ID: 1002045182

View in Genome Browser
Species Human (GRCh38)
Location 5:176537417-176537439
Sequence TCAGGGCGGAGCTCCCGGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002045182_1002045189 16 Left 1002045182 5:176537417-176537439 CCGCGCCGGGAGCTCCGCCCTGA 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1002045189 5:176537456-176537478 GCGACCACGCACGTGACTAGTGG 0: 1
1: 0
2: 0
3: 3
4: 16
1002045182_1002045190 17 Left 1002045182 5:176537417-176537439 CCGCGCCGGGAGCTCCGCCCTGA 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1002045190 5:176537457-176537479 CGACCACGCACGTGACTAGTGGG 0: 1
1: 0
2: 0
3: 0
4: 10

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002045182 Original CRISPR TCAGGGCGGAGCTCCCGGCG CGG (reversed) Exonic