ID: 1002047660

View in Genome Browser
Species Human (GRCh38)
Location 5:176550845-176550867
Sequence CCGTGGACTGCTCTGAGATG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 175}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002047657_1002047660 0 Left 1002047657 5:176550822-176550844 CCAAATTCTAGAAAATCTTGGCA 0: 1
1: 0
2: 1
3: 21
4: 275
Right 1002047660 5:176550845-176550867 CCGTGGACTGCTCTGAGATGCGG 0: 1
1: 0
2: 0
3: 17
4: 175
1002047655_1002047660 9 Left 1002047655 5:176550813-176550835 CCAGTGGTTCCAAATTCTAGAAA 0: 1
1: 0
2: 1
3: 16
4: 260
Right 1002047660 5:176550845-176550867 CCGTGGACTGCTCTGAGATGCGG 0: 1
1: 0
2: 0
3: 17
4: 175
1002047654_1002047660 10 Left 1002047654 5:176550812-176550834 CCCAGTGGTTCCAAATTCTAGAA 0: 1
1: 0
2: 0
3: 10
4: 177
Right 1002047660 5:176550845-176550867 CCGTGGACTGCTCTGAGATGCGG 0: 1
1: 0
2: 0
3: 17
4: 175
1002047651_1002047660 25 Left 1002047651 5:176550797-176550819 CCGGGTATCCTCACTCCCAGTGG 0: 1
1: 0
2: 0
3: 27
4: 193
Right 1002047660 5:176550845-176550867 CCGTGGACTGCTCTGAGATGCGG 0: 1
1: 0
2: 0
3: 17
4: 175
1002047653_1002047660 17 Left 1002047653 5:176550805-176550827 CCTCACTCCCAGTGGTTCCAAAT 0: 1
1: 0
2: 1
3: 27
4: 286
Right 1002047660 5:176550845-176550867 CCGTGGACTGCTCTGAGATGCGG 0: 1
1: 0
2: 0
3: 17
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002047660 Original CRISPR CCGTGGACTGCTCTGAGATG CGG Intronic
900146422 1:1160798-1160820 CCGTGGGCTGCTCTGAGCCCCGG - Intergenic
900795957 1:4708562-4708584 CCTTGGGCGGCTCTGAGATGAGG - Intronic
902146479 1:14405138-14405160 CCTTGGTCTGCTCTGAGCAGTGG - Intergenic
904494406 1:30878546-30878568 CCGTGGGCTTCTCAGAGTTGAGG + Intronic
905032918 1:34899772-34899794 CAGTGGACTGCTAGGAGGTGGGG + Intronic
905794611 1:40808567-40808589 CTGGGGACTGCTCTGGGAAGAGG - Intronic
906375158 1:45290535-45290557 CCGGGGACTGTTGTGGGATGGGG + Intronic
907648092 1:56264476-56264498 CTGCGGAGTGCTCTGAGTTGTGG - Intergenic
910267384 1:85352201-85352223 CTGTGCACAGCTCTGGGATGTGG - Intronic
913092125 1:115483495-115483517 CCTTGTACTTCTGTGAGATGGGG + Intergenic
913189087 1:116398271-116398293 CCGTGGAGTCATCTGATATGGGG + Intronic
913237421 1:116796940-116796962 CTGTGTGCTGCCCTGAGATGTGG + Intergenic
913647331 1:120871014-120871036 CTGTGGCCTGCTCTGTGGTGGGG - Intergenic
914399892 1:147308632-147308654 CCGGGGACTGTTGTGGGATGGGG + Intergenic
914907911 1:151761852-151761874 CCATGGAATAGTCTGAGATGAGG - Intronic
915621698 1:157090189-157090211 CCTTGGAATCCTCTGAGAGGAGG - Intergenic
916818255 1:168373794-168373816 CCGGGGACTGTTGTGGGATGGGG + Intergenic
916820868 1:168397471-168397493 CCGGGGACTGCTCTGAGAATTGG + Intergenic
916835590 1:168541712-168541734 CTGTGCACAGCTCTGAGATCTGG - Intronic
921259330 1:213371768-213371790 CAGTGGCCTGCACTGAAATGGGG + Intergenic
921726371 1:218528470-218528492 CCATGAACTGCTCTGAGGTATGG - Intergenic
922856062 1:228775583-228775605 CCGTATAGTGTTCTGAGATGTGG - Intergenic
924024534 1:239818515-239818537 CCATGGACTGCACTGAGAGCAGG - Intronic
924250041 1:242123571-242123593 ACTTGCACAGCTCTGAGATGTGG + Intronic
1063054609 10:2491166-2491188 CCGGGGACTGCTGTGGGGTGGGG - Intergenic
1065277502 10:24099743-24099765 CCGGGGACTGTTGTGGGATGGGG - Intronic
1072042928 10:91626637-91626659 ACATGGACTGCTCTGAGTTTGGG + Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077781028 11:5329925-5329947 CCGGGGACTGTTGTGAGGTGGGG - Intronic
1081499645 11:43653554-43653576 CCGGGGACTGTTGTGAGGTGGGG - Intronic
1091304427 11:134528461-134528483 CCTTGGACTGAGCTGTGATGTGG + Intergenic
1092970755 12:13692537-13692559 ACGTGCACAGCTTTGAGATGTGG - Intronic
1096934025 12:55249909-55249931 CCGGGGCCTGCTGTGAGGTGGGG - Intergenic
1097629563 12:62043450-62043472 CCGGGGACTGTTGTGAGGTGGGG + Intronic
1099625602 12:85069094-85069116 CCGGGGACTGTTGTGAGGTGGGG - Intronic
1099739265 12:86610746-86610768 CCGGGGACTGCTGTGGGGTGGGG - Intronic
1101215705 12:102579872-102579894 CCGGGGACTGTTGTGGGATGTGG + Intergenic
1113651920 13:112039556-112039578 GCAGGGACAGCTCTGAGATGAGG + Intergenic
1115867730 14:37766955-37766977 CTGGGGACTGCTGTGGGATGTGG - Intronic
1116307395 14:43275498-43275520 CTGTGAACTGCTCCGAGATGTGG - Intergenic
1116540410 14:46095573-46095595 CCGGGGACTGTTGTGGGATGGGG - Intergenic
1119965585 14:78912074-78912096 CCGGGGACTGTTGTGGGATGGGG - Intronic
1121274859 14:92660486-92660508 CCGTTGGCTGGTCTGGGATGGGG + Intronic
1123457379 15:20438628-20438650 CCGTGCAGTTCTCTGACATGCGG - Intergenic
1123660679 15:22561731-22561753 CCGTGCAGTTCTCTGACATGCGG + Intergenic
1123679012 15:22743547-22743569 CCGGGGACTGTTGTGGGATGGGG - Intergenic
1123981810 15:25611813-25611835 CCGTGGCCTGCTCTGGCATGTGG + Intergenic
1124263529 15:28213778-28213800 CCGTGCAGTTCTCTGACATGCGG - Exonic
1124314479 15:28655968-28655990 CCGTGCAGTTCTCTGACATGCGG + Intergenic
1124331224 15:28817848-28817870 CCGGGGACTGTTGTGGGATGGGG - Intergenic
1130818815 15:87469574-87469596 CTGTGGACTGTTGTGGGATGGGG + Intergenic
1132105902 15:99062415-99062437 CCCTGGATTGCTTTGAGATATGG - Intergenic
1132298534 15:100762342-100762364 CAGCGGAGTGCTCTGAGTTGAGG + Intergenic
1135181824 16:20281510-20281532 CAGTGCAAAGCTCTGAGATGGGG + Intergenic
1135683516 16:24479016-24479038 CCGTGGATCCCTCTGAGATTGGG + Intergenic
1136291264 16:29272938-29272960 ACTTGGCTTGCTCTGAGATGGGG - Intergenic
1136701882 16:32152150-32152172 CCGTGCAGTTCTCTGACATGCGG - Intergenic
1136765782 16:32775310-32775332 CCGTGCAGTTCTCTGACATGCGG + Intergenic
1136802316 16:33095068-33095090 CCGTGCAGTTCTCTGACATGCGG - Intergenic
1138205401 16:55120678-55120700 CCCTTGCCTGCTCTGAGCTGAGG - Intergenic
1138205594 16:55122209-55122231 CCCTGGTCTCCTCTGAGATCAGG - Intergenic
1140897986 16:79342123-79342145 CCCTGAACTTCTCTGAGATTCGG - Intergenic
1142097136 16:88246404-88246426 ACTTGGCTTGCTCTGAGATGGGG - Intergenic
1203068171 16_KI270728v1_random:1037558-1037580 CCGTGCAGTTCTCTGACATGCGG + Intergenic
1143894565 17:10126036-10126058 CAGAGGGCTGCTCTGCGATGGGG - Intronic
1148881282 17:50729623-50729645 CCGTGCACAGCTTTGGGATGTGG + Intronic
1150209375 17:63433831-63433853 CCCTGGGAAGCTCTGAGATGAGG - Exonic
1152901476 17:82943518-82943540 CCCTGGCCTGCTCTCAGGTGGGG + Intronic
1153028487 18:691929-691951 CCGTGGACAGCCCTGCGGTGTGG - Intronic
1153737012 18:8081731-8081753 CTGTGGATGGGTCTGAGATGGGG + Intronic
1153820843 18:8830147-8830169 CTGTGGGCTGCAGTGAGATGAGG + Intronic
1153850926 18:9093466-9093488 CCGGGGCCTGTTGTGAGATGGGG + Intergenic
1154327967 18:13405812-13405834 CCCTGTCCTGCTCTGAGCTGAGG + Intronic
1157327888 18:46682030-46682052 TGGTGTACTTCTCTGAGATGGGG + Exonic
1159408360 18:68036166-68036188 CCGTGGCCTCTTCTGAGATGTGG - Intergenic
1160460754 18:79036590-79036612 TCGTGGAAGGCTCTGAGATATGG - Intergenic
1160460806 18:79036886-79036908 TCGTGGAAGGCTCTGAGATATGG - Intergenic
1160460877 18:79037260-79037282 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460895 18:79037336-79037358 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460912 18:79037412-79037434 CCTTGGAAGGCTCTGAGATATGG - Intergenic
1160460930 18:79037488-79037510 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1166728888 19:45046510-45046532 GAGTGGACAGCGCTGAGATGGGG - Intronic
926924912 2:17977478-17977500 CCAGTGACTGCTCTGAGATGAGG + Intronic
927594343 2:24383784-24383806 CCGGGGACTGTTGTGGGATGGGG - Intergenic
927969802 2:27298406-27298428 CCGTGCGCTGCTCTCAGAGGTGG + Intronic
928180211 2:29063287-29063309 CTGAGCACTTCTCTGAGATGAGG + Exonic
928649406 2:33388906-33388928 CCCTTTACTGCTCTGGGATGTGG + Intronic
928802055 2:35107004-35107026 CTGGGGACTGCTGTGGGATGGGG - Intergenic
929576108 2:43053563-43053585 CCGTTGCCTGCTCTGGGATGGGG - Intergenic
933116918 2:78485463-78485485 CCGGGGACTGTTGTGGGATGGGG + Intergenic
935092517 2:99909324-99909346 CCGGGGACTGCTGTGGGGTGAGG + Intronic
936724681 2:115298812-115298834 CCATGGACTGCACTGAGCTAAGG + Intronic
938201213 2:129374494-129374516 CCGTGGACTGGTCAGAGAACAGG - Intergenic
939048697 2:137281557-137281579 CCGGGGACTGCTGTGGGGTGGGG - Intronic
941216209 2:162712799-162712821 CAGTGAACTGCTCTGACAAGTGG - Intronic
942543046 2:177034680-177034702 CCGGGGACTGTTGTGGGATGGGG - Intergenic
943925054 2:193765890-193765912 CCGGGGACTGTTGTGAGGTGGGG - Intergenic
944544747 2:200788083-200788105 CCCTGGATTTCTCTGAGCTGGGG + Intergenic
945217126 2:207445489-207445511 CTGTTGCTTGCTCTGAGATGTGG - Intergenic
945346489 2:208724181-208724203 CCGGGGACTGTTGTGGGATGGGG - Intronic
1170840506 20:19921517-19921539 CCAGGGACTGCTCTGAGCTGAGG + Intronic
1172609658 20:36240486-36240508 GCGTGGGCAGCTCTGAGAAGCGG - Exonic
1177640327 21:23836416-23836438 CCGTGGACAGCTCTGAGTGGTGG + Intergenic
1179116077 21:38493864-38493886 CCATAGACTGCTCTGATGTGCGG - Intronic
1179438148 21:41376027-41376049 CTGTGGCCTGCACTCAGATGAGG - Intronic
1180098326 21:45572078-45572100 CCAGGGACTGCTGTGAGAGGAGG + Intergenic
1181441592 22:22938807-22938829 CTGTGTACTCCTCTGTGATGTGG + Intergenic
1181757164 22:25032136-25032158 CTGGGGGCTGCTCTGAGGTGGGG + Intronic
1182588943 22:31364143-31364165 GAGAGGAGTGCTCTGAGATGGGG + Intergenic
1182993846 22:34794671-34794693 CCGGGGCCTGTTGTGAGATGGGG + Intergenic
1183484051 22:38079999-38080021 CCGCAGGCTGCACTGAGATGGGG - Intronic
950190780 3:10974776-10974798 CCGTGCAAAGCTCTGAGAGGAGG + Intergenic
950702996 3:14762912-14762934 CCGCTGAGTGCTCTGAGTTGTGG - Intronic
951123435 3:18956354-18956376 CCCTTGACAGCTCTGTGATGTGG - Intergenic
951835418 3:26977934-26977956 CCGGGGACTGTTGTGAGGTGGGG + Intergenic
953888355 3:46732903-46732925 ACGTGGACAACTCTGTGATGGGG - Intronic
954678841 3:52330684-52330706 CCGTGCCCTGTTCTCAGATGAGG + Intronic
955189758 3:56749513-56749535 CTGTGGACTGCTTTGATATGGGG - Intronic
955681950 3:61511604-61511626 CTGTGGACAGCTCTGGGAGGGGG + Intergenic
958204234 3:90369533-90369555 CTGGGGACTGCTCTGGGGTGGGG - Intergenic
960248053 3:115421479-115421501 CCGGGGACTGTTGTGAGGTGGGG - Intergenic
960968176 3:123120064-123120086 CTGATGGCTGCTCTGAGATGGGG - Intronic
961409978 3:126713328-126713350 CCGGGGACTGTTCAGAGTTGAGG + Intronic
962810018 3:138951603-138951625 CCGTGGGATGCTCTCAGAGGCGG + Exonic
965672313 3:171159246-171159268 CTGTGGACAGATCTGACATGTGG + Intronic
969882596 4:10187519-10187541 ACCTGGACTGCCCTTAGATGTGG + Intergenic
970857534 4:20666384-20666406 CTGTGAACTGCTCTCAGATTTGG + Intergenic
971002168 4:22335831-22335853 CCGTGGCCTGTTGTGGGATGGGG - Intergenic
971757804 4:30723140-30723162 CGCTGGACTCCTCTGTGATGGGG + Exonic
972904221 4:43724713-43724735 CCGGGGACTGTTGTGGGATGGGG + Intergenic
975439428 4:74394039-74394061 CCGGGGACTGTTGTGGGATGGGG + Intergenic
976065343 4:81180988-81181010 CCGGGGACTGCTGTGGGGTGGGG - Intronic
978255227 4:106685030-106685052 CCGGGGACTGCTGTGGGGTGGGG - Intergenic
987042284 5:14074292-14074314 CCTTGGCCTCCCCTGAGATGGGG - Intergenic
987470495 5:18321706-18321728 CCTTGGCCTGCTCTGAGGTATGG + Intergenic
987810059 5:22823220-22823242 CCGGGGACTGTTGTGAGGTGGGG + Intronic
989644519 5:43615629-43615651 CTGTGGACTGCTCTGAGTAAAGG - Intronic
990060664 5:51642598-51642620 CCGGGGACTGTTGTGGGATGGGG + Intergenic
990179741 5:53147036-53147058 CCGGGGACTGCTGTGGGGTGGGG + Intergenic
990603441 5:57384186-57384208 CCGGGGACTGTTGTGAGGTGGGG - Intergenic
991249625 5:64545251-64545273 CCGGGGCCTGTTGTGAGATGGGG + Intronic
995359634 5:111280673-111280695 CCGTGTAAATCTCTGAGATGTGG + Intronic
996408995 5:123136359-123136381 CCGAGAACTGCTGTGAGATATGG + Intronic
998349857 5:141493495-141493517 GCGGGGACTGCTCAGAAATGAGG - Intronic
1002047660 5:176550845-176550867 CCGTGGACTGCTCTGAGATGCGG + Intronic
1003510775 6:6778380-6778402 CCGGGGACTGCTATGGGGTGGGG + Intergenic
1003683419 6:8277942-8277964 GCGTGGACTGCGCAGGGATGTGG + Intergenic
1005086298 6:22010306-22010328 CTGTGCACAGCTCTGGGATGTGG + Intergenic
1005783888 6:29222191-29222213 CCGGGGACTGTTGTGAGGTGGGG + Intergenic
1006143922 6:31946994-31947016 CAGTGGATTGCTTTGAGAAGGGG - Exonic
1006795589 6:36730515-36730537 CCGTGGCCCACGCTGAGATGGGG + Intronic
1006819432 6:36879952-36879974 CAGTAGACTGCTCTGTGCTGTGG + Intronic
1007146661 6:39641480-39641502 CCGGGGACTGTTGTGAGGTGGGG + Intronic
1008453334 6:51679046-51679068 CCATGCCCTGCTCTGAGCTGTGG + Intronic
1010652655 6:78473167-78473189 CCGAGGACTGTTGTGAGGTGGGG + Intergenic
1011233935 6:85194155-85194177 CCGTGCACTGCTCAGAGAAGTGG - Intergenic
1013677544 6:112482488-112482510 CCAGGCACTGCCCTGAGATGTGG + Intergenic
1016610233 6:145980815-145980837 CCGTGGACTGTTGTGTGGTGGGG - Intergenic
1019117650 6:169778092-169778114 ACGTGCACAGCTCTGGGATGTGG + Intronic
1019121279 6:169806703-169806725 CTGTGGAGTGCTCTGTGTTGTGG - Intergenic
1022349574 7:29554945-29554967 CCCTGGACTGCTCTGAGTAAAGG + Intergenic
1026525140 7:71146706-71146728 CTTTAGACTGCTCTGACATGTGG + Intronic
1028366841 7:90041988-90042010 CCGGGGACTGTTGTGGGATGGGG - Intergenic
1030512809 7:110505380-110505402 CCTTGGACAGTTCAGAGATGTGG + Intergenic
1032348611 7:131139687-131139709 CAGTGGACTGCTCAGAGTTCAGG + Intronic
1033544166 7:142384931-142384953 CAGTGGAGTGGTGTGAGATGAGG - Intergenic
1033875913 7:145818222-145818244 CCGGGGACTGTTCTGGGGTGGGG - Intergenic
1035339941 7:158153719-158153741 CCGTGGTGTGCTCTGAGCAGTGG + Intronic
1035624031 8:1058379-1058401 CCATGCTCTGCTGTGAGATGCGG + Intergenic
1035993469 8:4518603-4518625 CCGGGGACTGCTGTGGGGTGGGG + Intronic
1038049584 8:23796250-23796272 TCCTGGACAGCTCTGAAATGGGG + Intergenic
1040428309 8:47311873-47311895 CCGGGGACTGTTGTGGGATGGGG - Intronic
1042076890 8:65006125-65006147 CCGGGGACTGTTGTGGGATGGGG + Intergenic
1042877772 8:73455519-73455541 CTCTGGACTGCCCTGAGCTGAGG - Intronic
1044976106 8:97667210-97667232 AGGTGGACTGCTTTGAGCTGAGG - Intronic
1046269460 8:111874632-111874654 CCGTGGACTGTTGTGGCATGGGG + Intergenic
1047714883 8:127586405-127586427 CCAGGGACAGCTCGGAGATGGGG - Intergenic
1053718625 9:40922421-40922443 CCGGGGACTGTTGTGAGTTGGGG + Intergenic
1056398928 9:86208409-86208431 CCAGGGAGTCCTCTGAGATGGGG + Intergenic
1059277003 9:113106080-113106102 CTGTCCACAGCTCTGAGATGTGG + Intergenic
1059279248 9:113118471-113118493 CTGTCCACAGCTCTGAGATGTGG - Intergenic
1060257336 9:122044012-122044034 CCGGGGACTGTTGTGGGATGAGG - Intronic
1061492906 9:130956151-130956173 CGGTTGTCTGCTCTGAGCTGAGG - Intergenic
1061625039 9:131836600-131836622 CCACCAACTGCTCTGAGATGAGG + Intergenic
1062267445 9:135693753-135693775 CAGTGGACTGCTCTCAGCTGGGG + Exonic
1203384606 Un_KI270438v1:12220-12242 CTGTGCCCTGCTCTCAGATGTGG - Intergenic
1189680661 X:43512828-43512850 CCATGGACTGCTGTGACATGTGG - Intergenic
1200753579 Y:6969158-6969180 CTGTGGACTTCTCTGGGCTGTGG + Intronic
1202360908 Y:24109527-24109549 CCGGGGACTGTTCTGGGGTGGGG - Intergenic
1202509870 Y:25560591-25560613 CCGGGGACTGTTCTGGGGTGGGG + Intergenic