ID: 1002045873

View in Genome Browser
Species Human (GRCh38)
Location 5:176541624-176541646
Sequence AAGCAGAGGCAGGAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002045858_1002045873 13 Left 1002045858 5:176541588-176541610 CCCCAGGCCTCCTCTGCAGTGGG No data
Right 1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG No data
1002045862_1002045873 11 Left 1002045862 5:176541590-176541612 CCAGGCCTCCTCTGCAGTGGGGA No data
Right 1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG No data
1002045855_1002045873 17 Left 1002045855 5:176541584-176541606 CCTCCCCCAGGCCTCCTCTGCAG No data
Right 1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG No data
1002045865_1002045873 6 Left 1002045865 5:176541595-176541617 CCTCCTCTGCAGTGGGGAAGGGC No data
Right 1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG No data
1002045856_1002045873 14 Left 1002045856 5:176541587-176541609 CCCCCAGGCCTCCTCTGCAGTGG No data
Right 1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG No data
1002045866_1002045873 3 Left 1002045866 5:176541598-176541620 CCTCTGCAGTGGGGAAGGGCTTG No data
Right 1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG No data
1002045860_1002045873 12 Left 1002045860 5:176541589-176541611 CCCAGGCCTCCTCTGCAGTGGGG No data
Right 1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG No data
1002045854_1002045873 24 Left 1002045854 5:176541577-176541599 CCGGCTTCCTCCCCCAGGCCTCC No data
Right 1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002045873 Original CRISPR AAGCAGAGGCAGGAAGAGGA GGG Intergenic
No off target data available for this crispr