ID: 1002029337

View in Genome Browser
Species Human (GRCh38)
Location 5:176416443-176416465
Sequence CGCTGTCACCCGAGCCGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 79}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002029324_1002029337 13 Left 1002029324 5:176416407-176416429 CCCGCGCCTGCCCCGCGCTGCGT 0: 1
1: 0
2: 4
3: 26
4: 217
Right 1002029337 5:176416443-176416465 CGCTGTCACCCGAGCCGCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 79
1002029330_1002029337 2 Left 1002029330 5:176416418-176416440 CCCGCGCTGCGTCCGGCGGCCGC 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1002029337 5:176416443-176416465 CGCTGTCACCCGAGCCGCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 79
1002029331_1002029337 1 Left 1002029331 5:176416419-176416441 CCGCGCTGCGTCCGGCGGCCGCG 0: 1
1: 1
2: 2
3: 17
4: 155
Right 1002029337 5:176416443-176416465 CGCTGTCACCCGAGCCGCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 79
1002029332_1002029337 -10 Left 1002029332 5:176416430-176416452 CCGGCGGCCGCGACGCTGTCACC 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1002029337 5:176416443-176416465 CGCTGTCACCCGAGCCGCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 79
1002029329_1002029337 3 Left 1002029329 5:176416417-176416439 CCCCGCGCTGCGTCCGGCGGCCG 0: 1
1: 0
2: 2
3: 18
4: 134
Right 1002029337 5:176416443-176416465 CGCTGTCACCCGAGCCGCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 79
1002029325_1002029337 12 Left 1002029325 5:176416408-176416430 CCGCGCCTGCCCCGCGCTGCGTC 0: 1
1: 0
2: 0
3: 31
4: 284
Right 1002029337 5:176416443-176416465 CGCTGTCACCCGAGCCGCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 79
1002029327_1002029337 7 Left 1002029327 5:176416413-176416435 CCTGCCCCGCGCTGCGTCCGGCG 0: 1
1: 0
2: 0
3: 24
4: 231
Right 1002029337 5:176416443-176416465 CGCTGTCACCCGAGCCGCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002029337 Original CRISPR CGCTGTCACCCGAGCCGCGG GGG Exonic
902031593 1:13426901-13426923 CGCTTTAACCCGAGAGGCGGAGG - Intergenic
907095679 1:51778119-51778141 CTCTGTCACCCAAGCTGCAGTGG - Intronic
917028891 1:170668500-170668522 AGCTGGCTCCCGGGCCGCGGCGG + Intronic
918116787 1:181504636-181504658 TGCTGTCACCGGAGCCCTGGGGG - Intronic
922239980 1:223749101-223749123 CTCGGTCACCGGAGCCGAGGAGG + Exonic
924815079 1:247434374-247434396 CGCAGTCACCCGAGCCGCCAAGG - Intronic
1064179165 10:13100102-13100124 GGCTGTCAGCTGAGCCGCGCTGG + Intronic
1065657809 10:27970064-27970086 CGCTGTCACCCAGGCTGCAGTGG - Intronic
1065807647 10:29409741-29409763 CGCTGTCTCTTGGGCCGCGGTGG + Intergenic
1069582143 10:69573376-69573398 CGCTCTCTCTCGAGGCGCGGCGG + Intergenic
1071784175 10:88880527-88880549 TGCTGCAACCCGGGCCGCGGTGG - Exonic
1073124341 10:101140346-101140368 CGCTGGGACCCGCGGCGCGGCGG + Intergenic
1075645191 10:124092416-124092438 CGCCGCCTCCCGAGACGCGGCGG + Intronic
1077358183 11:2128195-2128217 GGCTGTCACCCAAGCCTCTGAGG - Intergenic
1079035057 11:17013946-17013968 CGCTCGCACCTGTGCCGCGGGGG - Intronic
1083129916 11:60615680-60615702 CGCGGACACCTGAGGCGCGGTGG - Intergenic
1083227501 11:61294354-61294376 TGCTTTCCCCCGGGCCGCGGTGG - Intronic
1084973029 11:72781688-72781710 CGCTGGCACCCCGGCCCCGGCGG - Intronic
1094624210 12:32107169-32107191 CGCTGCCACCAGAGCCGGCGGGG + Intronic
1097014355 12:55974522-55974544 ACCTGTCGCCCGAGCCCCGGGGG + Intronic
1102299600 12:111761504-111761526 CGCTTTAACCCGAGAGGCGGAGG - Intronic
1103521194 12:121537729-121537751 CGCTGACACCCGAGGGGCGCGGG + Intronic
1104974901 12:132548049-132548071 GGCTGTCAGCCGAGCCCAGGAGG - Intronic
1116005765 14:39288507-39288529 CGCTGTCACCCGGGCTGGAGTGG + Intronic
1122226876 14:100285509-100285531 CGCGGGGACCCGAGGCGCGGTGG + Intergenic
1122854761 14:104554759-104554781 AGCTGTCACCCCAGCCCCCGCGG + Intronic
1125578556 15:40770562-40770584 CTCTGTCGCCGGAGCCGCCGTGG - Exonic
1126883862 15:53128901-53128923 AGCTCTCACCCCAGCTGCGGTGG + Intergenic
1128987789 15:72233777-72233799 CGCTTGAACCCGAGACGCGGAGG + Intergenic
1129220623 15:74129754-74129776 CACTATCCCCCAAGCCGCGGTGG - Exonic
1131215111 15:90529919-90529941 CGCTGGCTCCGGGGCCGCGGCGG + Intronic
1135088921 16:19496804-19496826 CGCTGGAACCCGAGAGGCGGAGG + Intronic
1138874588 16:60934276-60934298 CGCTGGAACCCGAGAGGCGGAGG + Intergenic
1141490336 16:84368390-84368412 CGCTGTCCCCAGAGCCCCTGGGG + Intergenic
1141657566 16:85424247-85424269 CGCTGGCACCGGAGGGGCGGGGG - Intergenic
1146019816 17:29267980-29268002 CGCTGGAACCCGAGAGGCGGAGG - Intronic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1148796578 17:50200099-50200121 CGCTGTCACCCGCGCTGATGAGG - Intronic
1152729117 17:81961225-81961247 CGCGGGCACCCGGGCCGCCGCGG - Exonic
1153285161 18:3450013-3450035 CGCTGTCACTCGTCCCTCGGGGG - Intronic
1153805313 18:8705341-8705363 CGCGGTCACCGGTGCCGCGGCGG - Intergenic
1158579808 18:58671547-58671569 CGCTCGCCTCCGAGCCGCGGAGG - Exonic
1158589675 18:58768810-58768832 GGCTGTCATCCCAGCCGCGCTGG - Intergenic
1160742406 19:693265-693287 CTCTGTCACCCAGGCCGCAGTGG + Intronic
1160948359 19:1653809-1653831 CGCTTTCACCCGAAAGGCGGAGG + Intergenic
1162393484 19:10403499-10403521 CGCCGCCACCCGAGCCGGAGCGG - Exonic
1166452348 19:42913188-42913210 CTCTGTCACCCCAGCTGCAGTGG + Intronic
1167647707 19:50714654-50714676 CTCTGTCACCCGGGCTGCAGTGG - Intronic
934296831 2:91749081-91749103 CGCCGCCACCAGCGCCGCGGCGG + Intergenic
934553512 2:95276026-95276048 CGCTGCCACCGGCGCTGCGGGGG + Exonic
945467847 2:210190998-210191020 CGCTCTAACCCGAGAGGCGGAGG - Intronic
948876554 2:240832679-240832701 CGCTCTCACCGCAGCCGGGGAGG - Intergenic
1172277222 20:33686276-33686298 GCCTGTCACCCGGGCCGCGCGGG - Exonic
1175691221 20:61067287-61067309 AGCTGTCACCCCAGCAGCGTTGG - Intergenic
1176156758 20:63626275-63626297 CGCAGGCACCCGACCCGCAGGGG - Intronic
1176156861 20:63626559-63626581 CGCAGGCACCCGACCCGCAGGGG - Intronic
1179188363 21:39102698-39102720 CTCTGTCACCCAAGCTGTGGGGG - Intergenic
1179411708 21:41167918-41167940 CGCTGTGACCTTGGCCGCGGGGG + Exonic
1179626878 21:42653910-42653932 CGCTGTCACCCGGGGGGAGGAGG - Intronic
1180289276 22:10782112-10782134 CTCTGTCTCCCGAGCAGCTGGGG + Intergenic
1184229669 22:43151793-43151815 CGCTGGAACCCCGGCCGCGGAGG - Intronic
1184932372 22:47690804-47690826 CAGTGTCACCCCAGCAGCGGGGG + Intergenic
959530738 3:107431549-107431571 CGCTTCCGCCCGAGCCCCGGCGG - Intergenic
966805706 3:183805752-183805774 CGCTGTCACCCAAGCTGGAGAGG - Intronic
969051932 4:4379379-4379401 ATCTGTCACCCAAGCCTCGGTGG + Intronic
981938442 4:150257505-150257527 CGCTGGAACCCGGGCCGAGGAGG - Intergenic
991054448 5:62306345-62306367 CGCTGTCGCCCGGGCCGGCGCGG + Intronic
993719740 5:91310705-91310727 CGCTGGAACCCGAGAGGCGGAGG - Intergenic
1002029337 5:176416443-176416465 CGCTGTCACCCGAGCCGCGGGGG + Exonic
1010926599 6:81752597-81752619 CGCTGCCACCCCAGCTGCGGTGG + Exonic
1012211282 6:96521724-96521746 CGCTTGCGCCCGAGGCGCGGGGG - Intronic
1016034561 6:139373425-139373447 TGCTGCCGCCCGAGCCGCCGGGG + Exonic
1018005005 6:159613527-159613549 CGCTGTCACCCAGGCAGTGGGGG - Intergenic
1029456026 7:100673047-100673069 CGCTTGCACCCGGGCGGCGGAGG + Intergenic
1029952347 7:104600463-104600485 TGCTGTCACCAGAGCCACTGGGG + Intronic
1035023097 7:155810099-155810121 CACTGAAACCCTAGCCGCGGGGG + Intronic
1038034739 8:23677665-23677687 CGCTGGAACCCGAGAGGCGGAGG - Intergenic
1039936469 8:42051255-42051277 GGCTGTCAGCCCAGCCGCCGAGG - Intronic
1047382127 8:124373047-124373069 CGCTGCCACCCCAGCCCCGACGG + Intergenic
1049762396 8:144337228-144337250 CGCGGTTCCCCGAGCCGCGCGGG - Intergenic
1053376601 9:37612430-37612452 CGCTGGAACCCGAGAAGCGGAGG - Intronic
1056299641 9:85227768-85227790 CTCTGTCATCCGAGCAGCTGTGG + Intergenic
1061881229 9:133570246-133570268 CGTTGTCACCAGAGTCGCCGTGG + Intronic
1187516546 X:19976472-19976494 CGCTGGAACCCGAGAGGCGGAGG - Intergenic