 GAGCCCCCGCACCTGGCCTCTGG + Intergenic
1091103691 11:132898850-132898872 GAGGCCTCCAAAGTGGCTGCGGG - Intronic
1202809695 11_KI270721v1_random:22306-22328 CAGGCACCCTGCCTGGCTTCAGG + Intergenic
1092057645 12:5521173-5521195 CTGTCCCCCAACCTGTCTTCAGG - Intronic
1092237204 12:6817608-6817630 GAGCCCCCCTCCCTGGCTCCTGG + Intronic
1096556273 12:52406041-52406063 GAGGTACCCTGCCTGGCTTCGGG - Exonic
1097085692 12:56466632-56466654 GAGCCACCACACCTGGCTTCTGG - Intronic
1104029379 12:125053553-125053575 GGCGCCCCCAACCTGCCTCCCGG + Intergenic
1110695875 13:78487725-78487747 GTGACCCCAAACTTGGCTTCTGG + Intergenic
1112315720 13:98360533-98360555 GAGCCCCCATCCCTGGCTTCTGG - Intronic
1112332855 13:98490040-98490062 GAGGACACCATCTTGGCTTCTGG - Intronic
1112825767 13:103391000-103391022 GAGGCCAGCAACCTTGGTTCTGG - Intergenic
1113470319 13:110540005-110540027 GTGGCCCACTACGTGGCTTCTGG + Intronic
1113732170 13:112649342-112649364 AAGGACCCCACCCTGCCTTCTGG - Intronic
1116999348 14:51356235-51356257 GAGCCCCCCATGCTGGCTCCAGG - Intergenic
1119563207 14:75607105-75607127 GAGGCCCCAAACATGGCTGCTGG - Intronic
1119582813 14:75802802-75802824 GAGGCCCCGAACCCAGCTTGTGG + Intronic
1119664870 14:76478255-76478277 GAAGCCCCCAGCCTGGCATGGGG + Intronic
1121415491 14:93776443-93776465 GTAGCCCCCAGCCTGGTTTCAGG + Intronic
1122028103 14:98892343-98892365 GAGTCCCCCTGCCAGGCTTCAGG + Intergenic
1122048736 14:99041177-99041199 GAGGCCGCCACCGTGGCTCCCGG + Intergenic
1124371575 15:29107349-29107371 AAGGCCCCCACCCTAGCTGCCGG - Intronic
1125733688 15:41909013-41909035 GAGGCCACCCATCTGGCTTCTGG - Intronic
1127282863 15:57506569-57506591 GAGGCCCCGAACCTGCCAGCTGG - Intronic
1127783464 15:62335856-62335878 GAGGCACTGCACCTGGCTTCAGG - Intergenic
1128525965 15:68412471-68412493 CAGGCACCCAACATGGATTCTGG + Intronic
1129680951 15:77658052-77658074 GATGCCCCCAACCTGGGGTCTGG + Intronic
1129992393 15:79976407-79976429 GAGGCTGCAAACCTGGCTCCAGG - Intergenic
1130679105 15:85980896-85980918 GTGGCCTCCAAACTGGCTCCCGG + Intergenic
1130988282 15:88858904-88858926 GATGCCCCGAACCCAGCTTCAGG - Exonic
1132303159 15:100788912-100788934 GAGGCCCCCAGGCAGGCTCCTGG + Intergenic
1132832087 16:1933350-1933372 GTGGCACCCAGCCTGTCTTCCGG - Intergenic
1132983580 16:2752085-2752107 GAGGCCCCGAGCCTGGCTGCAGG - Intergenic
1136022931 16:27451323-27451345 GAGTCCCCCAATCTGGCCTCAGG - Exonic
1141614438 16:85202539-85202561 GAGGCCCCCAGCCAGGCTGTGGG + Intergenic
1141614537 16:85202866-85202888 GAGGCCCACAGCCTGTCTCCAGG - Intergenic
1141631479 16:85290318-85290340 CAGGCCCCCAACCTGGAGTGCGG + Intergenic
1141750259 16:85953650-85953672 CAGGCCCCCACCTCGGCTTCGGG - Intergenic
1143344875 17:6242154-6242176 GAGGCCCGCCAGCTGGCCTCTGG - Intergenic
1143420670 17:6789221-6789243 ATGGCCCCAAACCTGGCTTTTGG + Intronic
1143805808 17:9425470-9425492 GAGTGCCCCCACCTTGCTTCAGG - Intronic
1144821972 17:18081486-18081508 CAGGCCCCCAACCTGGGTCAGGG + Intergenic
1145840249 17:27988595-27988617 GAGGCCTCTGACCTGGCTTGGGG - Intergenic
1151680294 17:75619509-75619531 CAGGCCCCCAGCCTGGATCCTGG + Intergenic
1151806791 17:76410684-76410706 GTGGCCCCCAGCATAGCTTCGGG - Intronic
1152409772 17:80117538-80117560 GAGGCCCCCATGCTGTCCTCAGG - Intergenic
1152629364 17:81403188-81403210 CAGCCCCCCGTCCTGGCTTCTGG + Intronic
1153028165 18:689794-689816 GAGGTCCCCTACGTAGCTTCAGG + Intronic
1156714198 18:39987093-39987115 TAGGAACCCAACCTAGCTTCTGG + Intergenic
1157395152 18:47335286-47335308 GAGGCCCAGAGCCTGGGTTCTGG - Intergenic
1160956024 19:1692058-1692080 GAGGTCCCCAGCCTGGCGCCCGG + Intergenic
1161285026 19:3464308-3464330 GAGGCCCCCTACACGGCTGCGGG - Intronic
1161594603 19:5144657-5144679 GAAGCCCCAAAGCTGGCTGCGGG - Intronic
1162299847 19:9838348-9838370 CAGGCCCTCACCCTGGCTTCTGG + Intronic
1164920999 19:32088704-32088726 GAGGCCCTCTCCCTGCCTTCTGG - Intergenic
1164931830 19:32181843-32181865 GAGGCTGCCCACCTGGCTTTGGG - Intergenic
1165094430 19:33402654-33402676 GAGGGGGCCCACCTGGCTTCGGG - Intronic
1165439789 19:35818614-35818636 GAGGCACACAACCTGGATTGGGG + Intergenic
1166334275 19:42095954-42095976 GAAGGCCCCACCCTGACTTCGGG - Intronic
1166710416 19:44933489-44933511 GAGCCACCGAGCCTGGCTTCAGG - Intergenic
1167291927 19:48629318-48629340 GAGGCCCCTACCCGGGCATCAGG - Exonic
925476909 2:4227321-4227343 GAAGTCATCAACCTGGCTTCAGG - Intergenic
929790711 2:45020602-45020624 GCTGCCCCCTATCTGGCTTCAGG + Intergenic
930422709 2:51174683-51174705 GAGGCCCCCAACCCTGGTACTGG + Intergenic
931258922 2:60599813-60599835 GAGGGCCCCAACCTGCCTTAGGG + Intergenic
932494752 2:72140788-72140810 TAGTCCCCCACCTTGGCTTCAGG + Intronic
934519728 2:95012377-95012399 GAGGCCCACACTCTGGCTCCAGG + Intergenic
934852752 2:97711882-97711904 GAGGTCCCCAAGGAGGCTTCGGG + Intergenic
937285909 2:120750993-120751015 GGGGCCACCATCCTGGCTTCCGG - Intronic
937340390 2:121087267-121087289 GTGGCCTCCCACGTGGCTTCAGG - Intergenic
941488487 2:166112744-166112766 GAGGGCCCCTACATAGCTTCAGG + Intronic
945898178 2:215508317-215508339 GAAGCCCCCACCCAGGCTGCTGG + Intergenic
948058225 2:235025343-235025365 GGGGCCCCCACCATGTCTTCTGG - Intronic
948232171 2:236356478-236356500 GTGGCCCCCCAGCTGGCCTCTGG - Intronic
948232273 2:236358842-236358864 GTGGCCCCCCAGCTGGCCTCTGG + Intronic
948927348 2:241107841-241107863 GAAGCCCCCAGCCTTGCATCTGG + Intronic
1168848248 20:959647-959669 GAGGGTCACAACCTGGCCTCTGG - Exonic
1170987907 20:21274969-21274991 CAGGCCCCAAACCTGACTTCTGG - Intergenic
1171300256 20:24053403-24053425 GAGGAGCCCAACCAAGCTTCTGG + Intergenic
1173160299 20:40647367-40647389 GACCCCCTCAACCTGGCCTCTGG - Intergenic
1173626615 20:44477462-44477484 GAGGCACCTAACCTGGCTGGGGG + Intronic
1173918267 20:46725649-46725671 GAGGCCCCCAAGCTGGGCCCGGG + Exonic
1173974055 20:47173922-47173944 GAGACCCGCCCCCTGGCTTCAGG + Intronic
1175443923 20:59007594-59007616 GAGGCCCCCAGCCTCACATCTGG + Intergenic
1176079165 20:63263019-63263041 GAGGGCCCCCACCTGTCTGCAGG - Intronic
1176133616 20:63508534-63508556 GAAGCTGCCGACCTGGCTTCGGG + Intergenic
1177169563 21:17640478-17640500 GAGGGCTCCACCCTGGCTACAGG + Intergenic
1178973425 21:37201197-37201219 TGGGCCTCCAACCTGGCCTCAGG - Intronic
1179722792 21:43324954-43324976 GATGCCCCAAACATGGCTTGAGG - Intergenic
1180221200 21:46359235-46359257 GAGCCACCGAACCTGGCTCCAGG + Intronic
1180934853 22:19618702-19618724 GAAACCCCCAACCTGGATTCTGG - Intergenic
1181168133 22:20994137-20994159 GAGGCCCCCGGCGTGGCTGCTGG + Exonic
1181309679 22:21937840-21937862 CAGCCCCGCAACCTCGCTTCTGG + Intronic
1181963878 22:26643081-26643103 GAGGCCCCCACCCGGCCTGCGGG + Intergenic
1182092722 22:27606952-27606974 GAGGCCCTTGAGCTGGCTTCTGG + Intergenic
1182224701 22:28787617-28787639 GAGTACCCAAACCAGGCTTCAGG + Exonic
1182275880 22:29188337-29188359 CAGGCCCCTCTCCTGGCTTCGGG + Intergenic
1183459649 22:37942098-37942120 GATGGCCCCAACATGGCCTCTGG - Exonic
1183582747 22:38735520-38735542 GTGGGCCCCAACCTAGCATCAGG + Exonic
1184597683 22:45524229-45524251 GAGGCCCCCACCCTCTCTCCTGG + Intronic
1185315708 22:50178328-50178350 GAAGCCCCCCTCCTGGCTCCGGG - Exonic
952514532 3:34090727-34090749 TGGGCCCCCAACTTGGGTTCTGG - Intergenic
952956534 3:38561171-38561193 GCATCCCCCAACCTGGCATCTGG - Intronic
952958364 3:38574631-38574653 GAGGCCCCAGCCCTGGCCTCAGG - Intronic
953152983 3:40342162-40342184 CAGACCTCCAACCTGACTTCAGG - Intergenic
954216757 3:49129008-49129030 GAGGCCCCACACCTGCCCTCGGG + Exonic
954274565 3:49533869-49533891 GAGGCCCCCAATCAGGCTCTGGG - Exonic
954398080 3:50303498-50303520 TAGGCCCCCATCCTGGGGTCAGG - Exonic
954663160 3:52236869-52236891 GAGGCCCCAAGCCTGGCCTCTGG + Intronic
955744100 3:62122909-62122931 AGGGCCCCCAACCTGTCTTGTGG + Intronic
959906268 3:111714086-111714108 GAGGCCCCCAACCAAGCCCCGGG - Exonic
960860476 3:122147752-122147774 CAGGCCACCAACCTGGCACCAGG + Intergenic
961013051 3:123448581-123448603 GAGACCCCCGGCCCGGCTTCCGG - Exonic
961426063 3:126849195-126849217 CAGGTCGCCAGCCTGGCTTCAGG + Intronic
961535150 3:127566065-127566087 GATGCCCCCAACTTCCCTTCTGG - Intergenic
964488314 3:157208645-157208667 GAGGCCTCCAACCAGGGATCTGG + Intergenic
966983135 3:185155760-185155782 CAGGCCCCCAACCTGTCCACTGG + Intergenic
968641569 4:1717504-1717526 CAGGCCCCCCACCTGGCTGCTGG + Exonic
968736078 4:2297199-2297221 GTGGCCCCCAGCCTGGCTCCCGG - Intronic
969503738 4:7570793-7570815 GAGGCCTGGACCCTGGCTTCGGG - Intronic
969866135 4:10078152-10078174 GAGGCCCTCAAGCTGGCTGGTGG + Intronic
984079228 4:175223171-175223193 CAGGTCCCCAACCTAACTTCTGG + Intergenic
985880680 5:2636777-2636799 CAGATCCCCCACCTGGCTTCAGG + Intergenic
990067357 5:51734857-51734879 GTGGCCCCCAACCTGGCCGCAGG + Intergenic
991645835 5:68799566-68799588 GAGGCCCCAGGCCTGGGTTCAGG - Intergenic
995724652 5:115170172-115170194 GAGCCCCCCAGCCTGGCATAGGG - Intronic
996820401 5:127620122-127620144 GAGGCCCCCAAGGTGTTTTCTGG - Intergenic
998253396 5:140567403-140567425 GGGGCCCCCACCCTGGCGCCAGG + Exonic
1000153211 5:158523963-158523985 GTGGCTCCCAATCTGGCTTAAGG - Intergenic
1002023822 5:176383508-176383530 GAGGCCCCCAACCTGGCTTCTGG - Intronic
1002085799 5:176774681-176774703 GAGGCCCCCACAGTGGCTTTAGG + Intergenic
1002182964 5:177441077-177441099 TGGGCCCCTAACCTGGCTCCAGG + Intronic
1004411908 6:15389017-15389039 GAGGCTCCCAGGCTAGCTTCTGG + Intronic
1005136087 6:22570571-22570593 GAGGCCACCATCCCAGCTTCCGG + Exonic
1012419854 6:99052787-99052809 GAGGCCCCACACCTGGCTAGTGG - Intergenic
1018763333 6:166909429-166909451 GAGACCCTCAACCTGGTGTCTGG - Intronic
1019188894 6:170238599-170238621 CAGTCCCCCAACCTGCCTCCGGG - Intergenic
1021397904 7:20172934-20172956 GAAGACCCCAACCTGGCACCAGG - Intronic
1021675948 7:23081035-23081057 TGGGCCCCAAACCTGCCTTCAGG - Intergenic
1021823379 7:24520023-24520045 GAGGCCATCACCCGGGCTTCTGG + Intergenic
1022046800 7:26628108-26628130 GTGGCCGCCACCCTGGCTGCTGG - Intergenic
1022476583 7:30714842-30714864 GAGGGCCCCAGCCTGGTCTCTGG - Intronic
1023075749 7:36481333-36481355 TAGGCCCCCAATCTCTCTTCTGG + Intergenic
1023888225 7:44375628-44375650 CAGGCCCCCACCCTTCCTTCGGG - Intergenic
1023931966 7:44711655-44711677 CCGGCCCCCAACCTGGCTCATGG + Intergenic
1026111445 7:67461858-67461880 GGGGAGCCCAACCTGGTTTCTGG + Intergenic
1029123308 7:98282049-98282071 GAGGTCCCCGGGCTGGCTTCGGG + Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1033245632 7:139714465-139714487 CGGGCCCCCATCCTGGCTGCAGG - Intronic
1034425175 7:151010277-151010299 GTGGCCCCCAACCTGGCTGAGGG - Exonic
1035058290 7:156051277-156051299 GAGGCCGCTATCCTGGCCTCTGG - Intergenic
1035373151 7:158391971-158391993 CAGGCCCCCAGGGTGGCTTCAGG + Intronic
1036939788 8:13040380-13040402 TAGGTCACCCACCTGGCTTCTGG - Intergenic
1048433457 8:134392346-134392368 GAGCCACCACACCTGGCTTCTGG + Intergenic
1049373231 8:142277534-142277556 GATGCCCCCACCCTGTCCTCAGG + Intronic
1060051566 9:120382204-120382226 GAGGCGCCCAGGCTGGCTGCAGG + Intergenic
1061245366 9:129398779-129398801 GAGGCCCACCACCTGGTTTGTGG - Intergenic
1061281044 9:129597715-129597737 GAAGCCCCCAGTCTGGGTTCAGG - Intergenic
1061442189 9:130613209-130613231 AAGGCCTCCTATCTGGCTTCTGG + Intronic
1061860264 9:133464357-133464379 GAGGCGCCCAGCCCAGCTTCAGG + Intronic
1061873978 9:133534907-133534929 GAGGTGGCCTACCTGGCTTCGGG - Intronic
1061911609 9:133728046-133728068 GAGGCCTCCTCCCTGGCTCCGGG - Intronic
1186981229 X:14959798-14959820 GATGCCTCAAAGCTGGCTTCTGG - Intergenic
1196176579 X:112645083-112645105 GATGCCCCAGACTTGGCTTCTGG - Intronic
1197885123 X:131210335-131210357 AAGGCCACCCACTTGGCTTCAGG - Intergenic
1199565526 X:149211822-149211844 AAGGCCCTGAACCAGGCTTCTGG + Intergenic
1199762606 X:150916550-150916572 CAGGCCCCAATACTGGCTTCAGG - Intergenic
1200092501 X:153642489-153642511 GAGGCCGCCACCCGGGGTTCCGG + Intronic
1200234321 X:154460915-154460937 GACCCCCGCAACCTGGGTTCAGG - Intronic