ID: 1002048306

View in Genome Browser
Species Human (GRCh38)
Location 5:176554340-176554362
Sequence GGAGGAGCAGCCATAAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002048299_1002048306 16 Left 1002048299 5:176554301-176554323 CCAGGGAGGGAGGAAGCTGTTTC No data
Right 1002048306 5:176554340-176554362 GGAGGAGCAGCCATAAGGTGAGG No data
1002048304_1002048306 -6 Left 1002048304 5:176554323-176554345 CCATGGTGATTGCAGTGGGAGGA 0: 1
1: 0
2: 2
3: 21
4: 287
Right 1002048306 5:176554340-176554362 GGAGGAGCAGCCATAAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002048306 Original CRISPR GGAGGAGCAGCCATAAGGTG AGG Intronic