ID: 1002033567

View in Genome Browser
Species Human (GRCh38)
Location 5:176448359-176448381
Sequence CCGGCGGGTGACGGTGCGGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002033560_1002033567 5 Left 1002033560 5:176448331-176448353 CCGGATGTGGTTGTGGCTGAGGT 0: 1
1: 0
2: 1
3: 25
4: 197
Right 1002033567 5:176448359-176448381 CCGGCGGGTGACGGTGCGGACGG 0: 1
1: 0
2: 0
3: 4
4: 68
1002033557_1002033567 14 Left 1002033557 5:176448322-176448344 CCGTTCAGACCGGATGTGGTTGT 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1002033567 5:176448359-176448381 CCGGCGGGTGACGGTGCGGACGG 0: 1
1: 0
2: 0
3: 4
4: 68
1002033555_1002033567 21 Left 1002033555 5:176448315-176448337 CCGGCGGCCGTTCAGACCGGATG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1002033567 5:176448359-176448381 CCGGCGGGTGACGGTGCGGACGG 0: 1
1: 0
2: 0
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002033567 Original CRISPR CCGGCGGGTGACGGTGCGGA CGG Exonic
903263564 1:22143510-22143532 CCGGCGGGGGGCGGTGGGGGGGG - Intronic
906411641 1:45583918-45583940 CCGGCGGGGGACGGAGGGTATGG + Intronic
913254912 1:116944627-116944649 CCGGCTGGGGTCGGTGTGGACGG + Intronic
921039486 1:211416479-211416501 CCGGCGGGGGACGGCGGGGCAGG + Intergenic
922420979 1:225461069-225461091 CCAGCGGGGGATGGTGGGGAAGG + Intergenic
922917611 1:229271262-229271284 CCGGCGCGTCTCGGTGGGGAAGG - Exonic
1063093598 10:2890106-2890128 GCGGCGGGAGATGGGGCGGAAGG + Intergenic
1063446556 10:6121523-6121545 GCGGCGGGCAACGGTGCGGGGGG + Intergenic
1076094444 10:127719987-127720009 CAGGCTGGTGAGGGTGGGGAAGG - Intergenic
1082854176 11:57791645-57791667 CCGGCGGGTGAGTGTGCCGTTGG - Exonic
1083762596 11:64826795-64826817 CTGTTGGGTGACAGTGCGGAGGG + Intronic
1083782262 11:64924710-64924732 GCGGCGGGTGCCGGTGCGCACGG + Exonic
1092726513 12:11491526-11491548 CTGGGGGGTGTCGGTGGGGAGGG + Intronic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1101131727 12:101697599-101697621 CCGGCTGGGGGCGGGGCGGAGGG - Intronic
1102008950 12:109606411-109606433 CCTGCGGGTGGCGGGGCGGCAGG + Intergenic
1104944385 12:132409219-132409241 CCGTCTGGGGACGGTGTGGACGG - Intergenic
1105472037 13:20703621-20703643 CCCGGGGGTGAGGGTGCGGCGGG + Intronic
1112012197 13:95301584-95301606 CCGACGGGTGACGCGGCGGGAGG + Intergenic
1116233600 14:42249509-42249531 CCGGCGGGTGGGGGTGGGGTCGG - Intergenic
1122804664 14:104250351-104250373 CCGGGGGGTGATGGTGAGGGTGG + Intergenic
1123038636 14:105481481-105481503 CCGGGGCCTGACGTTGCGGAAGG + Intergenic
1123040069 14:105486825-105486847 CGGGCGGGTGCCGGTGGGGTAGG + Intergenic
1132579197 16:677424-677446 GCGGCGGGTGAGGGTGCAGCCGG - Intronic
1134682851 16:16138510-16138532 CCGGTGGGCGATGGTGAGGACGG - Exonic
1134795914 16:17036824-17036846 CCGCCGGGTGACGGTGGGGCAGG - Intergenic
1141533424 16:84662155-84662177 CTGGGAGGTGACGGTGAGGATGG - Exonic
1142553003 17:752404-752426 CGGGCAGGGGACGGTGCGGAGGG - Intronic
1146022933 17:29293987-29294009 GCTGAGGGTGATGGTGCGGATGG + Exonic
1147661480 17:42119325-42119347 CCGGCGGGTAACGGTGAAAATGG + Exonic
1148562289 17:48613057-48613079 GCGGCGGGGGACGCTGCGGTGGG + Exonic
1152941571 17:83175526-83175548 CCTGAGGGTGACTGTGAGGAAGG - Intergenic
1155514296 18:26608594-26608616 CTGGGGGGTGACAGTGCAGAGGG - Intronic
1161063596 19:2227152-2227174 CCGGCGGGGGCCGGGGCGGGGGG - Intronic
1161073485 19:2273874-2273896 CCGGCAGGTGGCGCTGCGGCCGG - Intronic
1165883241 19:39058227-39058249 CCTGGGGGTGACGGTGGGGGAGG + Intergenic
1167278329 19:48552228-48552250 CAGGTGGGTGAGGGTGGGGAGGG - Exonic
926095783 2:10080097-10080119 CCGGCGGGTGCCGGTGGCGGCGG - Exonic
938380174 2:130832066-130832088 CCTGCGGGTGAGGGTGGGGCGGG + Intergenic
946306408 2:218859356-218859378 GGGGCGGGGGGCGGTGCGGAGGG - Intergenic
1172245585 20:33443344-33443366 GCGCCGCGTGACGGTGCGCAAGG - Exonic
1175441284 20:58993995-58994017 CCGGCCGGTGGGGGTGGGGAGGG + Intronic
1175532628 20:59684662-59684684 CCTGCGGGTGAGGTTGTGGAGGG - Intronic
1176023131 20:62972813-62972835 CAGGCTGGGGACGGAGCGGATGG - Intergenic
1179412006 21:41168911-41168933 CCAGCGGGAGACGGAGCGGTGGG + Intronic
1179824059 21:43954211-43954233 CAGAAGGGTGACGGTGAGGAAGG - Intronic
1180200659 21:46222178-46222200 CAGGCGGGTCACGGTGAGGAAGG - Intronic
1183482472 22:38072637-38072659 CTGGCGTGTGAGGGTGGGGAGGG + Intronic
950386419 3:12663880-12663902 GCGGCGGGTGAGGGAGCGGGAGG + Exonic
954129716 3:48554218-48554240 CCGGAGGGTGTGGGTGGGGATGG - Intronic
958942977 3:100335034-100335056 GCGGCGGGTGCCGGCGCGGCCGG - Intronic
968348066 3:198028091-198028113 CAGGATGCTGACGGTGCGGAAGG - Intronic
969342045 4:6548375-6548397 CCGGCTGGTGGCTGTGAGGATGG - Intronic
969342373 4:6550235-6550257 CCGGCTGGTGGCTGTGAGGAGGG - Intronic
981301018 4:143185501-143185523 CAAGCGGGTGATTGTGCGGAAGG + Exonic
1001296691 5:170503885-170503907 CCGGCAGATGAGGGTGCGCAGGG + Intronic
1002033567 5:176448359-176448381 CCGGCGGGTGACGGTGCGGACGG + Exonic
1002282119 5:178137212-178137234 GCGGCGGGTGAGGGTGAGGCAGG + Intronic
1002817257 6:692815-692837 CAGGCGGCTGACGGCGGGGATGG + Intronic
1014272525 6:119349811-119349833 CCGGAGAGTGACGGCGCGGCCGG + Intergenic
1021261410 7:18462192-18462214 CTGGCGGGTGACTGTGAAGATGG - Intronic
1029405936 7:100373948-100373970 CCTGTGGGTGAAGGTGCGGGAGG + Intronic
1030820186 7:114084987-114085009 CCGGAGGGAGACGGCGGGGAGGG + Intergenic
1033199940 7:139359956-139359978 CTGGCGGGTGGCGGTGTTGAAGG + Exonic
1034349651 7:150407645-150407667 CCTGCGGGGGACGGGGAGGAGGG + Intronic
1034383725 7:150720724-150720746 CCGGCGGGTGGCGGAGCGCGTGG + Exonic
1041008313 8:53516954-53516976 CCTGCGGGAGAGGGTGGGGAAGG + Intergenic
1041062148 8:54044575-54044597 CTGGGGGGTGACGGGGTGGAAGG + Intergenic
1046108170 8:109691411-109691433 GGGCCGGGTGCCGGTGCGGACGG + Exonic
1050287437 9:4118064-4118086 CCGGGTGGTGAAGGTGCGCATGG + Exonic
1060700971 9:125748096-125748118 CTGGCGGGTCCGGGTGCGGACGG + Intronic
1062036291 9:134384132-134384154 CCCGGGGGTGACAGTGTGGAGGG - Intronic
1203771496 EBV:52121-52143 CCGGCCGGTAACGGTGCCGTAGG + Intergenic