ID: 1002029390

View in Genome Browser
Species Human (GRCh38)
Location 5:176416619-176416641
Sequence GGTCGCCGAGCAGCGGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002029387_1002029390 -9 Left 1002029387 5:176416605-176416627 CCGCAGGGCCGGGAGGTCGCCGA 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1002029390 5:176416619-176416641 GGTCGCCGAGCAGCGGCCGCAGG 0: 1
1: 0
2: 2
3: 17
4: 132
1002029383_1002029390 5 Left 1002029383 5:176416591-176416613 CCGCGGGGGCGGGGCCGCAGGGC 0: 1
1: 0
2: 10
3: 72
4: 482
Right 1002029390 5:176416619-176416641 GGTCGCCGAGCAGCGGCCGCAGG 0: 1
1: 0
2: 2
3: 17
4: 132
1002029373_1002029390 24 Left 1002029373 5:176416572-176416594 CCGGAATGCGGTGACGTCACCGC 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1002029390 5:176416619-176416641 GGTCGCCGAGCAGCGGCCGCAGG 0: 1
1: 0
2: 2
3: 17
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002029390 Original CRISPR GGTCGCCGAGCAGCGGCCGC AGG Intergenic
901066613 1:6497392-6497414 GGCCGCAGAGCCGCCGCCGCCGG + Intronic
901630181 1:10644161-10644183 GGCCGCCCAGCAGAGGCCCCTGG - Intronic
903016786 1:20366680-20366702 GGTCGCGGCGCGGCGTCCGCGGG - Intergenic
903849164 1:26295963-26295985 TGTCCCCGAGCAGTGGCCACAGG - Intronic
905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG + Intergenic
907160969 1:52368631-52368653 GGTCCCCGAGCCGCGGCGGGGGG - Intergenic
907905673 1:58782513-58782535 GCGCGCTGAGCAGCGGCGGCGGG - Exonic
908523380 1:64966098-64966120 GGTCGCCGGGCGGGGGCCCCCGG - Intronic
909548158 1:76869168-76869190 GGATCCCGAGCAGTGGCCGCGGG - Intronic
913186282 1:116373263-116373285 GGGCGCAGAGCAGCGGCGGGAGG + Intronic
915359486 1:155277593-155277615 GGAGGCAGAGCAGCGGCCGGCGG + Exonic
923990946 1:239436348-239436370 TGTCGCAGAGCAGAGGCTGCAGG + Intronic
1067132129 10:43574437-43574459 GGCCGCCGAGCTGCGGAAGCCGG - Intronic
1067369740 10:45672473-45672495 GGTCCCCGGGCAGCAGCGGCCGG + Intronic
1068954015 10:62805473-62805495 GGGCGGCGGGCAACGGCCGCGGG + Exonic
1069486646 10:68827896-68827918 GGAAGCCGCGCGGCGGCCGCAGG - Exonic
1069486733 10:68828232-68828254 GGAAGCCGCGCGGCGGCCGCAGG - Intronic
1069544504 10:69318854-69318876 AGCCGCCGAGCAGCCGCCGGAGG + Intronic
1073110641 10:101061367-101061389 CGGAGCCGACCAGCGGCCGCAGG - Intergenic
1074137939 10:110644198-110644220 GGCCGCAGAGCAGCTCCCGCCGG + Intergenic
1074865949 10:117544317-117544339 GGGCGCCGAGCAGCCACAGCGGG + Intronic
1075645494 10:124093416-124093438 GGTCGGCGAGGAGCGGCGGTAGG - Intronic
1077090746 11:777258-777280 GGGCGCCGGGCAGGGGCCGGGGG - Intronic
1079297068 11:19242706-19242728 GGTCGCAGCGCAGCAGCTGCCGG + Intergenic
1079353481 11:19712744-19712766 GTGCGCCAATCAGCGGCCGCGGG - Intronic
1081807844 11:45900005-45900027 GGGAGCCGAGCAGGGGCCGCCGG - Intronic
1084438450 11:69157387-69157409 CTTCGCCCAGCAGCTGCCGCCGG + Intergenic
1094837907 12:34330806-34330828 GGTCTCCGCGCAGGGGCTGCTGG + Intergenic
1095998004 12:48105826-48105848 GGTGGCCGCGCTGTGGCCGCCGG - Intronic
1096154315 12:49333313-49333335 GGCGGCCGGGCAGCCGCCGCAGG + Intronic
1098320650 12:69239937-69239959 GGCCGCTGTGCAGCTGCCGCCGG + Intronic
1101227950 12:102708698-102708720 GGTGGCCAAGCAGGGGCCCCTGG + Intergenic
1101910476 12:108857368-108857390 GGACGCCGCGCCGAGGCCGCCGG - Intronic
1104865326 12:131950103-131950125 GGTCGCGTAGCCGCAGCCGCGGG + Intronic
1111672763 13:91348995-91349017 GGTCGCCGCGCGGCTGCCGCCGG + Intergenic
1113768441 13:112894613-112894635 GGACGCTGGGCAGGGGCCGCGGG - Intronic
1115687282 14:35809135-35809157 TGGCGGCGAGCGGCGGCCGCTGG - Exonic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1121279357 14:92688030-92688052 GTTCGCGGTGGAGCGGCCGCAGG + Exonic
1122418215 14:101560494-101560516 GGGCGCGGGGCAGCGGGCGCGGG - Intergenic
1122517639 14:102319873-102319895 GGGCCCCGAGCAGCTGCGGCAGG + Exonic
1122598064 14:102907257-102907279 GGCCCCCGAGCAGCGGTCTCTGG - Exonic
1123710202 15:22980838-22980860 GGTCGGCGCGCAGAGCCCGCTGG + Intronic
1124790144 15:32718945-32718967 TGGCGCCGGGCAGCGGCCACCGG + Intronic
1125329181 15:38565174-38565196 GTGCTCCGAGCAGCGGCCGCAGG - Intronic
1125727059 15:41873554-41873576 GGTGGAGGAGAAGCGGCCGCTGG - Exonic
1128160933 15:65422620-65422642 GGTCTGCGAGCTGCGGCCGGGGG - Intronic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1132805008 16:1771345-1771367 GGACGGCGTGCAGCGGCGGCTGG - Exonic
1133026618 16:2991443-2991465 GGTGGCTGGGCAGGGGCCGCAGG + Intergenic
1136913003 16:34159577-34159599 GGTCGGCGTGCAGCGCGCGCAGG + Intergenic
1142120096 16:88382963-88382985 GGACGCCGGCCGGCGGCCGCGGG - Intergenic
1142749283 17:1977822-1977844 GGGAGCCAACCAGCGGCCGCGGG + Intronic
1146126538 17:30235827-30235849 GAGCGCGGAGCCGCGGCCGCGGG - Exonic
1146208308 17:30922774-30922796 GGTCGCCGCGCAGCGGCCGGTGG + Intronic
1146794285 17:35770224-35770246 GGTCCCTGAGCCGCCGCCGCGGG - Exonic
1147139621 17:38453862-38453884 GGGCGCCTAGCAGCGGCCCCGGG + Intronic
1147967305 17:44200088-44200110 TGCTGCCGAGCTGCGGCCGCGGG - Intronic
1148048616 17:44758777-44758799 GGTGGCCGAGGAGAGGCCGCGGG + Intergenic
1148166954 17:45490480-45490502 GGTCGGAGAGGAGCGGGCGCGGG + Intronic
1148183145 17:45620798-45620820 GCGAGCCGGGCAGCGGCCGCGGG + Intergenic
1148751343 17:49947423-49947445 GGACGCCCAGCAGCAGCCCCAGG - Intergenic
1149997553 17:61412784-61412806 GGTCGCCGAGCTGGCGCTGCCGG - Exonic
1152225467 17:79090666-79090688 GGGCGCCGAGGAGCGGCCCCAGG - Intronic
1152423348 17:80205600-80205622 GGTCACCCAGCAGCGGCCCCCGG - Exonic
1152630012 17:81406696-81406718 GGCCCCAGAGCAGCTGCCGCGGG + Intronic
1152825042 17:82459201-82459223 GGTCACCGAGCAGCCGGTGCAGG + Intronic
1152834335 17:82519762-82519784 GGGGGCCGAGCGGAGGCCGCCGG - Exonic
1154303969 18:13217703-13217725 GGACGCGGCGCTGCGGCCGCCGG - Intronic
1156008601 18:32471031-32471053 GCGCGCCGAGCCGCGGGCGCTGG - Intergenic
1156473914 18:37394102-37394124 GGTCCCCGAGCATCTGCCGCGGG - Intronic
1157362960 18:47035362-47035384 GGTCGCCAGGCAGCGACCTCGGG + Exonic
1159608491 18:70499484-70499506 GGTCTCCGGGGAGCTGCCGCTGG + Intergenic
1160724977 19:613867-613889 GCTCGCCGTGCGGCGGCCCCGGG - Exonic
1163666592 19:18606572-18606594 GGACGCAGAGCAGCAGCAGCAGG + Exonic
1164617222 19:29674472-29674494 GGCCGCCCAGCAGCGGCAGGAGG + Exonic
1165227434 19:34365039-34365061 GGCCCCAGATCAGCGGCCGCGGG + Intronic
1166734388 19:45075801-45075823 GGTCTGCAGGCAGCGGCCGCAGG + Exonic
925899066 2:8495572-8495594 GGTCGAGGAGCAGCTGCAGCTGG - Intergenic
935591862 2:104852460-104852482 CGCAGCCGAGGAGCGGCCGCCGG - Intergenic
936433287 2:112482302-112482324 GGCCGCCGGGCAGCCGCCGCAGG - Exonic
946178761 2:217937654-217937676 GGACGCCCAGCAGAGGCCCCGGG + Intronic
947119407 2:226799803-226799825 GGCAGCCGGGCAGCCGCCGCCGG + Intergenic
947641660 2:231710533-231710555 GCTCGCCGGACAGCGGCCGAGGG + Intronic
948479162 2:238239648-238239670 GGGCGCCGAGGTGCGGCGGCCGG - Exonic
1171481969 20:25460994-25461016 GGCAGCCGAGCAGGGGCCTCAGG - Intronic
1172480258 20:35267308-35267330 GGTCCCCGAGGGGCGGCCGAGGG - Exonic
1176083991 20:63287677-63287699 AGTCCCCGAGCAGCGACAGCTGG + Exonic
1176143686 20:63556026-63556048 GGTCCCCGAGCAGCAGGAGCTGG - Exonic
1176869968 21:14076328-14076350 GGTTGCCGAGGAGCGGTCACCGG - Intergenic
1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG + Exonic
1179971486 21:44838442-44838464 GGTCGCTGAGCAGGGGCCTGGGG + Intergenic
1180163281 21:46007379-46007401 GGCCACGGAGCAGGGGCCGCAGG - Intergenic
1180342426 22:11629053-11629075 GGTCGGCGTGCAGCGCGCGCAGG + Intergenic
1180801562 22:18634325-18634347 GGTCAGCGAGCGGCGGCTGCAGG + Intergenic
1180965135 22:19784302-19784324 GAGCGCCCAGCAGCGGCGGCGGG + Exonic
1181030961 22:20148769-20148791 GGGCGCCCAGCAGCAGCCTCAGG + Exonic
1181220160 22:21360936-21360958 GGTCAGCGAGCGGCGGCTGCAGG - Intergenic
1182692880 22:32176064-32176086 TGTCGGCGGGCAGCGGCAGCCGG - Intergenic
1183691040 22:39388614-39388636 TCTCGCTGAGCAGCGGCCTCAGG - Intergenic
1185055301 22:48575978-48576000 CGACGCCGAGCAGCGGGCGGTGG + Intronic
950765438 3:15269775-15269797 CCTGGCCGAGCAGCGGCTGCTGG - Exonic
951231665 3:20186374-20186396 GGTCGCCGAGACCCGACCGCAGG - Intergenic
954540817 3:51392005-51392027 GGTCGTAGAGCAGCAGCTGCCGG - Exonic
960096756 3:113696674-113696696 GCTTGCTGAGCTGCGGCCGCGGG - Intergenic
961081658 3:124033401-124033423 TGTCCCCCAGCAGCGGCAGCTGG - Intergenic
964786289 3:160399898-160399920 GGCCGCCGGGGAGCGGCCGAGGG - Intronic
968225299 3:196969049-196969071 GTTCGCCGAGGAGGGGCCGCCGG - Intronic
968450509 4:674041-674063 GGTCGCTGGGCAGAGGTCGCAGG + Intronic
969330764 4:6472427-6472449 GGTGGGCGGGCGGCGGCCGCGGG + Intronic
975585083 4:75940960-75940982 GGTCTCCAAGTTGCGGCCGCTGG - Exonic
982435150 4:155376708-155376730 GGTCGCGGAGAACTGGCCGCGGG - Intronic
982573295 4:157076477-157076499 GGGCGCCTGGCAGCGGCAGCCGG + Intronic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
1001576945 5:172770895-172770917 GCTCCCCCAGCAGCGCCCGCAGG + Exonic
1002029390 5:176416619-176416641 GGTCGCCGAGCAGCGGCCGCAGG + Intergenic
1002468362 5:179419752-179419774 GGACGCAGAGCAGTGTCCGCGGG + Intergenic
1003081284 6:3023789-3023811 CGTCACCGAGCAGCCGTCGCTGG + Intergenic
1006337398 6:33427876-33427898 GGTCGCCTAGCAACGGCGGCGGG + Intronic
1006458376 6:34144555-34144577 GGTTGCCGGGCTCCGGCCGCTGG + Intronic
1007423922 6:41735081-41735103 GGTCGCGGAGAAGCCGCCCCCGG + Intronic
1017282127 6:152636842-152636864 GGGCGCCGGGCCGCGGCCGCCGG - Intronic
1020008072 7:4792677-4792699 GGCCGCTGAGCCGGGGCCGCAGG + Intronic
1020796946 7:12687376-12687398 GGGAGCCGAGCAGCCGCTGCAGG - Exonic
1028621872 7:92835224-92835246 GGTAGCCGGGGAGCCGCCGCCGG + Intronic
1029449560 7:100633276-100633298 GGTCGGAGAGCAGCTGCCGCTGG - Exonic
1032456318 7:132075866-132075888 GGACGCCTAGCAAGGGCCGCAGG - Intergenic
1033418109 7:141182206-141182228 GCTCGCCGGGCAGCAGCCTCAGG + Intronic
1034188372 7:149195972-149195994 CGGCGCGGAGCAGCGGTCGCCGG + Intronic
1034197875 7:149262076-149262098 GGGCGCGGGGCGGCGGCCGCGGG + Intergenic
1036561443 8:9903296-9903318 GACCTCCGCGCAGCGGCCGCGGG - Intergenic
1037879452 8:22565846-22565868 GGCCCCGGAGCAGCGGCCCCCGG + Exonic
1038554160 8:28494677-28494699 GGTTGCCGAGCCGCGGGCTCAGG - Intronic
1042278343 8:67028560-67028582 GGTCGCCCAGCAACCGCCGCTGG - Intronic
1043844959 8:85152942-85152964 GGCCGCGGAGCAGGGGCTGCCGG - Intergenic
1044591404 8:93917162-93917184 GCTCGCGGATCGGCGGCCGCGGG + Exonic
1049288028 8:141787103-141787125 GGACGCCGATCAGCAGCCACAGG + Intergenic
1049439114 8:142601173-142601195 GGTTGCCCAGCAGCGGCAGCTGG - Intergenic
1049682079 8:143923784-143923806 GGCCGCCCAGAAGCGGCTGCAGG - Exonic
1051591128 9:18777442-18777464 GGTGACCGAGCAGCGGCGCCTGG + Exonic
1057869900 9:98709327-98709349 GGTCGGCGGGCAGCGGCAGCTGG - Intergenic
1058053233 9:100427087-100427109 CTTCCCCGAGCTGCGGCCGCCGG - Intergenic
1058492746 9:105519811-105519833 TGGCGGCGAGCGGCGGCCGCTGG + Intronic
1058861247 9:109119652-109119674 CGGCCCAGAGCAGCGGCCGCAGG + Exonic
1060096267 9:120793359-120793381 GGACCGGGAGCAGCGGCCGCAGG - Exonic
1060893488 9:127202900-127202922 GGCCGCAGGGCAGCGGCCGCAGG + Intronic
1061002945 9:127912665-127912687 GCTCGCGGACCAGCGGCTGCAGG + Exonic
1062325694 9:136011544-136011566 GGCCTCCGGGCCGCGGCCGCCGG + Exonic
1185892775 X:3835518-3835540 GGGCCCCGAGCAGCTGCGGCAGG - Intronic
1185897883 X:3873938-3873960 GGGCCCCGAGCAGCTGCGGCAGG - Intergenic
1185903002 X:3912369-3912391 GGGCCCCGAGCAGCTGCGGCAGG - Intergenic
1200249846 X:154547062-154547084 GGATGCAGAGCAGCGGCAGCGGG - Exonic