ID: 1002038446

View in Genome Browser
Species Human (GRCh38)
Location 5:176492030-176492052
Sequence TTTGAACCAGACTCTACTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002038444_1002038446 17 Left 1002038444 5:176491990-176492012 CCTGAACAGGCAATAGAATAACA 0: 1
1: 0
2: 0
3: 10
4: 219
Right 1002038446 5:176492030-176492052 TTTGAACCAGACTCTACTCTCGG 0: 1
1: 0
2: 1
3: 15
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002038446 Original CRISPR TTTGAACCAGACTCTACTCT CGG Intronic