ID: 1002048304

View in Genome Browser
Species Human (GRCh38)
Location 5:176554323-176554345
Sequence TCCTCCCACTGCAATCACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 287}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002048304_1002048308 6 Left 1002048304 5:176554323-176554345 CCATGGTGATTGCAGTGGGAGGA 0: 1
1: 0
2: 2
3: 21
4: 287
Right 1002048308 5:176554352-176554374 ATAAGGTGAGGACAACCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 127
1002048304_1002048309 10 Left 1002048304 5:176554323-176554345 CCATGGTGATTGCAGTGGGAGGA 0: 1
1: 0
2: 2
3: 21
4: 287
Right 1002048309 5:176554356-176554378 GGTGAGGACAACCCCACGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 90
1002048304_1002048310 17 Left 1002048304 5:176554323-176554345 CCATGGTGATTGCAGTGGGAGGA 0: 1
1: 0
2: 2
3: 21
4: 287
Right 1002048310 5:176554363-176554385 ACAACCCCACGGAAGGAAGAAGG No data
1002048304_1002048306 -6 Left 1002048304 5:176554323-176554345 CCATGGTGATTGCAGTGGGAGGA 0: 1
1: 0
2: 2
3: 21
4: 287
Right 1002048306 5:176554340-176554362 GGAGGAGCAGCCATAAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002048304 Original CRISPR TCCTCCCACTGCAATCACCA TGG (reversed) Intronic