ID: 1002038444

View in Genome Browser
Species Human (GRCh38)
Location 5:176491990-176492012
Sequence TGTTATTCTATTGCCTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002038444_1002038445 -8 Left 1002038444 5:176491990-176492012 CCTGAACAGGCAATAGAATAACA 0: 1
1: 0
2: 0
3: 10
4: 219
Right 1002038445 5:176492005-176492027 GAATAACACTTGCTGCTTTATGG 0: 1
1: 0
2: 1
3: 20
4: 160
1002038444_1002038446 17 Left 1002038444 5:176491990-176492012 CCTGAACAGGCAATAGAATAACA 0: 1
1: 0
2: 0
3: 10
4: 219
Right 1002038446 5:176492030-176492052 TTTGAACCAGACTCTACTCTCGG 0: 1
1: 0
2: 1
3: 15
4: 195
1002038444_1002038448 26 Left 1002038444 5:176491990-176492012 CCTGAACAGGCAATAGAATAACA 0: 1
1: 0
2: 0
3: 10
4: 219
Right 1002038448 5:176492039-176492061 GACTCTACTCTCGGATTTGATGG 0: 1
1: 0
2: 1
3: 5
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002038444 Original CRISPR TGTTATTCTATTGCCTGTTC AGG (reversed) Intronic