ID: 1002034315

View in Genome Browser
Species Human (GRCh38)
Location 5:176454888-176454910
Sequence TGTCAGGAATACAACTTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002034315_1002034318 16 Left 1002034315 5:176454888-176454910 CCAGTCAAGTTGTATTCCTGACA 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1002034318 5:176454927-176454949 GCTCCCAAACTAGTGTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002034315 Original CRISPR TGTCAGGAATACAACTTGAC TGG (reversed) Intronic
905934085 1:41810026-41810048 AGTCAGGTATAAAACTTGACTGG - Intronic
913047522 1:115087217-115087239 TGTCAGAAATACAAATTCTCAGG - Intronic
918937955 1:190949039-190949061 TAACAGGAATAGAACTTGAAGGG - Intergenic
919578967 1:199347755-199347777 TGCCAAGAATACATCTTCACAGG + Intergenic
1064924217 10:20552122-20552144 TGTCAGGAAAACCACTTACCTGG + Intergenic
1065987217 10:30966826-30966848 TGTCTGGAATACAGTTTTACAGG - Intronic
1068144226 10:53045600-53045622 AGGCAGGCAGACAACTTGACAGG - Intergenic
1069001707 10:63274130-63274152 TAGGAGGAATTCAACTTGACTGG + Intronic
1069233231 10:66038052-66038074 TGTCTGTAATACAACTCCACAGG + Intronic
1069528724 10:69198838-69198860 TTTCAGGACTACAACTTAAAAGG - Intronic
1070976668 10:80610779-80610801 TGTAAGAAATAAACCTTGACTGG - Intronic
1074136772 10:110634359-110634381 TTAGAGGAATACAAATTGACAGG + Intergenic
1078361198 11:10669189-10669211 TGTCAGGAATGCAAATTCATGGG - Intronic
1084175828 11:67421591-67421613 TGTCAGGAATTCAACCTCAAAGG - Intronic
1085965971 11:81526839-81526861 AGCCAGGAATACAACTAGCCAGG - Intergenic
1085977989 11:81683406-81683428 TGTCAGGAATAATAATTGAAAGG - Intergenic
1086398906 11:86444831-86444853 TTTCAGAAATATAACTTGCCAGG + Intronic
1086905263 11:92411478-92411500 TGTAAGAAATACAATTTCACAGG + Intronic
1087660132 11:100977615-100977637 TGTCAGGAAAACAAAATGAAAGG - Intronic
1089887626 11:121843342-121843364 TGTTAGGACTACAACAAGACAGG + Intergenic
1090533418 11:127614835-127614857 AGTCAGGAGTCCAGCTTGACTGG - Intergenic
1093084675 12:14853330-14853352 TGTCTGGAATTCATCTAGACTGG - Intronic
1093115726 12:15208344-15208366 TGACAGGAATGCAACATGACCGG - Intronic
1094707761 12:32931258-32931280 TGTCAGGGATACATTGTGACTGG - Intergenic
1098618313 12:72557795-72557817 TGTCAGGCATATAACTTGAATGG - Intronic
1098810128 12:75077401-75077423 TTTCAGTAATATAACTTCACAGG + Intronic
1100062441 12:90597234-90597256 TTTCAGGAACATAACTTGAATGG + Intergenic
1100144304 12:91658645-91658667 TGTAAGGAATAAAATTTGACTGG - Intergenic
1100333767 12:93610425-93610447 TGTCAGAAATACAAACTCACAGG - Intergenic
1103732339 12:123036239-123036261 TCTCAGGAATACCAGTAGACAGG + Intronic
1104862653 12:131932234-131932256 TTTCAGGAATACAGCCTGACCGG - Exonic
1108194013 13:47973245-47973267 TTTCAGGAATACAACATACCTGG + Exonic
1108221386 13:48236831-48236853 TGTCAGCAAAACAACTTGCAGGG - Intronic
1108799659 13:54079880-54079902 AGTCAGGTATACAACTGGTCAGG + Intergenic
1108875215 13:55039366-55039388 TGTAAGTGGTACAACTTGACTGG - Intergenic
1110535079 13:76641940-76641962 TGGTAGGAAAACAACTTGAGAGG + Intergenic
1115122350 14:29952336-29952358 TATAAGGAATTCAACATGACTGG - Intronic
1116216332 14:42022039-42022061 TCTCTGGAAAACAACTTTACTGG - Intergenic
1117348757 14:54860245-54860267 TGTCAAGAGTTCAACTTCACAGG - Intronic
1126379991 15:48036676-48036698 TGACAGGAAAACAAATTGAAAGG - Intergenic
1132849221 16:2016926-2016948 TGTCAGGAAAACACTGTGACAGG - Intronic
1134389511 16:13806470-13806492 TTTCACATATACAACTTGACAGG - Intergenic
1137898341 16:52238012-52238034 GGTCAGGAATAGCACGTGACTGG - Intergenic
1138453730 16:57108789-57108811 TGTCAGTAATTAACCTTGACTGG + Intronic
1144285528 17:13770397-13770419 GGGCAGGAATACAAGCTGACTGG - Intergenic
1146410500 17:32579538-32579560 TTTAAGGTATACAATTTGACAGG + Intronic
1149234743 17:54577109-54577131 GGTCAAGAATAGAACATGACTGG + Intergenic
1150370278 17:64631561-64631583 GGTGAGGAACACACCTTGACTGG + Intronic
1151387169 17:73762120-73762142 TGTTAGGAATACAAATTCTCTGG - Intergenic
1156656802 18:39298156-39298178 TATAAAGAATACAACTTGGCCGG + Intergenic
1160609837 18:80076359-80076381 TTTCAGGAAAACAAATTCACGGG + Intronic
1163004884 19:14390904-14390926 TGTCTGGAACACAACAGGACAGG - Exonic
1163062783 19:14772495-14772517 TGTCTGGAACACAACAGGACAGG + Exonic
1167138365 19:47632244-47632266 TTTCTGGAATGCAACTTGGCGGG - Intronic
930257895 2:49112891-49112913 TGTCAGGAATAAAAGTTCTCAGG - Intronic
935291532 2:101614712-101614734 TGACAGGAATACATTTTGAGAGG + Intergenic
937524137 2:122746525-122746547 TCTATGGAATACTACTTGACTGG - Intergenic
941448390 2:165629242-165629264 TGTCAGGAGAACAACTTGGTGGG - Intronic
943846626 2:192657201-192657223 TTTCAGAAGTACAACTTTACAGG + Intergenic
1171150673 20:22824130-22824152 TTTCCAGAATACAACTCGACTGG - Intergenic
1171247795 20:23626760-23626782 TGTCAGGACTTCAACTTGCAAGG + Exonic
1172046022 20:32080776-32080798 TGTCAGGACTACAAAGTGTCAGG + Intronic
1175596847 20:60241496-60241518 TATCAGCAACACAACTTGAAAGG - Intergenic
1176009245 20:62883348-62883370 TGTCAGAATTACAACTAGACAGG + Intronic
1182678979 22:32063559-32063581 TGTCAGGAAGACCACCTGACAGG + Intronic
1183283718 22:36949304-36949326 TTACATGAATACATCTTGACAGG + Intergenic
1184544243 22:45155392-45155414 TGTCAGGGGTACAGCTTGACTGG + Intergenic
954811915 3:53253896-53253918 TGTCAGGAATGCTTCTTGGCAGG - Intronic
957341919 3:78910893-78910915 TGTTAGAAATACAAATTAACAGG + Intronic
961065370 3:123870573-123870595 TCTCAAGAATACAACTTGTCTGG + Intronic
962165880 3:133047358-133047380 TGTCAGAAATAGCACTTGGCTGG + Intronic
962625172 3:137219032-137219054 TGTTAGAAATACAACTTCTCAGG + Intergenic
963433344 3:145236982-145237004 TGTGAGGCATACAAATTGTCCGG - Intergenic
964772239 3:160236488-160236510 AGTCAGGAAGAAAACCTGACAGG - Intronic
966022147 3:175227197-175227219 TGTTAGGAATACTACATGCCTGG + Intronic
968787805 4:2636919-2636941 TCTCAGAAATGCAACTTTACTGG + Intronic
971385527 4:26137835-26137857 TCTCAGGAATGCATATTGACTGG + Intergenic
972181843 4:36476260-36476282 TTGAAGGAATACAACTTCACAGG + Intergenic
974627021 4:64439193-64439215 TTTCAGGAATACAAATTAAGTGG - Intergenic
975482703 4:74899327-74899349 GGTCAGGAATAGAACTTTAATGG - Intergenic
977657886 4:99543788-99543810 TGTTATGAGAACAACTTGACTGG - Intergenic
977667173 4:99654530-99654552 TGCCAGGCAAACAACTGGACAGG - Exonic
977760535 4:100730803-100730825 AGTGAGGAATACAAGTAGACTGG + Intronic
978154132 4:105470870-105470892 AGTCAGGACTACAACTTAAGTGG + Intronic
983029161 4:162777529-162777551 TGTCTGAAATAAAACTTGATTGG + Intergenic
983055130 4:163093154-163093176 TGTCAGGAATACTGATTGTCAGG + Intergenic
983413630 4:167427546-167427568 TGTCAGAAATACAAATTCTCAGG - Intergenic
987596347 5:20004348-20004370 TGTGAGGAATACAGGATGACAGG - Intronic
988621645 5:32829541-32829563 TGTGAGGAAAGCAACTAGACTGG + Intergenic
991173494 5:63657223-63657245 TGTCAGGAATAGAAATTGTAGGG - Intergenic
993001774 5:82388125-82388147 TGTCTGGAATACAATTTAATAGG - Intergenic
994607926 5:101994498-101994520 TGTCAAAAGTACAATTTGACAGG + Intergenic
997906075 5:137818636-137818658 TGTCAGGCAGATAACTTGGCGGG - Intergenic
1000762358 5:165242038-165242060 TGTCATGAATAAGACTTGAAAGG + Intergenic
1002034315 5:176454888-176454910 TGTCAGGAATACAACTTGACTGG - Intronic
1007657834 6:43462923-43462945 TTTCAGGGATAAAGCTTGACTGG - Intergenic
1013845678 6:114447959-114447981 TGTGGGGATTACAATTTGACAGG + Intergenic
1014175451 6:118326574-118326596 TGTCAGAAATACTTCTTGAGTGG - Intergenic
1017363569 6:153605154-153605176 TGGCAGCAATTCATCTTGACTGG - Intergenic
1021017779 7:15556512-15556534 TATCAGGAATAAAACTTCTCTGG + Intronic
1021816397 7:24451438-24451460 TGTCTGCAATGCAGCTTGACTGG + Intergenic
1027550799 7:79592127-79592149 TTTCAGGAATAGAAATTGAATGG + Intergenic
1029104118 7:98160936-98160958 TGACAGAAATATAATTTGACAGG - Intronic
1032006476 7:128305867-128305889 TGAGAGGAATAAAACTGGACAGG + Exonic
1037426765 8:18764161-18764183 TGTCAGAAATGAAAGTTGACAGG - Intronic
1037514753 8:19619310-19619332 TGTGAGGAATACAATATGGCTGG + Intronic
1041752525 8:61276452-61276474 TGCCAGAAGTACAACTTTACTGG - Intronic
1044466506 8:92512921-92512943 TGTCATGAACACAACTGGCCTGG - Intergenic
1048911976 8:139143864-139143886 GGTCATTAATACAACTAGACAGG - Intergenic
1049973306 9:840052-840074 TGTCAGGAGTAGAGCTTCACTGG + Intergenic
1051225507 9:14894918-14894940 TTTAAGGAATTAAACTTGACTGG + Intronic
1054447470 9:65384650-65384672 TGTCAGGAAAACAAAGGGACTGG + Intergenic
1057095457 9:92304021-92304043 TATCAGAAATACCACTAGACTGG + Intronic
1060040789 9:120298852-120298874 TTTCTGGAAAACAAATTGACTGG + Intergenic
1060291523 9:122307281-122307303 TGTCAGGAATGTATCTTGATAGG + Intronic
1062438612 9:136558531-136558553 TGTGGGGATTACAACTTGATTGG - Intergenic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1192528152 X:71865705-71865727 TGTCAGCAATACATCTCGAAAGG - Intergenic
1198805984 X:140495299-140495321 TTTCAAAAAAACAACTTGACTGG + Intergenic