ID: 1002048308

View in Genome Browser
Species Human (GRCh38)
Location 5:176554352-176554374
Sequence ATAAGGTGAGGACAACCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002048299_1002048308 28 Left 1002048299 5:176554301-176554323 CCAGGGAGGGAGGAAGCTGTTTC No data
Right 1002048308 5:176554352-176554374 ATAAGGTGAGGACAACCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 127
1002048304_1002048308 6 Left 1002048304 5:176554323-176554345 CCATGGTGATTGCAGTGGGAGGA 0: 1
1: 0
2: 2
3: 21
4: 287
Right 1002048308 5:176554352-176554374 ATAAGGTGAGGACAACCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002048308 Original CRISPR ATAAGGTGAGGACAACCCCA CGG Intronic